RESUMO
Uniformly 32P-labeled bacteriophage T5 leucine tRNA has been isolated by two-dimensional gel electrophoresis from phage-infected E. coli cells. Its nucleotide sequence has been determined by conventional techniques using TLC on cellulose for oligonucleotide fractionation: pGGGGCUAUGCUGGAACDGmGDAGACAAUACGGCCUUAGm6AU psi CCGUAGCUUAAAUGCGUGGGAGT psi CGAGUCUCCCUAGCCCCACCAoh. This tRNA has anticodon sequence UAG, which can presumably recognize all the four leucine-specific codons (CUN). The main feature of T5 tRNALeu is the absence of the A10-C25 and C31-psi 39 pairing in the D and anticodon stems, respectively.
Assuntos
Aminoacil-RNA de Transferência/isolamento & purificação , Fagos T/genética , Sequência de Bases , Cromatografia em Camada Fina , Escherichia coli/genética , Conformação de Ácido Nucleico , Radioisótopos de Fósforo , RNA Viral/isolamento & purificaçãoRESUMO
Uniformly 32P-labeled phage-specific tRNAGln has been isolated from bacteriophage T5-infected Escherichia coli cells and its nucleotide sequence has been determined using thin-layer chromatography on cellulose to fractionate the oligonucleotides. The sequence is: pUGGGGAUUAGCUUAGCUUGGCCUAAAGCUUCGGCCUUUGAAG psi CGAGAUCAUUGGT psi CAAAUCCAAUAUCCCCUGCCAOH. The main feature of this tRNA is the absence of Watson-Crick pairing between the 5'-terminal base and the fifth base from its 3'-end. The structure of tRNA was confirmed by DNA sequencing of its gene.
Assuntos
RNA de Transferência , Fagos T/genética , Sequência de Bases , DNA Viral/genética , Genes , Genes Virais , Glutamina , Conformação de Ácido NucleicoRESUMO
One EcoRI-generated fragment (440 basepairs) and two EcoRI/HindIII fragments (220 and 960 basepairs) from the deletion region of T5 phage have been inserted into the phage lambda XIII and the plasmid pBR322 as vectors. Recombinant DNA molecules were studied by hybridization with in vivo 32P-labeled T5 4-5 S RNAs on nitrocellulose filters. Two-dimensional polyacrylamide gel electrophoretic fractionation and fingerprint analysis of the RNAs eluted from the filters were carried out to identify RNAs coded by cloned fragments. For the accurate localization of the genes for these RNAs, RNA-DNA hybrids were treated with T1 and pancreatic RNAases, and the eluted RNA fragments stable against RNAase action were electrophoresed. It was shown that the EcoRI 440 fragment contains the gene for tRNA 10 (tRNAAsp), the EcoRI/HindIII 220 fragment contains the gene for RNA III (107 bases) and parts of the genes for RNA I (107 bases) and tRNA 12 (tRNAHis), and the EcoRI/HindIII 960 fragment contains only a part of the gene for tRNA 9 (tRNAGln). The arrangement of these genes on the physical map of T5 phage was as follows: -tRNAGln-tRNAHis-RNA III-RNA I-...-tRNAAsp.
Assuntos
Clonagem Molecular , Escherichia coli/genética , Genes Virais , RNA Viral/genética , Fagos T/genética , Bacteriófago lambda/genética , Composição de Bases , Sequência de Bases , Enzimas de Restrição do DNA , DNA Recombinante/metabolismo , Desoxirribonuclease EcoRI , Hibridização de Ácido NucleicoRESUMO
By method of isoelectric focusing in polyacrylamide gel and sucrose density gradient it has been shown that rhodopsin preparation, obtained by different methods (including the rhodopsin with low content of lipids) are divided into a number of fractions with isoelectric points at the pH-range 5.4-6.0. The corresponding preparations of opsin show heterogeneity in pI, too. Heterogeneity in pI remains at denaturation conditions (8 M urea, 0.01% beta-mercaptoethanol, 1 mM EDTA). If separated in this system at least two protein components are detected. The nature of heterogeneity in pI found and its possible connection with complicated kinetics of the decay of early intermediate products of visual pigment are discussed.
Assuntos
Pigmentos da Retina , Rodopsina , Concentração de Íons de Hidrogênio , Focalização Isoelétrica , Lipídeos/análise , Desnaturação Proteica , Pigmentos da Retina/isolamento & purificação , Rodopsina/isolamento & purificação , EspectrofotometriaRESUMO
Kinetic analysis, electrophoresis and selective inactivation were used in studies of isozymic composition of LDH in the retina, cardiac and skeletal muscles in 8 species of marine teleost fishes. In the retina, the number of isoenzymes in all the fishes studied varied from 2 to 7, the predominant ones being B4 and E4. The isoenzyme E4 was found only in the retina of Hexagrammus octogrammus, Pleurogrammus monopterygius, Liopsetts pannifasciata, Limanda yokohamae, Eleginus gracilis, Therarga chalcogramma. In two last species, the electric charge of E4, B4 and A4 is opposite to that of the corresponding isoenzyme in terrestrial animals, resulting in opposite migration of these isoenzymes during electrophoresis. In the retina of fishes containing the isoenzyme E4, double heterotetramers B1E3, B2E2, B3E1 were also found. The retina in Leuciscus brandti, Clupea harengus harengus does not contain the isoenzyme E4. Investigation of the distribution pattern of the isoenzymes in cellular fractions of the retina in P. monopterygius revealed that hyaloplasm and nuclei contain A4, B4, B3E1, E2B2, E3B1 and E4, which corresponds to the situation found after the extraction of LDH from the whole retina tissue. In the mitochondria B4 and E4 were found, while in the outer segments--only B4. Skeletal muscles in all the fishes studied differ by the predominance of the isoenzyme A4 which is present as a sole component (P. monopterygius, H. octogrammus, L. pannifasciata, L yokohamae, L. brandti) or together with B4 (T. chalcogramma, C. harengus harengus). In the cardiac muscles of four species of fishes (except L. yokohamae, L. pannifasciata, H. octogrammus, P. monopterygius), the predominant isoenzyme was found to be B4, although the total number and the ratio of the isoenzymes varied: A4, A2B2, B4 (E. gracilis), A4B4 (T. chalcogramma, C. harengus harengus), A4, A3B1, A2B2, A1B3, B4 (L. brandti). The LDH in the heart of L. yokohamae, L. pannifasciata, H. octogrammus, P. monopterygius has only one isoenzyme A4.
