Diagnostic and prognostic value of double-negative T cells in colorectal cancer.

Objective: To evaluate the T-lymphocyte subset distribution and the diagnostic and prognosis value of double-negative T (DNT) cells in colorectal cancer (CRC). Methods: This retrospective study compared the T-lymphocyte subsets and DNT of 114 patients with CRC with those of 107 healthy controls (HC). The diagnostic potential of DNT and T-lymphocyte subsets was assessed using the receiver operating characteristic (ROC) curve, and prognostic values were evaluated using the Kaplan-Meier curve and the Cox regression model. Results: The percentages of CD8+ T cells and DNT cells, and value of carcinoembryonic antigen (CEA), were remarkably higher in patients with CRC than in those with HC, but the ratio of CD4+/CD8+ was decreased. Using ROC curve analysis, DNT cell percentage, CEA, and CD4+/CD8+ ratio all had good diagnostic efficacy, with areas under the curve (AUCs) of 0.865, 0.786 and 0.624, respectively. The combination of DNT cell percentage and CEA had an AUC of 0.905, which was significantly higher than that of any single biomarker (p < 0.05). In univariate analysis, the Tumor Node Metastasis (TNM) clinical stage, CD4+/CD8+ ratio, and DNT cell percentage were significantly associated with overall survival (OS) (p < 0.05). In multivariate analysis, TNM clinical staging (HR = 2.37, 95 % CI: 1.15-4.90), a decreased CD4+/CD8+ ratio (HR = 0.33, 95 % CI: 0.15-0.74), and an increased DNT cell percentage (HR = 2.29, 95 % CI: 1.11-4.73) were independent prognostic factors for CRC. Conclusion: The percentage of DNT cells may be useful as an evaluation index for CRC diagnosis and prognosis, which was even better when combined with serum CEA.

MicroRNA-148a Targets DNMT1 and PPARGC1A to Regulate the Viability, Proliferation, and Milk Fat Synthesis of Ovine Mammary Epithelial Cells.

In this study, the expression profiles of miR-148a were constructed in eight different ovine tissues, including mammary gland tissue, during six different developmental periods. The effect of miR-148a on the viability, proliferation, and milk fat synthesis of ovine mammary epithelial cells (OMECs) was investigated, and the target relationship of miR-148a with two predicted target genes was verified. The expression of miR-148a exhibited obvious tissue-specific and temporal-specific patterns. miR-148a was expressed in all eight ovine tissues investigated, with the highest expression level in mammary gland tissue (p < 0.05). Additionally, miR-148a was expressed in ovine mammary gland tissue during each of the six developmental periods studied, with its highest level at peak lactation (p < 0.05). The overexpression of miR-148a increased the viability of OMECs, the number and percentage of Edu-labeled positive OMECs, and the expression levels of two cell-proliferation marker genes. miR-148a also increased the percentage of OMECs in the S phase. In contrast, transfection with an miR-148a inhibitor produced the opposite effect compared to the miR-148a mimic. These results indicate that miR-148a promotes the viability and proliferation of OMECs in Small-tailed Han sheep. The miR-148a mimic increased the triglyceride content by 37.78% (p < 0.01) and the expression levels of three milk fat synthesis marker genes in OMECs. However, the miR-148a inhibitor reduced the triglyceride level by 87.11% (p < 0.01). These results suggest that miR-148a promotes milk fat synthesis in OMECs. The dual-luciferase reporter assay showed that miR-148a reduced the luciferase activities of DNA methyltransferase 1 (DNMT1) and peroxisome proliferator-activated receptor gamma coactivator 1-A (PPARGC1A) in wild-type vectors, suggesting that they are target genes of miR-148a. The expression of miR-148a was highly negatively correlated with PPARGC1A (r = -0.789, p < 0.001) in ovine mammary gland tissue, while it had a moderate negative correlation with DNMT1 (r = -0.515, p = 0.029). This is the first study to reveal the molecular mechanisms of miR-148a underlying the viability, proliferation, and milk fat synthesis of OMECs in sheep.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

PI3K/AKT/mTOR signaling pathway: an important driver and therapeutic target in triple-negative breast cancer.

Triple-negative breast cancer (TNBC) is a highly heterogeneous tumor lacking estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2) expression. It has higher aggressiveness and metastasis than other subtypes, with limited effective therapeutic strategies, leading to a poor prognosis. The phosphoinositide 3-kinase (PI3K)/protein kinase B (AKT)/mechanistic target of rapamycin (mTOR) signaling pathway is prevalently over-activated in human cancers and contributes to breast cancer (BC) growth, survival, proliferation, and angiogenesis, which could be an interesting therapeutic target. This review summarizes the PI3K/AKT/mTOR signaling pathway activation mechanism in TNBC and discusses the relationship between its activation and various TNBC subtypes. We also report the latest clinical studies on kinase inhibitors related to this pathway for treating TNBC. Our review discusses the issues that need to be addressed in the clinical application of these inhibitors.

SAS: Split antibiotic selection for identifying chaperones that improve protein solubility.

Background: Heterologous expression of active, native-folded protein in Escherichia coli is critical in both academic research and biotechnology settings. When expressing non-native recombinant proteins in E. coli, obtaining soluble and active protein can be challenging. Numerous techniques can be used to enhance a proteins solubility, and largely focus on either altering the expression strain, plasmid vector features, growth conditions, or the protein coding sequence itself. However, there is no one-size-fits-all approach for addressing issues with protein solubility, and it can be both time and labor intensive to find a solution. An alternative approach is to use the co-expression of chaperones to assist with increasing protein solubility. By designing a genetic system where protein solubility is linked to viability, the appropriate protein folding factor can be selected for any given protein of interest. To this end, we developed a Split Antibiotic Selection (SAS) whereby an insoluble protein is inserted in-frame within the coding sequence of the hygromycin B resistance protein, aminoglycoside 7″-phosphotransferase-Ia (APH(7″)), to generate a tripartite fusion. By creating this tripartite fusion with APH(7″), the solubility of the inserted protein can be assessed by measuring the level of hygromycin B resistance of the cells. Results: We demonstrate the functionality of this system using a known protein and co-chaperone pair, the human mitochondrial Hsp70 ATPase domain (ATPase70) and its co-chaperone human escort protein (Hep). Insertion of the insoluble ATPase70 within APH(7'') renders the tripartite fusion insoluble and results in sensitivity to hygromycin B. Antibiotic resistance can be rescued by expression of the co-chaperone Hep which assists in the folding of the APH(7'')-ATPase70-APH(7'') tripartite fusion and find that cellular hygromycin B resistance correlates with the total soluble fusion protein. Finally, using a diverse chaperone library, we find that SAS can be used in a pooled genetic selection to identify chaperones capable of improving client protein solubility. Conclusions: The tripartite APH(7'') fusion links the in vivo solubility of the inserted protein of interest to hygromycin B resistance. This construct can be used in conjunction with a chaperone library to select for chaperones that increase the solubility of the inserted protein. This selection system can be applied to a variety of client proteins and eliminates the need to individually test chaperone-protein pairs to identify those that increase solubility.

Prognosis prediction and risk stratification of breast cancer patients based on a mitochondria-related gene signature.

As the malignancy with the highest global incidence, breast cancer represents a significant threat to women's health. Recent advances have shed light on the importance of mitochondrial function in cancer, particularly in metabolic reprogramming within tumors. Recognizing this, we developed a novel risk signature based on mitochondrial-related genes to improve prognosis prediction and risk stratification in breast cancer patients. In this study, transcriptome data and clinical features of breast cancer samples were extracted from two sources: the TCGA, serving as the training set, and the METABRIC, used as the independent validation set. We developed the signature using LASSO-Cox regression and assessed its prognostic efficacy via ROC curves. Furthermore, the signature was integrated with clinical features to create a Nomogram model, whose accuracy was validated through clinical calibration curves and decision curve analysis. To further elucidate prognostic variations between high and low-risk groups, we conducted functional enrichment and immune infiltration analyses. Additionally, the study encompassed a comparison of mutation landscapes and drug sensitivity, providing a comprehensive understanding of the differing characteristics in these groups. Conclusively, we established a risk signature comprising 8 mitochondrial-related genes-ACSL1, ALDH2, MTHFD2, MRPL13, TP53AIP1, SLC1A1, ME3, and BCL2A1. This signature was identified as an independent risk predictor for breast cancer patient survival, exhibiting a significant high hazard ratio (HR = 3.028, 95%CI 2.038-4.499, P < 0.001). Patients in the low-risk group showed a more favorable prognosis, with enhanced immune infiltration, distinct mutation landscapes, and greater sensitivity to anti-tumor drugs. In contrast, the high-risk group exhibited an adverse trend in these aspects. This risk signature represents a novel and effective prognostic indicator, suggesting valuable insights for patient stratification in breast cancer.

Development and analytical validation of a novel nasopharynx swab-based Epstein-Barr virus C promoter methylation quantitative assay for nasopharyngeal carcinoma detection.

OBJECTIVES: Epstein-Barr virus (EBV) C promoter (Cp) hypermethylation, a crucial factor for EBV latent infection of nasopharyngeal epithelial cells, has been recognized as a promising biomarker for nasopharyngeal carcinoma (NPC) detection. In this study, we develop a novel EBV Cp methylation quantification (E-CpMQ) assay and evaluate its diagnostic performance for NPC detection. METHODS: A novel qPCR assay for simultaneous quantification of methylated- and unmethylated EBV Cp was developed by the combinational modification of MethyLight and QASM, with an innovative calibrator to improve the detection accuracy and consistency. The NP swab samples and synthetic standards were used for the analytical validation of the E-CpMQ. The diagnostic efficacy of the developed E-CpMQ assay was validated in 137 NPC patients and 137 non-NPC controls. RESULTS: The E-CpMQ assay can detect the EBV Cp methylation ratio in one reaction system under 10 copies with 100 % recognition specificity, which is highly correlated to pyrosequencing with a correlation coefficient over 0.99. The calibrated E-CpMQ assay reduces the coefficient of variation by an average of 55.5 % with a total variance of less than 0.06 units standard deviation (SD). Linear methylation ratio detection range from 4.76 to 99.01 %. The sensitivity and specificity of the E-CpMQ respectively are 96.4 % (95 % CI: 91.7-98.8 %), 89.8 % (95 % CI: 83.5-94.3 %). CONCLUSIONS: The developed E-CpMQ assay with a calibrator enables accurate and reproducible EBV Cp methylation ratio quantification and offers a sensitive, specific, cost-effective method for NPC early detection.

A flavin-monooxygenase catalyzing oxepinone formation and the complete biosynthesis of vibralactone.

Oxepinone rings represent one of structurally unusual motifs of natural products and the biosynthesis of oxepinones is not fully understood. 1,5-Seco-vibralactone (3) features an oxepinone motif and is a stable metabolite isolated from mycelial cultures of the mushroom Boreostereum vibrans. Cyclization of 3 forms vibralactone (1) whose ß-lactone-fused bicyclic core originates from 4-hydroxybenzoate, yet it remains elusive how 4-hydroxybenzoate is converted to 3 especially for the oxepinone ring construction in the biosynthesis of 1. In this work, using activity-guided fractionation together with proteomic analyses, we identify an NADPH/FAD-dependent monooxygenase VibO as the key enzyme performing a crucial ring-expansive oxygenation on the phenol ring to generate the oxepin-2-one structure of 3. The crystal structure of VibO reveals that it forms a dimeric phenol hydroxylase-like architecture featured with a unique substrate-binding pocket adjacent to the bound FAD. Computational modeling and solution studies provide insight into the likely VibO active site geometry, and suggest possible involvement of a flavin-C4a-OO(H) intermediate.

An updated analysis on the association of GSTM1 polymorphism and smoking exposure with the increased risk of coronary heart disease.

OBJECTIVE: To undertake a meta-analysis to investigate if there is an association between the glutathione S-transferase mu 1 (GSTM1) gene polymorphism, coronary artery disease (CAD) susceptibility and smoking. METHODS: Electronic databases, including PubMed®, Web of Science and Embase®, were searched for relevant case-control studies. Data were extracted and the odds ratio (OR) was calculated and appropriate statistical methods were used for the meta-analysis. RESULTS: The analysis included eight studies with a total of 1880 cases with CAD and 1758 control subjects. The results of this meta-analysis demonstrated that there is no association between the GSTM1 null and CAD (OR 1.24, 95% confidence interval [CI] 1.00, 1.55). An increased risk of CAD was observed in the smoking population with the GSTM1 null genotype (OR 1.48, 95% CI 1.02, 2.15). Subgroup analyses of geographical region, genotyping method and publication language category demonstrated potential relationships among gene polymorphism, smoking and CAD. CONCLUSIONS: Based on the current literature, the GSTM1 null genotype was associated to CAD in the smoking population. The interaction between smoking and GSTM1 polymorphism may contribute to the susceptibility of CAD.

Risk factors for asthma in patients with allergic rhinitis in eastern China.

BACKGROUND: Asthma is one of the most common chronic diseases among children and adults and can lead to a high health and socioeconomic burden. Allergic rhinitis (AR) often precedes the development of asthma. This study aims to clarify the risk factors for cocurrent asthma in patients with AR in eastern China. METHODS: A cross-sectional study of 3739 patients with AR was performed in eastern China. Patients meeting the criteria for AR were evaluated using a skin-prick test (SPT) of 16 common aeroallergens. A logistic regression analysis was used to assess the risk factors of asthma in patients with AR. RESULTS: The prevalence of asthma in patients with AR was 14.23%. The patients sensitive to dust mites (D. farinae and D. pteronyssinus) had the highest prevalence (76.84% and 73.68%). A significant difference was found in sensitization to four types of allergens (D. farinae, D. pteronyssinus, dog dander, Alternaria alternata) in patients with AR with and without asthma. The strongest risk factor for asthma in patients with AR was an allergy to Aspergillus fumigatus (adjusted OR, 2.42; 95% CI, 1.50-3.90), followed by allergy to D. pteronyssinus (adjusted OR, 2.06; 1.30-3.27), and allergy to dog dander (adjusted OR, 1.92; 1.24-2.97). Various risk factors that are independently associated with asthma in patients with AR were found in different age groups. CONCLUSIONS: We observed a difference in risk factors in patients with AR with and without asthma. Clarifying the risk factors for asthma in patients with AR is important and may be beneficial to the optimal interventions of asthma.

IL-21 Enhances the Immune Protection Induced by the Vibrio vulnificus Hemolysin A Protein.

We previously reported that the Vibrio vulnificus hemolysin A (VvhA) protein elicited good immune protection and could effectively control V. vulnificus infection in mice. However, its molecular mechanism remains unknown. We hypothesized that hemolysin A induces an immunoprotective response via IL-21 regulation. To demonstrate this, IL-21 expression in mice was regulated by injecting either specific antibodies or rIL-21, and the immune response was evaluated by flow cytometry. Our results suggested that IL-21 enhances immune protection by inducing a T follicular helper cell and germinal center B cell response. We used RNA-seq to explore molecular mechanisms and identified 10 upregulated and 32 downregulated genes involved in IL-21-upregulated protection. Gene Ontology analysis and pathway analysis of the differentially expressed genes were also performed. Our findings indicate that IL-21 can enhance the immune protection effect of the VvhA protein and may serve as a novel strategy for enhancing the immune protection effect of protein vaccines.

MicroRNA-432 inhibits milk fat synthesis by targeting SCD and LPL in ovine mammary epithelial cells.

The microRNA (miR)-432 is differentially expressed in the mammary gland of two breeds of lactating sheep with different milk production traits, and between the non-lactating and peak-lactation periods, but there have been no reports describing the molecular mechanisms involved. In this study, the effect of miR-432 on the proliferation of ovine mammary epithelial cells (OMECs) and the target genes of miR-432 were investigated. The effects of miR-432 on the expression of the target genes and the content of triglycerides in the OMECs were also analyzed. Transfection with a miR-432 mimic was found using CCK8 and Edu assays, to inhibit the viability of OMECs and reduce the number of proliferated OMECs. In contrast, a miR-432 inhibitor had the opposite effect to the miR-432 mimic, and together these results suggest that miR-432 inhibits the proliferation of OMECs. A dual luciferase assay revealed that the genes for stearoyl-CoA desaturase (SCD) and lipoprotein lipase (LPL) are targeted by miR-432. The transfection of miR-432 mimic into OMECs resulted in decreases in the expression of SCD and LPL, and three other milk fat synthesis marker genes; FABP4, LPIN1 and ACACA. The mimic also decreased the content of triglycerides. The miR-432 inhibitor had the opposite effect to the mimic on the expression of these genes and the level of triglycerides. This is the first study to reveal the biological mechanisms by which miR-432 inhibits milk fat synthesis in sheep.

An Efficient Nomogram to Predict Overall Survival of Patients with Pediatric Ewing's Sarcoma: A Population-Based Study.

BACKGROUND: The objective of our study was to develop and validate a nomogram to predict the overall survival (OS) of patients with pediatric Ewing's sarcoma (PES). METHODS: Age, gender, race, tumor stage, tumor size, tumor site, treatment method, and survival time were collected from patients diagnosed with PES between 2004 and 2016 from the Surveillance, Epidemiology, and End Results (SEER) database. A total of 772 patients were randomly allocated to a training dataset (n = 579) and a validation dataset (n = 193). Then, univariate and multivariate analyses were performed to determine the prognostic effect of the selected variables. A nomogram was constructed to estimate the OS and it was further assessed using the concordance index (C-index), calibration curves, and receiver operating characteristic (ROC). RESULTS: Age, race, tumor size, and tumor stage were included in the nomogram. The C-index was 0.77 in the OS for the training dataset. The C-index for the validation dataset of the OS prediction was 0.75. Calibration plots and ROC curves showed excellent predictive accuracy. CONCLUSION: Age, race, tumor stage, and tumor size were independent prognostic factors for patients with PES. The nomogram showed an accurate and reliable prognostic performance for PES patients.

MicroRNA-148a Regulates the Proliferation and Differentiation of Ovine Preadipocytes by Targeting PTEN.

MicroRNAs (miRNAs) have been found to be involved in lipid deposition and metabolism. However, there have been no reports on the roles of miR-148a in the proliferation and adipogenesis of preadipocytes in sheep. In this study, the expression of miR-148a was profiled in the eight tissues of Tibetan ewes and differentiated preadipocytes, and the role of miR-148a in differentiation and proliferation of ovine preadipocytes was investigated using Oil Red O staining, CCK-8, EdU staining, cell cycle detection, and RT-qPCR. The effect of PTEN on the differentiation of ovine preadipocytes was also investigated. The miR-148a was widely expressed in the eight tissues investigated and had significantly increased expression in liver, spleen and subcutaneous adipose tissues, and the heart. The expression of miR-148a continued to increase with the differentiation of ovine preadipocytes. The over-expression of miR-148a significantly promoted differentiation but inhibited the proliferation of ovine preadipocytes. The inhibition of miR-148a had the opposite effect on the differentiation and proliferation of ovine preadipocytes with over-expressed miR-148a. The results from the dual luciferase reporter assays showed that miR-148a mimic significantly decreased the luciferase activity of PTEN-3'UTR dual luciferase reporter vector, suggesting that PTEN is a target gene of miR-148a. In over-expressed-PTEN preadipocytes, the number of lipid droplets remarkably decreased, and the expression levels of adipogenesis marker genes PPARγ, FASN, FATP4, GLUT4, C/EBPß and LPL were also significantly down-regulated. These results suggest that miR-148a accelerated the adipogenic differentiation of ovine preadipocytes by inhibiting PTEN expression, and also inhibited the proliferation of ovine preadipocytes.

A useful epitope tag derived from maltose binding protein.

Maltose binding protein (MBP) is used in recombinant protein expression as an affinity and solubility tag. The monoclonal antibody B48 binds MBP tightly and has no cross-reactivity to other proteins in an Escherichia coli lysate. This high level of specificity suggested that MBP contains an epitope that could prove useful as a purification and visualization tag for proteins expressed in E. coli. To discover the MBP epitope, a co-crystal structure was determined for MBP bound to its antibody and four amino acids of MBP were identified as critical for the binding interaction. Fusions of various fragments of MBP to the glutathione S-transferase protein were engineered in order to identify the smallest fragment still recognized by the α-MBP antibody. Stabilization of the epitope via mutational engineering resulted in a minimized 14 amino-acid tag.

Identification and characterization of circular RNAs in mammary gland tissue from sheep at peak lactation and during the nonlactating period.

Circular RNAs are a class of noncoding RNA with a widespread occurrence in eukaryote tissues, and with some having been demonstrated to have clear biological function. In sheep, little is known about the role of circular RNAs in mammary gland tissue, and therefore an RNA sequencing approach was used to compare mammary gland tissue expression of circular RNAs in 9 Small Tail Han sheep at peak lactation, and subsequently when they were not lactating. These 9 sheep had their RNA pooled for analysis into 3 libraries from peak lactation and 3 from the nonlactating period. A total of 3,278 and 1,756 circular RNAs were identified in the peak lactation and nonlactating mammary gland tissues, respectively, and the expression and identity of 9 of them was confirmed using reverse transcriptase-polymerase chain reaction analysis and DNA sequencing. The type, chromosomal location and length of the circular RNAs identified were ascertained. Forty upregulated and one downregulated circular RNAs were characterized in the mammary gland tissue at peak lactation compared with the nonlactating mammary gland tissue. Gene ontology enrichment analysis revealed that the parental genes of these differentially expressed circular RNAs were related to molecular function, binding, protein binding, ATP binding, and ion binding. Five differentially expression circular RNAs were selected for further analysis to predict their target microRNAs, and some microRNAs reportedly associated with the development of the mammary gland were found in the constructed circular RNA-microRNA network. This study reveals the expression profiles and characterization of circular RNAs at 2 key stages of mammary gland activity, thereby providing an improved understanding of the roles of circular RNAs in the mammary gland of sheep.

Small RNA deep sequencing reveals the expressions of microRNAs in ovine mammary gland development at peak-lactation and during the non-lactating period.

MicroRNAs (miRNAs) are small non-coding RNAs that are involved in mammary gland development and lactation in livestock. Little is known about the roles of miRNAs in ovine mammary gland development, hence in this study the expression profiles of miRNAs of the mammary gland tissues of ewes at peak-lactation and during the non-lactating period were investigated using RNA sequencing. A total of 147 mature miRNAs were expressed in the two periods. Compared with peak-lactation, eight miRNAs in the non-lactating ewe mammary gland were significantly up-regulated, whereas fifteen miRNAs were down-regulated. A KEGG analysis revealed that the target genes of the up-regulated miRNAs were significantly enriched in lysosome, Wnt and MAPK signaling pathways, while the target genes of down-regulated miRNAs were significantly enriched in the PI3K-Akt signaling pathway, protein processing in endoplasmic reticulum and axon guidance. These results suggest that further study of the differentially expressed miRNAs could provide a better understanding of the molecular mechanisms of mammary development and lactation in sheep.

Improved production of Humira antibody in the genetically engineered Escherichia coli SHuffle, by co-expression of human PDI-GPx7 fusions.

Microbial production of antibodies offers the promise of cheap, fast, and efficient production of antibodies at an industrial scale. Limiting this capacity in prokaryotes is the absence of the post-translational machinery, present in dedicated antibody producing eukaryotic cell lines, such as B cells. There has been few and limited success in producing full-length, correctly folded, and assembled IgG in the cytoplasm of prokaryotic cell lines. One such success was achieved by utilizing the genetically engineered Escherichia coli strain SHuffle with an oxidative cytoplasm. Due to the genetic disruption of reductive pathways, SHuffle cells are under constant oxidative stress, including increased levels of hydrogen peroxide (H2O2). The oxidizing capacity of H2O2 was linked to improved disulfide bond formation, by expressing a fusion of two endoplasmic reticulum-resident proteins, the thiol peroxidase GPx7 and the protein disulfide isomerase, PDI. In concert, these proteins mediate disulfide transfer from H2O2 to target proteins via PDI-Gpx7 fusions. The potential of this new strain was tested with Humira, a blockbuster antibody usually produced in eukaryotic cells. Expression results demonstrate that the new engineered SHuffle strain (SHuffle2) could produce Humira IgG four-fold better than the parental strain, both in shake-flask and in high-density fermentation. These preliminary studies guide the field in genetically engineering eukaryotic redox pathways in prokaryotes for the production of complex macromolecules. KEY POINTS: • A eukaryotic redox pathway was engineered into the E. coli strain SHuffle in order to improve the yield of the blockbuster antibody Humira. • The best peroxidase-PDI fusion was selected using bioinformatics and in vivo studies. • Improved yields of Humira were demonstrated at shake-flask and high-density fermenters.

A Nomogram Predicting Overall and Cancer-Specific Survival of Patients with Primary Bone Lymphoma: A Large Population-Based Study.

We aimed to develop a nomogram for evaluating the overall survival (OS) and cancer-specific survival (CSS) in patients with primary bone lymphoma (PBL). Patients diagnosed with PBL between 2007 and 2016 were collected from the Surveillance, Epidemiology, and End Results (SEER) database. All patients were randomly allocated to the training cohort and validation cohort (2 : 1). The nomogram was developed by the training cohort and validated by the validation cohort using the concordance index (C-index), calibration plots, and decision curve analyses (DCAs). The C-index for CSS and OS prediction in the training cohort were 0.76 and 0.77, respectively; in the validation cohort, they were 0.76 and 0.79, respectively. The calibration curve showed good consistency between nomogram prediction and actual survival. The DCA indicated obvious net benefits of the new predictive model. The nomogram showed favorable applicability and accuracy, and it will be a reliable tool for predicting OS and CSS in patients with PBL.