First report of milkweed (Euphorbia geniculata) as an alternative host for Colletotrichum truncatum in soybean fields in India.

Soybean (Glycine max, L.), a major oilseed crop of India faces anthracnose disease caused by Colletotrichum truncatum (Nataraj et al. 2021). Several weeds serve as alternative hosts for Colletotrichum spp. (Hartman et al. 1986). Around 24.67% of soybean fields in the study area were infested with Euphorbia geniculata (Kutariye et al. 2021). In September 2021, milkweed plants died in the field, showing irregular circular lesions with wavy margins on the stem, change in color of veins and veinlets from brown to black and leaves exhibiting a twisted appearance at ICAR-Indian Institute of Soybean Research, India. Later on plants completely died and acervuli of average size 284 µm were visualized under stereo microscopy. Twenty milkweed samples were collected, rinsed, and surface sterilized with NaOCl (1%). Fungus isolation was done from leaf and stem and transferred to sterilized Petri plates with Potato dextrose agar (PDA). The plates were incubated at 25 ± 2°C for 48 h with dark/light (10h/14h) cycle. The fungi produced circular, raised, black to light grey colonies. Sickle shaped aseptate conidia, measuring 23.14 µm length, 3.18 µm width and hyphal width 5.49 µm were confirmed using a compound microscope with 20X magnification. The fungus was purified via hyphal tip method and pure culture was maintained on PDA at (26 ± 2°C). Milkweed seedlings in clay pots were inoculated with a conidial suspension of the fungus (106 conidia/mL) prepared from ten days old culture using serial dilution technique. Soybean variety JS 95-60 was inoculated by atomizing 20 ml of the same suspension on each plant. The negative controls for both milkweed and soybean were inoculated with sterile distilled water. Veinal necrosis and acervuli formation were observed on both milkweed and soybean, but no signs or symptoms of disease were observed in the controls. The re-isolated fungus from both the diseased hosts resembled original culture as they produced black to light grey colonies, sickle shaped aseptate conidia and ITS sequence (OR124845) exhibiting 100% resemblance to C. truncatum isolate C-17 (MN736513), thus confirming Koch's postulates. The pathogen was classified as Colletotrichum spp. based on morphological and cultural characters and the pathogenicity test (Rajput et al. 2021). To confirm identity of the pathogen infecting milkweed, DNA was extracted from the reisolated fungus using the HiPurA Fungal DNA Purification Kit (HiMedia, India). The internal transcribed spacer (ITS) region, beta-tubulin (TUB2) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) genes were amplified (Kumar et al. 2021). The GAPDH gene was amplified under similar reaction conditions except for annealing temp 59°C. For species level identification, the ITS, TUB2 and GAPDH gene sequences were submitted to GenBank with accession numbers OR004468, OQ869780 and OQ869781, respectively. The BLAST analysis of TUB2 and GAPDH gene showed sequence homology of 100% and 98.43% respectively with C. truncatum culture-collection CBS:151.35 (GU228156, GU228254). The isolate was identified as C. truncatum on the basis of molecular analysis, corroborating the above morphological identification. This is the first report of C. truncatum infecting milkweed in India, indicating milkweed as an alternative host in soybean fields, potentially raising inoculum levels and carryover between crops.

The type-III effectors-based multiplex PCR for detection of Xanthomonas campestris pv. campestris causing black rot disease in crucifer crops.

The black rot disease in crucifer crops is caused by Xanthomonas campestris pv. campestris (Xcc) which drastically reduces the productivity of crops. Three Xcc races, such as races 1, 4, and 6, have been identified from India that possess nine avr genes, or type-III effectors (T3Es). Here, we used three T3Es-avrXccC, avrBs1, and avrGf1 to identify Xcc from bacterial DNA, bacterial suspensions, Xcc-infected seeds, and the sap of the infected leaves using multiplex PCR. The T3Es were amplified using gene-specific primers with gDNA of Xcc. Then, the multiplex PCR was optimized and amplified T3Es using the sap of black rot-infected cauliflower leaves. Further, this method amplified T3Es from artificially infected seeds (1-100%) of cauliflower and from Xcc colonies (0.1-100%) grown on nutrient agar medium. The primer specificity of T3E genes elucidates that these are specifically detected in all Indian Xcc strains and races, while no bands were observed with other unrelated bacteria, such as X. euvesicatoria, X. oryzae pv. oryzae, Pseudomonas fluorescens, Ralstonia solanacearum, Bacillus subtilis, and B. amyloliquefaciens. Further, this PCR possesses high sensitivity and amplifies T3E genes using up to 0.01 ng Xcc DNA. The high specificity and sensitivity of T3Es-based multiplex PCR make it a potential method and can be used to amplify Xcc from various templates, such as purified DNA, Xcc-infected seeds and leaves, crude extracts, etc., without the need to extract plant or bacterial DNA. Supplementary Information: The online version contains supplementary material available at 10.1007/s13205-023-03691-z.

First report of Tobacco rattle virus infecting Brassica oleracea var. botrytis (cauliflower) in India.

The Brassica oleracea var. botrytis (cauliflower) is an important annual vegetable crop in the Brassicaceae family and is extensively grown worldwide (Singh et al. 2018). In the early summer of 2022, the cauliflower plants grown at the Indian Agricultural Research Institute (IARI), New Delhi, India, showed virus-like symptoms. Symptoms comprised chlorosis, stunted growth, mottling, necrosis, and mosaic. Additionally, the infected plants had deformed, curled leaves and reduced growth. The symptomatic plant leaf samples were collected and examined under the transmission electron microscope (TEM), which showed rigid, rod-shaped particles with tubular morphology resembling tobacco rattle virus (TRV, genus Tobravirus) infection (Basavaraj et al. 2020). TRV has a vast host range and is reported to infect many vegetable crops (beans, beets, peppers, potatoes, and spinach) and ornamental plants (lily, marigold, and tulip) (Adams et al. 2012; Katoch et al. 2004; MacFarlane, 1999). The reverse transcription (RT)-PCR also tested infected samples. Total RNA was extracted with Plant RNeasy Mini Kit (Qiagen, Germany). The cDNA was prepared using a RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, US). A 600-bp-long coat protein gene of TRV was PCR amplified using coat protein gene (CPG)-specific primers (TRVCPF: ATGGGAGATATGTACGATGAATC and TRVCPR: CTAGGGATTAGGACGTATCGGA). The PCR reaction contained 5.0µl of 5× Go-Taq Flexi buffer, 2.5µl of 25mM MgCl2, 1.0µl of 10mM dNTPs, 0.75µl each of 10µm forward and reverse primers of TRVCP, 1.0µl of cDNA, 13.8µl of nuclease-free water, and 0.2µl of Go-Taq polymerase (Promega, US). No template control was run with this PCR. The PCR (Gradient thermocycler, C-1000TM, BIORAD) was carried out under the following conditions: 94°C for 2 min, followed by 35 cycles of 94°C for 1 min, 50°C for 30 sec, and 72°C for 1 min, and final elongation at 72°C for 10 min. TRV was amplified in three cauliflower samples at IARI, New Delhi (Lat 28.08° N and Long 77.12°E). The amplicon of partial CPG was sequenced by Sanger sequencing (AgriGenome Labs Pvt. Ltd., India). The BLASTN analysis of the CPG revealed 100% nucleotide homology with TRV isolates (Accession No. Z36974) (Hernandez et al. 1995). Three isolates were sequenced and submitted to the GenBank database (Accession Nos. ON983976, ON983977, and ON983978). The sap from the TRV-infected cauliflower leaves were used to confirm the infection of TRV in healthy cauliflower plants grown in the greenhouse condition. TRV may be a new threat to cauliflower production and needs further research to elaborate more about the virus-host interactions and disease resistance. As per our knowledge, this is the first report of TRV infecting cauliflower in India.

Black rot disease incited by Indian race 1 of Xanthomonas campestris pv. campestris in Brassica juncea L. cv. Pusa Bold in India.

Mustard (Brassica juncea L.) is an important oil seed crop in the Brassicaceae family. It is widely cultivated in India for its edible leaves, oil and medicinal properties. In January 2022, we noticed necrotic symptoms typical black rot disease on Brassica juncea (L.) cv. Pusa Bold grown in Indian Agricultural Research Institute, India. Initially, chlorotic lesions emerged on the leaf margin, which progressed to angular V-shaped necrotic lesions and blackened veins. Disease progression became a necrotic appearance in the leaf results browning and papery leaf texture appeared. The suspected causal agent was isolated from three different diseased plants of Pusa Bold on nutrient sucrose agar medium that formed pale yellow, mucoid, and fluidal colonies. Three representative isolates originated from three different plants were sub-cultured on YGCA medium. These isolates are Gram-negative, oxidase negative, KOH positive, nonfluorescent on King's Medium B agar, and positive for starch hydrolysis test (Schaad and White 1974). The 16S ribosomal RNA gene and avirulence genes - AvrBs1 and AvrGf1 were amplified and sequenced in these three isolates with other Xanthomonas campestris pv. campestris (Xcc) isolates. The DNA sequence analysis revealed that these isolates are within the species of X. campestris. The race 1 specific marker namely xcc-b100_4389 was used to characterized the race by detection of 1090bp fragment respectively from gDNA of Xcc isolates (Rubel et al., 2017). The pathogenicity of these isolates was tested twice on youngest leaves of 30-day-old plants of Pusa Bold to convey Koch postulates. Inoculum of three isolates were prepared in nutrient broth at 28°C for 48-h. The pathogenicity test was conducted by small scissors dipped in a bacterial suspension (~ 108 cfu/ml) to cut leaf near margins at 10 points per leaf and the three youngest leaves per plant with three replications. The number of infected points per leaf and the severity of symptoms were assessed 15 and 30 days after inoculation (Singh et al., 2011; 2016). The chlorotic lesions with V-shaped symptoms were appeared on all inoculated plants after 15 and 30 dpi (days post-inoculation). The bacteria were reisolated from inoculated plants and has the same identity as original isolates by using 16S rRNA, avr genes and race 1 specific marker PCR, thereby confirming Koch's postulates. The bacterial inoculation was repeated and the same symptoms appear. Most of the crucifers are infected with black rot disease e.g., cauliflower, cabbage, Brussels, sprout etc. (Vicente et al., 2001). The nucleotide BLAST analysis of 16S rRNA, AvrBs1, AvrGf1 showed a 100% identity with different Xcc strains reported from Germany (B100; AM920689), Brazil (ATCC 33913; AE008922), India (Xcc-C7; CP077958), France (CFBP 5817; CM002673) and China (8004; CP000050) (Singh et al. 2022). Whilst, the nBLAST analysis of xcc-b100_4389 showed 100% nucleotide identity with Xcc race 1 (B100; AM920689), Germany. The sequences were deposited in GenBank (16S rRNA: OM839780; AvrBs1: OM994397; AvrGf1: OM994398; xcc-b100_4389: OM994399). The XccAK1 strain (ITCCBH_0014) was deposited in Indian Type Culture Collection, ICAR-IARI, New Delhi, India. Presently, it is a first report of necrotic black rot on B. juncea cv. Pusa Bold incited by Xcc race 1, India. Previous research reported the black rot disease on other species of the Brassica genus e.g., B. oleracea, and B. napus in Serbia (Popovic et al., 2013) and Argentina (Gaetan et al., 2005).

Unraveling Microbial Volatile Elicitors Using a Transparent Methodology for Induction of Systemic Resistance and Regulation of Antioxidant Genes at Expression Levels in Chili against Bacterial Wilt Disease.

Microbial volatiles benefit the agricultural ecological system by promoting plant growth and systemic resistance against diseases without harming the environment. To explore the plant growth-promoting efficiency of VOCs produced by Pseudomonas fluorescens PDS1 and Bacillus subtilis KA9 in terms of chili plant growth and its biocontrol efficiency against Ralstonia solanacearum, experiments were conducted both in vitro and in vivo. A closure assembly was designed using a half-inverted plastic bottle to demonstrate plant-microbial interactions via volatile compounds. The most common volatile organic compounds were identified and reported; they promoted plant development and induced systemic resistance (ISR) against wilt pathogen R. solanacearum. The PDS1 and KA9 VOCs significantly increased defensive enzyme activity and overexpressed the antioxidant genes PAL, POD, SOD, WRKYa, PAL1, DEF-1, CAT-2, WRKY40, HSFC1, LOX2, and NPR1 related to plant defense. The overall gene expression was greater in root tissue as compared to leaf tissue in chili plant. Our findings shed light on the relationship among rhizobacteria, pathogen, and host plants, resulting in plant growth promotion, disease suppression, systemic resistance-inducing potential, and antioxidant response with related gene expression in the leaf and root tissue of chili.

Screening and Biocontrol Potential of Rhizobacteria Native to Gangetic Plains and Hilly Regions to Induce Systemic Resistance and Promote Plant Growth in Chilli against Bacterial Wilt Disease.

Plant growth-promoting rhizobacteria (PGPR) is a microbial population found in the rhizosphere of plants that can stimulate plant development and restrict the growth of plant diseases directly or indirectly. In this study, 90 rhizospheric soil samples from five agro climatic zones of chilli (Capsicum annuum L.) were collected and rhizobacteria were isolated, screened and characterized at morphological, biochemical and molecular levels. In total, 38% of rhizobacteria exhibited the antagonistic capacity to suppress Ralstonia solanacearum growth and showed PGPR activities such as indole acetic acid production by 67.64% from total screened rhizobacteria isolates, phosphorus solubilization by 79.41%, ammonia by 67.75%, HCN by 58.82% and siderophore by 55.88%. We performed a principal component analysis depicting correlation and significance among plant growth-promoting activities, growth parameters of chilli and rhizobacterial strains. Plant inoculation studies indicated a significant increase in growth parameters and PDS1 strain showed maximum 71.11% biocontrol efficiency against wilt disease. The best five rhizobacterial isolates demonstrating both plant growth-promotion traits and biocontrol potential were characterized and identified as PDS1-Pseudomonas fluorescens (MN368159), BDS1-Bacillus subtilis (MN395039), UK4-Bacillus cereus (MT491099), UK2-Bacillus amyloliquefaciens (MT491100) and KA9-Bacillus subtilis (MT491101). These rhizobacteria have the potential natural elicitors to be used as biopesticides and biofertilizers to improve crop health while warding off soil-borne pathogens. The chilli cv. Pusa Jwala treated with Bacillus subtilis KA9 and Pseudomonas fluorescens PDS1 showed enhancement in the defensive enzymes PO, PPO, SOD and PAL activities in chilli leaf and root tissues, which collectively contributed to induced resistance in chilli plants against Ralstonia solanacearum. The induction of these defense enzymes was found higher in leave tissues (PO-4.87-fold, PP0-9.30-fold, SOD-9.49-fold and PAL-1.04-fold, respectively) in comparison to roots tissue at 48 h after pathogen inoculation. The findings support the view that plant growth-promoting rhizobacteria boost defense-related enzymes and limit pathogen growth in chilli plants, respectively, hence managing the chilli bacterial wilt.