Nucleotide excision repair and photoreactivation in the entomopathogenic fungi Beauveria bassiana, Beauveria brongniartii, Beauveria nivea, Metarhizium anisopliae, Paecilomyces farinosus and Verticillium lecanii.

AIMS: To compare the DNA repair capabilities of the entomopathogenic fungus (EPF) bassiana to the EPF Beauveria brongniartii, Beauveria nivea, Metarhizium anisopliae, Paecilomyces farinosus, Verticillium lecanii, and the fungi Aspergillus niger and Neurospora crassa. METHODS AND RESULTS: Germination of B. bassiana conidiospores following ultraviolet (UV) irradiation was used to show that nucleotide excision repair and photoreactivation decrease the post-UV germination delay. These two modes of repair were characterized and compared between the aforementioned EPF, A. niger and N. crassa using a physiological assay where per cent survival post-UV irradiation was scored as colony forming units. CONCLUSIONS: The results showed B. bassiana and M. anisopliae are the most UV-tolerant EPF. The DNA repair capabilities indicated that EPF do not have all DNA repair options available to fungi, such as A. niger and N. crassa. SIGNIFICANCE AND IMPACT OF THE STUDY: A key factor detrimental to the survival of EPF in agro-ecosystems is UV light from solar radiation. The EPF literature pertaining to UV irradiation is varied with respect to methodology, UV source, and dose, which prevented comparisons. Here we have characterized the fungi by a standard method and established the repair capabilities of EPF under optimal conditions.

Analysis of the chiB gene of Serratia liquefaciens.

A 4.6-kb EcoRI/BglII fragment of Serratia liquefaciens genomic DNA has been sequenced and within this fragment the chiB gene has been identified and characterized. The chiB ORF encodes a polypeptide with a deduced molecular mass of 52-kDa and the translational product in vitro has chitinase, but not chitobiase activity. Alignment of the predicted Chib 499 amino acid sequence indicated a chitin-binding and a catalytic domain that shares homology to the chitinase family 18 domain, to the Chib polypeptide of Serratia marcescens QMB1466 (93.6%), a human chitinase and several bacterial chitinases. This chiB gene sequence transcription/translation in Escherichia coli may be blocked by a RNA folding mechanism thus controlling the chitin utilization regulon in S. liquefaciens.

Constitutive and heat-inducible heat shock element binding activities of heat shock factor in a group of filamentous fungi.

This study represents the initial characterization of the heat shock factor (HSF) in filamentous fungi. We demonstrate that HSFs from Beauveria bassiana, Metarhizium anisopliae, Tolypocladium nivea, Paecilomyces farinosus, and Verticillium lecanii bind to the heat shock element (HSE) constitutively (non-shocked), and that heat shock resulted in increased quantities and decreased mobility of HSF-HSE complexes. The monomeric molecular mass of both heat-induced and constitutive HSFs was determined to be 85.8 kDa by UV-crosslinking and the apparent molecular masses of the native HSF-HSE complexes as determined by pore exclusion gradient gel electrophoresis was 260 and 300 kDa, respectively. Proteolytic band clipping assays using trypsin and chymotrypsin revealed an identical partial cleavage profile for constitutive and heat-induced HSF-HSE complexes. Thus, it appears that both constitutive and heat-inducible complexes are formed by trimers composed of the same HSF molecule which undergoes conformational changes during heat shock. The mobility difference between the complexes was not abolished by enzymatic dephosphorylation and deglycosylation, indicating that the reduced mobility of the heat-induced HSF is probably due to a post-translational modification other than phosphorylation or glycosylation.

Production of listeriolysin O by Listeria monocytogenes (Scott A) under heat-shock conditions.

Early stationary phase cells of Listeria monocytogenes (Scott A) were examined to determine the effect of heat-shock on the production of listeriolysin O (LLO) during and after resuscitation at 37 degrees C. Cells were subjected to a heat-shock at 48 degrees C for 1 h. Intracellular and extracellular proteins of the heat-shocked cells were assayed for LLO using a microtiter plate hemolysis assay and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and immunoblotting. Our results showed that significant amounts of LLO are synthesized under heat-shock conditions that are not detected in the extracellular medium by a functional assay. This situation is evident by the absence of hemolytic activity immediately after heat-shock, and may be due to either a lack of excretion or inactivation of the LLO at 48 degrees C once outside the cell. By studying the intracellular and extracellular proteins using SDS-PAGE and immunoblots of the heat-shocked cells, we substantiated an absence of excretion as an operating mechanism. Heat-shocked cells resumed LLO production within 2-4 h of resuscitation at 37 degrees C, achieving an activity level 2-fold higher compared to the controls and 4-fold higher compared to cells immediately after heat-shock. Most likely, the LLO excreted must have been from LLO accumulated in the cells during heat-shock.

Agricultural use of antibiotics and the evolution and transfer of antibiotic-resistant bacteria.

Microbial Resistance to antibiotics is on the rise, in part because of inappropriate use of antibiotics in human medicine but also because of practices in the agricultural industry. Intensive animal production involves giving livestock animals large quantities of antibiotics to promote growth and prevent infection. These uses promote the selection of antibiotic resistance in bacterial populations. The resistant bacteria from agricultural environments may be transmitted to humans, in whom they cause disease that cannot be treated by conventional antibiotics. The author reviews trends in antibiotic use in animal husbandry and agriculture in general. The development of resistance is described, along with the genetic mechanisms that create resistance and facilitate its spread among bacterial species. Particular aspects of resistance in bacterial species common to both the human population and the agrifood industry are emphasized. Control measures that might reverse the current trends are highlighted.

Characterization and structure of the mitochondrial small rRNA gene of the entomopathogenic fungus Beauveria bassiana.

The entire mitochondrial (mt) small ribosomal RNA (srRNA) gene from the entomopathogenic fungus Beauveria bassiana was sequenced. Alignment of the sequence to those of other filamentous fungi revealed gross length differences in their respective products. Construction of a secondary structural model showed that these differences were restricted to known variable srRNA subdomains. Several features were identified that were common only to the hyphomycetous fungi examined. Phylogenetic analysis indicated that the anamorph B. bassiana was more closely related to the pyrenomycete than to the plectomycete ascomycetous fungi. Based on our previous comparison of mt gene arrangement in filamentous fungi, this was unexpected. The possibility that the smaller mt genomes reflect the ancestral arrangement of genes is discussed.

Expression of a Bacillus thuringiensis delta-endotoxin gene by Bacillus pumilus.

The delta-endotoxin genes from Bacillus thuringiensis were introduced into a rhizosphere-inhabiting Bacillus pumilus isolate to create a delta-endotoxin expression and delivery system for subterranean feeding insects such as the larvae of pale western cutworm (Agrotis orthogonia Morrison (Lepidoptera: Noctuidae)). Preliminary experiments indicated that Bacillus thuringiensis subsp. kurstaki cultures were toxic to pale western cutworm larvae. Three different cry genes from Bacillus thuringiensis subsp. kurstaki were cloned into high and low copy number vectors and mated into Bacillus pumilus RB8. When carried on high copy number vectors, cry genes appeared to inhibit sporulation and delta-endotoxin production in Bacillus pumilus RB8 cultures, since microscopic examination of these cultures revealed that < 0.1% of the cells of late stationary phase cultures had sporulated and produced parasporal inclusions. On low copy number vectors, the cry genes did not inhibit sporulation; however, production of delta-endotoxins was undetectable. Using a heat shock regime for enrichment of sporogenous crystalliferous variants, a Bacillus pumilus isolate, carrying cryIA(c) on a high copy number plasmid, was obtained in which high level delta-endotoxin production occurred concomitant with sporulation. Synthesis of functional delta-endotoxin by this strain was confirmed by Western blot analysis and bioassay with pale western cutworm larvae. These results show that rhizosphere-inhabiting bacilli are indeed a potential route for introduction of delta-endotoxins to the root environment for biocontrol purposes.

Toxic properties of Beauveria pigments on erythrocyte membranes.

The Beauveria pigments, tenellin, bassianin and oosporein, all inhibited total erythrocyte membrane ATPase activity in a dose-dependent manner by as much as 50% at 200 micrograms/ml. These pigments inhibited Ca(2+)-ATPases to a greater extent than Na+/K(+)-ATPase activity. The ATPase inhibitory activity for these pigments was not specific but was probably a consequence of membrane disruption, since pigments all caused alterations in erythrocyte morphology and promoted varying degrees of cell lysis.

Identification and differentiation of the entomopathogenic fungus Beauveria bassiana using polymerase chain reaction and single-strand conformation polymorphism analysis.

A series of genomic DNA probes which exhibit specificity for Beauveria bassiana demonstrated a level of sensitivity to approximately 152 ng of fungal DNA (Hegedus and Khachatourians, 1993a). To improve the sensitivity of a DNA-based monitoring system for detection of this entomopathogenic fungus we have developed a PCR-based method. Using sequence information from a region of the B. bassiana-specific probe pBb22, primers P1 (5'AAGCTTCGACATGGTCTG) AND P3 (5GGAGGTGGTGAGGTTCTGTT) were generated. This primer set amplified similar-sized products from several B. Bassiana isolates, Beauveria brongniartii, Beauveria caledonica, and B. densa, but not Tolypocladium nivea, Tolypocladium cylindrospora, Metarhizium anisopliae, Verticillium lecanii, and Paecilomyces farinosus or migratory grasshoppers and locusts. Hybridization with the probe indicated the presence of DNA homology between the products. Restriction enzyme analysis of the PCR products, however, showed that sequence heterogeneity existed which was confirmed by partial sequencing of the products. Another primer, P5 (5AGGAGAGAGCTCGACGGTCA), was developed to exploit the sequence variations. When the P1-P5 primer set was used, a product was amplified from most B. bassiana isolates, including two which failed to amplify with the P1-P3 set. This amplification was not observed with the other Beauveria species tested. The nature of the sequence variations within the P1-P3 PCR-amplified region suggests the placement of B. densa and B. caledonica outside the species B. bassiana, confirming previous evidence with mitochondrial DNA and DNA probes. PCR with the P1-P3 and P1-P5 primer sets was used to discriminate isolates of B. bassiana found to be infecting a population of the migratory grasshopper, Melanoplus sanguinipes, collected in Saskatchewan. The PCR products derived from the P1-P3 primer set with the various Beauveria spp. could be differentiated by single-strand conformation polymorphisms (SSCP). Thus, analysis of PCR products using restriction enzymes, sequencing, or SSCPs allows positive differentiation of a particular B. bassiana isolate from others. The great sensitivity of these techniques should help the release and monitoring of entomopathogenic fungi in the environment.

The impact of biotechnology on hyphomycetous fungal insect biocontrol agents.

The potential for the control of insect pests by entomopathogenic fungi has been touted for decades, if not centuries. Only recently have advances in biotechnology provided the tools for indepth analysis of the mechanisms involved in pathogenesis and host death at the molecular level. This review outlines the current state of knowledge regarding the mode of infection and targets several key components that are amenable to improvement via biotechnology. Realization of the considerable economic potential of fungal bioinsecticides can occur only through a combined and coordinated effort involving fundamental science, formulation technology and field applications.

Effect of T-2 toxin and verrucarin A in combination on Kluyveromyces marxianus.

The growth inhibitory effects of combinations of T-2 toxin and verrucarin A on the yeast Kluyveromyces marxianus was studied. A combination index value was derived to indicate the type of interaction that existed between the binary mixture of these two toxins at various ratios and the target yeast cells. The type of interaction was dependent on the ratio of the toxins used to attain a particular level of growth inhibition. Further, the least change in the type and intensity of interaction or the maximally quiescent ratio (MQR) was found to be unique to the growth medium. In a rich medium, the MQR was 1.0 microgram/ml T-2 toxin:0.75 microgram/ml verrucarin A, where the two toxins had a very stable synergistic interaction over a 2 or 3 log value concentration range. Decreasing the nutrients changed the MQR to 1.0 micrograms/ml T-2 toxin:0.38 microgram/ml verrucarin A. Halving the concentration of the cells in the assay changed the MQR to 1.0 microgram/ml T-2 toxin:6.0 micrograms/ml verrucarin A. We have previously shown that the hierarchy of trichothecene toxicity in yeast bioassay is verrucarin A > roridin A > T-2 toxin > diacetoxyscirpenol > HT-2 toxin. The MQR of these toxins in combination with T-2 toxin follows the same order. This study shows an exception to the above order in that verrucarin A and roridin A exchange places.

Identification of Molecular Variants in Mitochondrial DNAs of Members of the Genera Beauveria, Verticillium, Paecilomyces, Tolypocladium, and Metarhizium.

A set of five mitochondrial (mt) probes derived from a strain of Beauveria bassiana was used to evaluate the similarity of mtDNAs from 15 additional isolates of this fungus and five genera of other entomopathogenic fungi. The probes and genes encoded for (shown in parentheses) were pBbmtE2 (NADI, ATP6), pBbmtE3 (ATP6, small rRNA [srRNA]), pBbmtE4 (srRNA, CO3, NAD6), pBbSE1 (NAD6, tRNA, large rRNA [lrRNA]), and pBbXS1 (lrRNA). The probes produced identical hybridization patterns in EcoRI-digested DNA from nearly all isolates of B. bassiana and Beauveria caledonica. Similar patterns were also observed with Beauveria densa. The isolates of B. caledonica and B. densa DNAs could be differentiated from each other and from B. bassiana on the basis of a HindIII digestion and probing with pBbmtE3. Probe pBbmtE2 produced either a 5.0-kb or a 4.1-kb band in all of the B. bassiana isolates. This observation was used to categorize the mtDNA of B. bassiana into two types, designated A and B. Hybridization of the five probes produced distinct banding patterns in Beauveria brongniartii, Tolypocladium cylindrosporum, Tolypocladium nivea, Metarhizium anisopliae, Verticillium lecanii, and Paecilomyces farinosus. Hybridizations carried out with multiple probes simultaneously present produced unique patterns which characterized the B. bassiana group from all other fungi tested. These results are discussed in terms of how mtDNA polymorphisms in B. bassiana may relate to natural population structures, mt transmission in deuteromycetes, and the use of mtDNA polymorphisms in structural analysis of mtDNA.

The occurrence of inducible anti-Escherichia coli activity in hemolymph from the migratory grasshopper, Melanoplus sanguinipes.

1. Inducible antibacterial activity against an Escherichia coli strain has been shown to occur in the hemolymph of Melanoplus sanguinipes. 2. This anti-E. coli activity was induced by the infection with Serratia marcescens or E. coli K12 but not Enterobacter cloacae. 3. The greatest anti-E. coli activity was observed in hemolymph extracted from grasshoppers 6 hr after the injection of any of the two species of bacteria. 4. Anti-E. coli activity disappeared in hemolymph extracted from grasshoppers 8 hr after injection or longer.

The mitochondrial genome of the entomopathogenic fungus Beauveria bassiana: analysis of the ribosomal RNA region.

The 28.5-kbp mitochondrial (mt) genome from the entomopathogenic fungus Beauveria bassiana was studied using restriction enzyme analysis, gene probe hybridization, and DNA sequence comparisons. A detailed restriction enzyme map allowed cloning of the entire genome into a number of segments. Hybridization of heterologous gene probes to the mtDNA resulted in the identification of the large ribosomal RNA (lrRNA) and small ribosomal RNA (srRNA) genes. Gene probes derived from several yeasts and fungi failed to identify any additional genes. However, partial DNA sequence analysis revealed the lrRNA and srRNA genes as well as four protein-encoding genes: the NADH dehydrogenase subunit 1 (NAD1), NADH dehydrogenase subunit 6 (NAD6), cytochrome oxidase subunit 3 (CO3), and ATPase subunit 6 (ATP6) genes. The ATPase subunit 9 (ATP9) gene was not identified by hybridization to mtDNA, but could be detected by hybridization to total cellular DNA. The portions of the genes sequenced were homologous to the equivalent genes from yeast and other filamentous fungi, most notably Aspergillus nidulans. No introns were identified in these regions. The organization of the sequenced region of the B. bassiana mt genome more closely resembled that of A. nidulans than that of Podospora anserina or Neurospora crassa.

Partial purification and characterization of two extracellular N-acetyl-D-glucosaminidases produced by the entomopathogenic fungus Beauveria bassiana.

Beauveria bassiana grown in a liquid medium containing N-acetyl-D-glucosamine and colloidal chitin produced two distinct N-acetyl-D-glucosaminidases, NAGase 1 and NAGase 2. NAGase 1 had a molecular weight of 97,000 and NAGase 2 was comprised of two subunits, of molecular weights 64,000 and 66,000. The optimal temperature and pH for NAGase 1 were 57 degrees C and pH 5 and for NAGase 2 they were 37 degrees C and pH 5. NAGase 1 was more thermostable than NAGase 2. The isolectric points of NAGase 1 and 2 were ca. pH 9.5 and 5.5, respectively. NAGase 1 and 2 were unaffected by a 10 mM concentration of chloride salts of the ions Ca2+, Mg2+, or Zn2+, by 10 mM EDTA, and by 0.25-1 mM of short chain fatty acids. Dithiothreitol caused some inactivation of NAGase 2 while stimulating activity of NAGase 1. NAGase 1 had a Km of 0.38 mM and a Kcat/Km of 3923.88 M-1.s-1.NAGase 2 had a Km of 2.095 mM and a Kcat/Km of 411.88 M-1.s-1 when p-nitrophenyl-beta-N-acetylglucosaminide was used as the substrate.

Regulation of extracellular N-acetyl-D-glucosaminidase production in the entomopathogenic fungus Beauveria bassiana.

The entomopathogenic fungus Beauveria bassiana produces two extracellular N-acetylglucosaminidases (NAGase) in liquid medium containing colloidal chitin as the sole source of carbon and nitrogen. To study the regulation of NAGase synthesis, N-acetyl-D-glucosamine (GlcNAc), glucose NH4NO3, or amino acids were added to the colloidal chitin medium and NAGase activity was measured. NAGase synthesis was (i) induced with GlcNAc, and no repression was observed with GlcNAc provided at 2% (w/v); (ii) repressed in the presence of glucose plus NH4NO3; (iii) partially repressed when glucose or NH4NO3 was provided; and (iv) repressed to levels that were < 40% of the control levels when glutamic acid, tyrosine, arginine, proline, valine, and histidine were provided to the colloidal chitin medium. Total NAGase activity levels were > 60% of the control activity when alanine, glycine, isoleucine, aspartic acid, and leucine were tested. It appears that synthesis of NAGase is sensitive to cell energy and the carbon and nitrogen requirements.

Effects of T-2 toxin on ethanol production by Saccharomyces cerevisiae.

A trichothecene mycotoxin, T-2 toxin, inhibits several aspects of cellular physiology in Saccharomyces cerevisiae, including protein synthesis and mitochondrial functions. We have studied growth of, glucose utilization by, and ethanol production by S. cerevisiae and show that they are inhibited by T-2 toxin between 20 and 200 micrograms/ml in a dose-dependent manner. At 200 micrograms/ml, T-2 toxin causes cell death. This apparent inhibition of ethanol production was found to be the result of growth inhibition. On the basis of biomass or glucose consumption, T-2 toxin increased the amount of ethanol present in the culture. This suggests that T-2 inhibits oxidative but not fermentative energy metabolism by inhibiting mitochondrial function and shifting glucose catabolism toward ethanol formation. As T-2 toxin does not directly inhibit ethanol production by S. cerevisiae, this system could be used for ethanol production from trichothecene-contaminated grain products.

Pathogenicity of Beauveria bassiana in mice.

The potential pathogenicity of Beauveria bassiana was examined by intramuscular injection of high (2 x 10(8)) or low (2 x 10(5)) concentrations of conidia spores, into the left or right quadriceps muscles of CD-1 mice, respectively. The injection sites were monitored over a period of 28 days by both microbiological and histopathological methods. Focal muscle necrosis, edema and inflammation occurred rapidly (within 12 hours) at the high dose application (2 x 10(8)) site, but such lesions were far less severe with the low dose spore application (2 x 10(5)). Fungal spores in the high dose site persisted in normal shape for 2 weeks, after which time they began to degenerate. Almost all spores were cleared from the injection site within the 28-day observation period. Spread to other organs of the body was not observed, except by macrophage transport to regional lymph nodes. At the low dose rate, most spores were cleared within 12 h to 2 d, leaving only mild focal edema and inflammation. Viable fungal colonies could be recovered up to 3 d after injection from the high dose site, but only up to 12 h from the low dose site. It was concluded that B. bassiana does not cause infection, nor multiply, nor survive for more than 3 days when injected intramuscularly into healthy mice.

Trichothecene synergism, additivity, and antagonism: the significance of the maximally quiescent ratio.

The interactive effect of the combinations of trichothecene mycotoxins often found in fungus infected plants, contaminated grain, and other biological systems is poorly understood. Growth inhibition of the yeast Kluyveromyces marxianus was used to measure the effects of HT-2 toxin, roridin A, and T-2 toxin as individual toxins or as binary mixtures. A value, the combination index, was derived which indicates the interactive effects of a binary mixture of toxins. The interaction is affected by the ratio of the individual toxins, and the percent inhibition of yeast growth. Generally the interaction of T-2 toxin and roridin A or T-2 toxin and HT-2 toxin changes from antagonistic when they cause a low percent inhibition of yeast growth to synergistic when they cause a high percent inhibition of yeast growth. Additionally, any two trichothecenes have a unique ratio, which we name the maximally quiescent ratio (or MQR), where there is the least change in the type and intensity of their interaction. The maximally quiescent ratio in this case has helped to define the nature of toxin interactions and could be used to provide insights into hormone, immune system, developmental, enzyme, and gene regulation, combined drug therapy, and the action of mixtures of natural or synthetic toxins, carcinogens, pesticides, and environmental pollutants.