Homozygosity for a missense variant in COMP gene associated with severe pseudoachondroplasia.

The phenotypic spectrum associated with heterozygous mutations in cartilage oligomeric matrix protein gene (COMP) range from a mild form of multiple epiphyseal dysplasia (MED) to pseudoachondroplasia (PSACH). However, the phenotypic effect from biallelic COMP variants is unclear. We investigated a large consanguineous Pakistani family with a severe form of PSACH in 2 individuals. Another 14 family members presented with a mild PSACH phenotype similar to MED. Using exome sequencing and subsequent segregation analysis, we identified homozygosity for a COMP missense variant [c.1423G>A; p.(D475N)] in the 2 severely affected individuals, whereas family members with the mild PSACH phenotype were heterozygous. Our observations show for the first time that a biallelic COMP variant may be associated with pronounced and widespread skeletal malformations suggesting an additive effect of the 2 mutated alleles.

First Report of Phoma glomerata Associated with the Ascochyta Blight Complex on Field Pea (Pisum sativum) in Australia.

The ascochyta blight complex on field pea (Pisum sativum) in Australia causes severe yield loss of up to 60% (1). This blight complex includes a range of different symptoms, including ascochyta blight, foot rot, and black stem and leaf and pod spot (together more commonly known as "black spot disease" in Australia). In Australia, disease is generally caused by one or more of the four fungi: Didymella pinodes, Phoma pinodella, Ascochyta pisi, and P. koolunga (1,2). However, in September 2012, from a field pea disease screening nursery at Medina, Western Australia, approximately 1% of isolates were a Phoma sp. morphologically different to any Phoma sp. previously reported on field pea in Australia. The remaining isolates were either D. pinodes or P. pinodella. Single spore isolations of two isolates of this Phoma sp. were made onto Coon's Agar and DNA extracted. Two PCR primers TW81 (5'GTTTCCGTAGGTGAACCTGC 3') and AB28 (5'ATATGCTTAAGTTCAGCGGGT 3') were used to amplify extracted DNA from the 3' end of 16S rDNA, across ITS1, 5.8S rDNA, and ITS2 to the 5' end of the 28S rDNA. The PCR products were sequenced and BLAST analyses used to compare sequences with those in GenBank. In each case, the sequence had ≥99% nucleotide identity with the corresponding sequence in GeneBank for P. glomerata. Isolates also showed morphological similarities to P. glomerata as described in other reports (3). The relevant information for a representative isolate has been lodged in GenBank (Accession No. KF424434). The same primers were used by Davidson et al. (2) to identify P. koolunga, but neither of our two isolates were P. koolunga. A conidial suspension of 106 conidia ml-1 from a single spore culture was spot-inoculated onto foliage of 20-day-old plants of P. sativum variety WAPEA2211 maintained under >90% RH conditions for 72 h post-inoculation. Symptoms on foliage first became evident by 8 days post-inoculation, consisting of dark brown lesions 1 to 2.5 mm in diameter. P. glomerata was readily re-isolated from infected foliage to fulfill Koch's postulates. No lesions occurred on foliage of control plants inoculated with only deionized water. A culture of this representative isolate has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13652). While not reported previously on P. sativum in Australia, P. glomerata has been reported on other legume crop and pasture species in eastern Australia, including Cicer arietinum (1973), Lupinus angustifolius (1982), Medicago littoralis (1983), M. truncatula (1985), and Glycine max (1986) (Australian Plant Pest Database). Molecular analysis of historical isolates collected from P. sativum in Western Australia, mostly in the late 1980s and 1990s, did not show any incidence of P. glomerata, despite this fungus being previously reported on Citrus, Cocos, Rosa, Santalum, and Washingtonia in Western Australia (4). We believe this to be the first report of P. glomerata as a pathogen on field pea in Australia. The previous reports of P. glomerata on other crop legumes in eastern Australia and its wide host range together suggest potential for this fungus to be a pathogen on a range of leguminous genera/species. References: (1) T. W. Bretag et al. Aust. J. Agric. Res. 57:883, 2006. (2) J. A. Davidson et al. Mycologica 101:120, 2009. (3) G. Morgan-Jones. CMI Descriptions of Pathogenic Fungi and Bacteria No.134 Phoma glomerata, 1967. (4) R. G. Shivas. J. Roy. Soc. West. Aust. 72:1, 1989.

First Report of Black Spot Caused by Boeremia exigua var. exigua on Field Pea in Australia.

Black spot is a major disease of field pea (Pisum sativum L.) production across southern Australia. Known causal agents in Australia include one or more of Mycosphaerella pinodes (Berk. & Bloxam) Vestergr., Phoma medicaginis var. pinodella (L.K. Jones), Ascochyta pisi Lib., or P. koolunga (Davidson, Hartley, Priest, Krysinska-Kaczmarek, Herdina, McKay & Scott) (2), but other pathogens may also be associated with black spot symptoms. Black spot generally occurs on most plants and in most pea fields in Western Australia (W.A.), and during earlier winter/spring surveys of blackspot pathogens, some isolates were tentatively allocated to P. medicaginis var. pinodella despite different cultural characteristics on potato dextrose agar (PDA). Recently, single-spore isolations of a single culture each from an infested pea crop at Medina, Moora, and Mt. Barker in W.A. were made onto PDA. A PCR-based assay with TW81 and AB28 primers was used to amplify from the ITS-5.8S rDNA region. Purified DNA products were sequenced for the three isolates and then BLASTn was used to compare sequences with those in GenBank. Our sequences (GenBank Accession Nos. JN37743, JN377439, and JN377438) had 100% nucleotide identity with P. exigua Desm. var. exigua accessions (GI13385450, GI169894028, and GI189163921), an earlier synonym of what is now known as Boeremia exigua var. exigua ([Desm.] Aveskamp, Gruyter & Verkley) (1). Davidson et al. (2) used the same primers to identify P. koolunga, but none of our isolates were P. koolunga. A suspension of 107 conidia ml-1 of each representative isolate was inoculated onto foliage of 15-day-old field pea cv. Dundale plants and maintained at >90% relative humidity for 72 h postinoculation. Control plants inoculated with just water remained symptomless. Brown lesions were evident by 8 to 10 days postinoculation and mostly 1 to 3 mm in diameter. B. exigua var. exigua was readily reisolated from infected leaves. Isolates have been lodged in the W.A. Culture Collection Herbarium maintained at the Department of Agriculture and Food W.A. (Accession Nos. WAC13500, WAC13502, and WAC13501 from Medina, Moora, and Mt. Barker, respectively). Outside Australia, its synonym P. exigua var. exigua is a known pathogen of field pea (4), other legumes including common bean (Phaseolus vulgaris L.) (4) and soybean (Glycine max [L.] Merr.) (3), and is known to produce phytotoxic cytochalasins. In eastern Australia, P. exigua var. exigua has been reported on common bean (1930s and 1950s), phasey bean (Macroptilium lathyroides [L.] Urb.) and siratro (M. atropurpureum (DC.) Urb.) (1950s and 1960s), mung bean (Vigna radiata [L.] Wilczek.) (1960s), ramie (Boehmeria nivea [L.] Gaudich.) (1939), potato (Solanum tuberosum L.) (1980s), and pyrethrum (Tanacetum cinerariifolium [Trevir.] Schultz Bip.) (2004 and 2007) (Australian Plant Pest Database). To our knowledge, this the first report of B. exigua var. exigua on field pea in Australia, and because of its potential to be a significant pathogen on field pea, warrants further evaluation. References: (1) M. M. Aveskamp et al. Stud. Mycol. 65:1, 2010. (2) J. A. Davidson et al. Mycologia 101:120, 2009. (3) L. Irinyi et al. Mycol. Res. 113:249, 2009. (4) J. Marcinkowska. Biul. Inst. Hod. Aklim. Rosl. 190:169, 1994.

First Report of Phoma herbarum on Field Pea (Pisum sativum) in Australia.

Black spot disease on field pea (Pisum sativum) in Australia is generally caused by one or more of the four fungi: Mycosphaerella pinodes (anamorph Ascochyta pinodes), Phoma medicaginis var. pinodella (synonym Phoma pinodella), Ascochyta pisi, and Phoma koolunga (1,2,4). However, in 2010 from a field pea blackspot disease screening nursery at Medina, Western Australia, approximately 25% of isolates were a Phoma sp. that was morphologically different to Phoma spp. previously reported on field pea in Western Australia, while the remaining 75% of isolates were either M. pinodes or P. medicaginis var. pinodella. Single-spore isolations of 23 isolates of this Phoma sp. were made onto potato dextrose agar. A PCR-based assay with the TW81 and AB28 primers was used to amplify from the 3' end of 16S rDNA, across ITS1, 5.8S rDNA, and ITS2 to the 5' end of the 28S rDNA. The DNA products were sequenced and BLAST analyses were used to compare sequences with those in GenBank. In each case, the sequence had ≥99% nucleotide identity with the corresponding sequence in GenBank for P. herbarum. Isolates also showed morphological similarities to P. herbarum as described in other reports (e.g., 3). The relevant information for a representative isolate has been lodged in GenBank (Accession No. JN247437). The same primers were used by Davidson et al. (2) to identify P. koolunga, but none of our 23 isolates were P. koolunga. A conidial suspension of 107 conidia ml-1 from a single-spore culture was spray inoculated onto foliage of 10-day-old Pisum sativum cv. Dundale plants maintained under >90% relative humidity conditions for 72 h postinoculation. Symptoms evident by 11 days postinoculation consisted of pale brown lesions that were mostly 1.5 to 2 mm long and 1 to 1.5 mm wide. Approximately 50% of lesions showed a distinct chlorotic halo extending 1 to 2 mm outside the boundary of the lesion. P. herbarum was readily reisolated from infected foliage. A culture of this representative isolate has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13499). Outside of Australia, P. herbarum, while generally considered a soilborne opportunistic pathogen, has been reported on a wide range of species, including field pea (3). Molecular analysis of historical isolates collected from field pea in Western Australia, mostly in the late 1980s, did not show any incidence of P. herbarum, despite this fungus being reported on alfalfa (Medicago sativa) and soybean (Glycine max) in Western Australia in 1985 (Australian Plant Pest Database). In Western Australia, this fungus has also been recorded on a Protea sp. in 1991 and on Arabian pea (Bituminaria bituminosa) in 2010 (Australian Plant Pest Database). To our knowledge, this is the first report of P. herbarum as a pathogen on field pea in Australia. These previous reports of P. herbarum on other hosts in Western Australia and the wide host range of P. herbarum together suggest the potential for this fungus to be a pathogen on a wider range of genera/species than field pea. References: (1) T. W. Bretag and M. Ramsey. Page 24 in: Compendium of Pea Diseases and Pests. 2nd ed. The American Phytopathologic Society, St Paul, MN, 2001. (2) J. A. Davidson et al. Mycologica 101:120, 2009. (3) G. L. Kinsey. Phoma herbarum. No 1501. IMI Descriptions of Fungi and Bacteria, 2002. (4) T. L. Peever et al. Mycologia 99:59, 2007.

Prevalence of histological reflux oesophagitis in H. pylori positive patients: effect of density of H. pylori and activity of inflammation.

OBJECTIVE: Recently there has been a great interest in the role of Helicobacter pylori in gastroesophageal reflux disease. Many studies do not show any significant difference in the overall prevalence of H. pylori in patients with endoscopic oesophagitis and controls. In this prospective study we assessed the influence of H. pylori density and activity of inflammation in different parts of stomach on histological oesophagitis. METHODS: One Hundred and forty consecutive patients undergoing endoscopy for dyspepsia and heartburn were evaluated. Three biopsies were taken from antrum and two each from corpus, cardia and lower oesophagus. Urease test (CLO test) was performed. Density and activity of infection was assessed in a semi-quantitative way. RESULTS: One Hundred and Fourteen (81%) patients from the 140 endoscoped, were positive for H. pylori and had H. pylori positive antral gastritis. Of these 114 cases, H. pylori were detectable in 104 (91%) of biopsies taken from corpus and 96 (84%) of biopsies from cardia. There was a strong correlation of density of H. pylori (0-3) in antrum with body and of body with cardia by Spearman correlation tests (p = 0.000). But H. pylori were more dense in antrum as compared to corpus and in corpus as compared to cardia (p = 0.0000 and 0.0003 respectively by Wilcoxon's rank test). Neutrophil activity and degree of mononuclear infiltrate were also greater in antrum as compared to corpus (p = 0.000 and 0.059). The activity and degree of inflammation was not significantly different in corpus-cardia pair. Out of 114 H. pylori positive patients, 75 had histological oesophogitis (p = 0.855). After excluding cases of hiatal hernia (H.H) and gapping lower oesophageal sphincter (LOS), number of H. pylori positive patients decreased to 73, out of these 50 had histological oesophagitis (p = 0.103). In all H. pylori positive patients with histological oesophagitis, H. pylori density (1-3) in antrum correlated with severity of oesophagitis (P = 0.011). Neutrophil activity in antrum and corpus also correlated with the severity of histological oesophagitis (P = 0.024 and 0.035 respectively). Correlation further improved after excluding cases of HH and gapping LOS (P = 0.002 for H. pylori density and 0.026 and 0.004 for activity in antrum and corpus). No correlation could be found of density and activity of infection in cardia with histological oesophagitis. CONCLUSION: Our H. pylori positive patients had more dense and severe infection in antrum. Those who had histological oesophagitis in addition showed a positive correlation of the density of H. pylori in antrum and neutrophil activity in antrum and corpus with the severity of histological oesophagitis.

Renal tubular basement membrane changes in tubulointerstitial damage in patients with glomerular diseases.

Injury to renal tubules and interstitium occur in various glomerular diseases, leading to functional impairment. Tubular basement membrane (TBM) is an important component in maintaining tubular epithelial cell integrity. Because ultrastructural changes in these structures had not been studied in detail, the authors analyzed 30 patients with various types of glomerular diseases, including minimal change disease (MCD), focal segmental glomerular sclerosis, IgA nephropathy, diffuse proliferative glomerulonephritis, membranous nephropathy, and lupus nephritis, by light, electron, and immunofluorescence microscopy. Ultrastructural changes in the TBM were studied and morphometric measurements were performed. The tubular basement membranes showed membranous structures, lucent or lytic areas, and tubular epithelial detachment. There was significant linear correlation between these tubular basement membrane changes and terminal complement complex neoantigens. The interstitial widening was due to banded collagen fibers, with anchoring fibers in the TBM. The various glomerular diseases lead to tubulointerstitial damage via changes in the TBM, leading to renal dysfunction.

Prevalence of streptococcal sorethroat in the school children of Dhaka.

Beta Haemolytic Streptococcal (BHS) infections and their sequelae Rheumatic Fever (RF) and Glomerulonephritis (GN) have a world wide distribution and so pose an important health problem. Reports show that there is considerable variation in the number of isolations from different groups. Present study intended to find out the health status of the school children in relation to streptococcal throat infection, in Dhaka Cantonment. It was a cross sectional, observational study. During one year period total six hundred and one (601) children were examined from one school of Dhaka Cantonment. Prevalence of streptococcus was found to be 22% among the study population with highest rate (67%) for group-G among BHS positive cases. True streptococcal infection was found in 8.7% cases & 2.2% cases were true GABHS positive cases. GABHS was significantly higher in large size families. Females and children from lower socioeconomic group were at higher risk. Females and children of large families may require special attention regarding prevention of streptococcal infection and RF/RHD prevention programme.

Trace elements in spinach (Spinacia oleracea) cultivated in soil fortified with graded levels of iron.

Trace elements in two varieties of spinach cultivated in soil with different levels of added iron were determined. Addition of iron to soil decreased potassium, sodium and magnesium contents in spinach markedly (p < 0.05), while the contents of zinc, manganese and copper in spinach were not significantly altered (p > 0.05). Differential behavior of spinach varieties was found in the zinc, manganese and sodium contents.

Role of complement in renal tubular damage.

Deposition of immunoglobulins, complement proteins C1q, C3c, C3d, C4, C5, C6, C7, C8, C9, and terminal complement complex neoantigens in the renal tubulointerstitium was studied in serial sections by immunofluorescence microscopy. Renal tissue from 45 cases with various glomerular diseases, including 8 controls, was studied. The patients were divided into groups; one with tubulointerstitial lesions (24 cases) and the other without (13 cases). The immunoproteins were deposited mainly in the tubular basement membrane and blood vessels. Compared with controls there was a significantly increased staining score for C5 to C9 in the tubular basement membrane in both disease groups. However, the increase in terminal complement complex neoantigens score was significant only in the disease group with tubulo interstitial lesions. The changes in C3d score were not significant. Serial sections showed consistent and heavy ribbon-like deposits of complement proteins C3d, C5 to C9, and terminal complement complex neoantigens in corresponding locations of the segments of tubular basement membrane, mainly in the disease group with tubulointerstitial lesions and especially in the damaged tubules. These findings suggest that in situ activation of the complement cascade leads to the deposition of terminal complement complex neoantigens. Complement activation in the basal area of the tubules may, therefore, be an important pathogenetic mechanism in tubulointerstitial damage.

In vitro bioavailability of iron from spinach (Spinacea oleracea) cultivated in soil fortified with graded levels of iron and zinc.

A pot-culture experiment was conducted to assess the bioavailability of iron from spinach cultivated in soil fortified with graded levels of iron and zinc (FeSO4 x 7H2(0) and ZnSO4 x 7H2(0), respectively). Applications of varying levels of iron to soil increased the total iron and phosphorus contents and decreased the zinc content (P < 0.05). The effect of applying varying levels of zinc was the opposite of on the minerals in spinach. The ascorbic acid content was remarkably reduced with varying levels of iron and zinc. Higher levels of zinc and lower levels of iron in the soil increased the bioavailability of iron from spinach (P < 0.05). In conclusion, the interactions of 15 ppm zinc with 30 ppm iron significantly enhanced the bioavailability of iron, total iron and zinc contents.

An in situ hybridization study of herpes simplex and Epstein Barr viruses in IgA nephropathy and non-immune glomerulonephritis.

Renal tissues from forty cases of IgA nephropathy, 20 Singapore and 20 British patients, and 38 patients with non-immune glomerulonephritis were studied by in situ hybridization using DNA probes for the herpes simplex virus (HSV) and Epstein Barr virus (EBV). Two Singapore patients with IgA nephropathy showed HSV antigens in the glomerular mesangium, with one of them having EBV coinfection. In the control non-immune glomerulonephritis cases, 4 patients had viral antigens; 2 with EBV, one with EBV and HSV coinfection, and one with HSV alone. The study indicates that in some cases of IgA nephropathy and in non-immune nephropathy there may be coincidental rather than causal persistent infection by the herpes group of viruses.

Study of renal tubular glycoconjugates in tubulointerstitial damage using conjugated lectins.

Changes in the glycoconjugates of renal tubules associated with tubular damage were studied by lectin histochemistry, and their possible significance was determined. The excretion of various saccharides in tubular casts may also serve as markers of renal tubular damage. Renal tissues from 55 cases with various glomerular diseases including ten controls were studied. The patients were divided into two groups: one with tubulointerstitial lesions (TILs) (30 cases), and the other without (15 cases). Our results showed a wide spectrum of changes, predominantly in the disease group with TILs. The brush border of the proximal tubules showed significantly increased staining with Triticum vulgaris (WGA) and decreased staining with Canavalia ensiformis (Con A) lectins in both disease groups. The distal tubules revealed a significant increase in the apical and a decrease in the basal staining with Arachis hypogaea (PNA) and WGA lectins, respectively, in cases with TILs. The significant decrease in the basal domain staining was also seen with WGA lectin in cortical ducts. The vulnerability of various segments of the tubules in the process of TILs was clearly demonstrable. It appeared that the distal tubules were the most vulnerable anatomical segments around which the TILs began and later spread to involve other segments of tubules.

Morphometric study showing the importance of distal tubular damage in impaired creatinine clearance.

It is established that the glomerular filtration rate (GFR) is affected by tubulointerstitial lesions (TIL) in various glomerulonephritides. The fall in GFR is believed to be the result of damage to tubules, mainly the proximal tubules, and interstitial widening. We performed the morphometric point-counting study in 45 renal biopsies with various glomerular diseases, and 10 controls, to quantify interstitial widening, proximal and distal tubular damage, and to study their relation to serum creatinine clearance, and also to determine the best predictor, and the degree of damage in each component of the tubulointerstitium. There was a statistically significant correlation of serum creatinine clearance to interstitial widening (r = -0.748; p = 0.0001) and decrease in proximal (r = 0.611; p = 0.0001) and distal tubular area percentages, with a maximum value of the correlation coefficient for the distal tubules (r = 0.818; p = 0.0001). On the basis of relative mean difference values, it appeared that in the presence of tubulointerstitial damage, the distal tubule sustained greater damage. Therefore, distal tubular damage may serve as an important prognostic parameter.

Renal tubular antiproteinase (alpha-1-antitrypsin and alpha-1-antichymotrypsin) response in tubulo-interstitial damage.

We studied the role of proteinase inhibitors (Pls) alpha 1-antitrypsin and alpha 1-antichymotrypsin in relation to lysozyme (LZM), and membrane attack complex (C5b-9) in renal tubular damage by immunohistochemical techniques. Fifty-five cases, including 45 patients with glomerular diseases, and 10 controls were studied. The patients were divided into two groups; one with tubulo-interstitial lesions (TILs; 30 cases), and the other without (15 cases). Significant antiproteinase response was observed in the proximal tubules in both disease groups, indicating that they were subjected to proteolytic attack. This response correlated with proteinuria and occurred in tubules which showed protein reabsorption as demonstrated by the presence of LZM staining in consecutive serial sections. Increased deposition of membrane attack complex (C5b-9) was observed in the disease group with TILs, indicating direct damage to cell membranes. C5b-9 may also generate oxygen species, potent inhibitors of Pls, which allow the proteases to cause tubular damage.

IgA nephropathy in Pakistan.

A light, electron and immunofluorescence microscopy study was performed on 102 consecutive patients on whom suitable percutaneous renal biopsies were obtained. In this selected group of patients primary IgA glomerulonephritis was diagnosed in 6 (5.9%) cases. On light microscopy the glomerular lesions were predominantly focal (WHO class III) and diffuse mesangial proliferative glomerulonephritis (Class IV). The mesangial deposits showed high association with IgM deposits and presence of early complement components (C1q, C4) indicative of both classical and alternative pathways of C3 activation in our patients. The high incidence of nephrotic syndrome with microhaematuria (5 cases) is due to patient selection when compared to other studies. This study shows the existence of IgA nephropathy in Pakistan and larger number of cases need to be investigated to determine the true prevalence of this disease and its clinical manifestations and importance in Pakistan.