RESUMO
Ciprofloxacin (CFX), a widely used fluoroquinolone antibiotic, is critical in healthcare settings for treating patients. However, improper treatment of wastewater from these facilities can lead to environmental contamination with CFX. This underscores the need for an efficient, straightforward method for early detection. In this study, a DNA aptamer was selected through a hierarchical docking workflow, and the stability and interactions were assessed by Molecular Dynamics (MD) simulation. The aptamer-CFX complex that showed the most promise had a docking score of -8.596 kcal/mol and was further analyzed using MD simulation and MM/PBSA. Based on the overall results, the identified ssDNA sequence length of 60 nt (CAGCGCTAGGGCTTTTAGCGTAATGGGTAGGGTGGTGCGGTGCAGATATCGGAATTGGTG) was immobilized over a gold transducer surface through the self-assembled monolayer (SAM; Au-S-ssDNA) method. The ssDNA-modified surface has demonstrated a high affinity towards CFX, which is confirmed by cyclic voltammogram (CV) and electrochemical impedance spectroscopy measurements (EIS). The DNA-aptamer modified electrode demonstrated a good linear range (10 × 10-9 - 200 × 10-9 M), detection limit (1.0 × 10-9 M), selectivity, reproducibility, and stability. The optimized DNA-aptamer-based CFX sensor was further utilized for the accurate determination of CFX with good recoveries in real samples.
Assuntos
Aptâmeros de Nucleotídeos , Técnicas Biossensoriais , Ciprofloxacina , Simulação de Acoplamento Molecular , Simulação de Dinâmica Molecular , Ciprofloxacina/química , Ciprofloxacina/análise , Aptâmeros de Nucleotídeos/química , Técnicas Biossensoriais/métodos , Simulação por ComputadorRESUMO
Aflatoxin B1 (AFB1) is a naturally occurring toxin produced by Aspergillus flavus and Aspergillus parasiticus. The AFB1 is classified as a potent carcinogen and poses significant health risks both to humans and animals. Early detection of the toxin in post-harvest agricultural products will save lives and promote healthy food production. In this study, stratified docking approach was utilized to screen and identify potential aptamers that can bind to AFB1. ssDNA sequences were acquired from the Mendeley dataset, secondary and tertiary structures were predicted through a series of bioinformatics pipelines. Further, the final DNA tertiary structures were minimized and SiteMap algorithm was used to probe and locate binding cavities. According to the final XP docking result, a 34 nt sequence (5'-ATCCTGTGAGGAATGCTCATGCATAGCAAGGGCT-3') aptamer with a docking score of -5.959 kcal/mol was considered for 200 ns MD Simulation. Finally, the screened DNA-aptamer was immobilized over the gold surface based on Au-S chemistry and utilized for the detection of AFB1. The fabricated DNA-aptamer electrode demonstrated a good analytical performance including wide linear range (1.0 to 1000 ng L-1), detection limit (1.0 ng L-1), high stability, and reproducibility.Communicated by Ramaswamy H. Sarma.