[Chemical ribonucleases: VII. Effect of positively charged RNA-binding domains and hydrophobic fragments of the conjugates based on 1,4-diazabicyclo[2.2.2]octane and imidazol on their ribonuclease activity].

The effect of the total positive charge in the RNA-binding domain of chemical ribonucleases that are conjugates of bisquaternary salts of diazabicyclo[2.2.2]octane and imidazol on the cleavage of an HIV-1 RNA fragment was studied. An increase in the positive charge from +2 to +4 was shown to result in a significant growth in the ribonuclease activity. Possible mechanisms of the interactions between structural moieties of chemical ribonucleases and RNA that enable an effective catalysis of the cleavage of phosphodiester bonds are discussed.

[Kinetic parameters of hydrolysis of CpA and UpA sequences in an oligoribonucleotide by compounds functionally mimicking ribonuclease A]. / Kineticheskie parametry gidroliza CpA- i UpA-posledovatel'nostei v sostave ribooligonukleotida pod deistviem soedinenii, funktsional'no imitiruiushchikh ribonukleazu A.

Kinetic parameters of cleavage of CpA and UpA sequences in an oligoribonucleotide under the action of artificial ribonuclease ABL3C1 were measured. The compounds were built of RNA-binding domain B, catalytic fragment C, linker L3 comprising 3 methylene groups, and aliphatic fragment A. The rate of cleavage of phosphodiester bonds in CpA sequence within decaribonucleotide UUCAUGUAAA was shown to be 3.4 +/- 0.2 times higher than in UpA sequence. The rate of cleavage of phosphodiester bonds were found to depend on substrate length: a thousandfold increase in cleavage rate constant was observed for CpA sequence in decaribonucleotide as compared with diribonucleotide monophosphate CpA. A slight decrease in the cleavage rates was observed for the reactions proceeding in different buffers at pH 7.0: imidazole > HEPES > phosphate > cacodylate. At the same time, the ratio of cleavage rates for CpA and UpA sequences remained constant.

[Chemical ribonucleases. 4. Analysis of the fragment structure of chemical ribonucleases based on 1,4-diazabicyclo[2.2.2]octane]. / Khimicheskie ribonukleazy. 4. Analiz fragmentnoi struktury khimicheskikh ribonukleaz na osnove 1,4-diazabitsiklo[2.2.2]oktana.

Artificial ribonucleases of the ABLkCm series were synthesized. They consist of a lipophilic alkyl radical (Et, n-C14H29, or C15H31) A, an "RNA-binding domain" B (bisquaternary salt of 1,4-diazabicyclo[2.2.2]octane), a "catalytic domain" Cm [histamine (C1) or histidine (C3) residue], and a "linker" Lk that joins the "domains" B and Cm [here, k is the number of methylene units (one or three) in the linker]. The effect of the "domain structure" on the catalytic properties of the chemical ribonucleases was analyzed using seven compounds of this series (ABL1C1, ABL3C1, ABL3C3, AC1, AB, BL2, and BL3C3). The catalytic activity of the compounds was assessed in the reaction of hydrolysis of the in vitro transcripts of human tRNA(Lys) and yeast tRNA(Asp) under physiological conditions. It was shown that only chemical ribonucleases that involve all the fragments of the ABLkCm construct can hydrolyze the substrate tRNA at a high rate (90% of tRNA is hydrolyzed for 10 h at 37 degrees C). The activity of the compounds is largely determined by the presence of a long lipophilic radical linked to 1,4-diazabicyclo[2.2.2]octane and a long linker, which joins the RNA-hydrolyzing and RNA-binding fragments. The results indicate an important role of hydrophobic interactions in the acceleration of the RNA hydrolysis reaction. The English version of the paper: Russian Journal of Bioorganic Chemistry, 2002, vol. 28, no. 4; see also http://www.maik.ru.

[Chemical ribonucleases. 2. Design and hydrolytic properties RNase mimetics based on diazabicyclo[2.2.2]octane with various positive charges]. / Khimicheskie ribonucleazy. 2. Dizain i gidroliticheskie svoistva RNKaza-mimetikov na osnove diazabitsiklo[2.2.2]oktana s razlichnym chislom polozhitel'nykh zariadov.

A procedure was proposed allowing one to synthesize RNA mimics on the basis of conjugates of diazabicyclo[2.2.2]octane with imidazole bearing a varying number of positive charges (nDm series, where n is the number of positive charges at neutral pH, m is the code of an imidazole-containing fragment of the catalytic domain: 1, histamine; 2, histidine methyl ester). The hydrolytic activity of six compounds of this series was studied under physiological conditions using in vitro transcript of human mitochondrial tRNA(Lys) as a substrate. It was shown that the rate of RNA hydrolysis with nDm conjugates rises with an increase in the number of positive charges: an approximately 30-fold acceleration of hydrolysis was observed with an increase in the total charge of the construct from +2 to +4.

[Chemical ribonucleases. 3. Synthesis of organic catalysts of hydrolysis of phosphodiester bonds based on quaternary salts of 1,4-diazabicyclo(2.2.2)octane]. / Khimicheskie ribonukleazy. 3. Sintez organicheskikh katalizatorov gidroliza fosfodiéfirnykh sviazei na osnove chetvertichnykh solei 1,4-diazabitsiklo(2.2.2)oktana.

On the basis of imidazole and bisquaternary salts of 1,4-diazabicyclo[2.2.2]octane, a number of highly effective catalysts of the nDm series (here, n is the number of positive charges at neutral pH values and m is the digital code of the catalytically active fragment: 1, histamine, and 2, histidine methyl ester) were synthesized for the cleavage of the phosphodiester bonds in ribonucleic acids. A general method for the synthesis of chemical ribonucleases was suggested, which helps vary both the number of positive charges in their RNA-binding domain and the catalytic center. By the example of hydrolysis under physiological conditions of the in vitro transcript of tRNA(Lys) from human mitochondria, it was shown that the RNA cleavage rate with the nDm conjugates increases approximately 30-fold along with the increase in the number of positive charges from two to four.

[Inhibition of reproduction of the human immunodeficiency virus by sense and antisense oligodeoxynucleotides]. / Ingibirovanie reproduktsii virusa immunodefitsita cheloveka smyslovymi i antismyslovymi oligodezoksinukleotidami.

Inhibitory effects on human immunodeficiency virus (HIV) reproduction on lymphoid cell line MT-4 were characterized for antisense and sense oligodeoxynucleotides. It was established that antisense oligonucleotide pCGTAGTTCGTCGAGGTCCGT (MP-20) (ID50 = 0.1 microM) is a more effective HIV inhibitor than the previously described pTGGCGTACTCACCAGTCGCCGC (DSS-22) (ID50 = 4.7 microM) and pTTTTTTTTTTTTTTTT (PA-16) (ID50 = 8.0 microM). A sense oligonucleotide pGCATCAAGCAGCTCCAGGCA (PM-20) (ID50 = 0.5 microM) complementary to the region of the start of translation of the open reading frame on the (+)-chain virus DNA was also investigated. Specificity of the anti-HIV-I action of oligonucleotides was confirmed by experiments with HIV-II.

[Nuclear peptides, specifically binding oligonucleotides]. / Iadernye peptidy, spetsifichno sviazyvaiushchie oligonukleotidy.

Interaction of alkylating derivatives of oligonucleotides with nuclear extracts from mammalian cells has been investigated. Three modified 1.5-, 3.0-, and 6.0-kDa proteins were detected in nuclear extracts from human and murine cells. The 1.5-kDa and 3.0-kDa proteins were also detected in insect, plant, yeast, and bacterial cells. The ubiquity of the proteins suggests their important role in cellular metabolism.

[Regulation of the expression of the c-fos gene in cells, reverting from being transformed to the pseudonormal phenotype]. / Reguliatsiia ékspressii gena c-fos v kletkakh, revertiruiushchikh ot transformirovannogo k psevdonormal'nomu fenotipu.

Regulation of c-fos expression in mice sarcoma cell lines CBA and C3H was investigated. Each of the cell lines was represented by a pair of clones: the tumorigenic and the one, which was produced from it by cloning. It was found, that c-fos expression in cells of the pseudonormal phenotype was similar to that in the normal fibroblasts. Experiments with cells reverted to pseudonormal phenotype transfected transiently or permanently with an indicator plasmid fos-cat have shown, that a 600 bp sequence of the c-fos promotor including the TATA site, provides the expression level of the chloramphenicol acetyltransferase, correlating with the level of the c-fos mRNA expression. In the tumorigenic cells, permanent high activity of the cat gene expression was observed which was comparable to that in the normal fibroblasts stimulated by the embrionic serum or TPA. Activity of the transcription factors interacting with regulatory elements SRE, DSE, TRE did not correlate with the c-fos expression level in all the cells.