Mononuclear copper(II) complexes with polypyridyl ligands: synthesis, characterization, DNA interactions/cleavages and in vitro cytotoxicity towards human cancer cells.

DNA being the necessary element in cell regeneration, controlled cellular apoptosis via DNA binding/cleaving is considered an approach to combat cancer cells. The widely prescribed metallodrug cisplatin has shown interactions with the guanine-N7 center, and a plethora of complexes are continually developed to enhance crosslinking properties as well as covalent and non-covalent interactions. Two pentadentate ligands, L1 (1-(6-(1H-benzo[d]imidazol-2-yl)pyridin-2-yl)-N,N-bis(pyridin-2-ylmethyl)methanamine) and L2 (1-(6-(1-methyl-1H-benzo[d]imidazol-2-yl)pyridin-2-yl)-N,N-bis(pyridin-2-ylmethyl)methanamine), were synthesized together with their respective copper(II) complexes [1](ClO4)2 and [2](ClO4)2, which crystallized in a trigonal bipyramidal fashion. Different analytical and spectroscopic methods confirmed their formation, and their redox behaviour was also examined. The interactions of salmon sperm DNA (ss-DNA) with these two complexes were explored using absorbance spectroscopy, and they both exhibited a binding affinity (Kb) of ∼104 M-1. Fluorescence quenching experiments with ethidium bromide (EB)-bound DNA (EB-DNA) were also performed, and Stern-Volmer constant (KSV) values of 6.93 × 103 and 2.34 × 104 M-1 for [1](ClO4)2 and [2](ClO4)2, respectively, were obtained. Furthermore, DNA conformational changes due to the interactions of both complexes were validated via circular dichroism. We also assessed the DNA cleavage property of these complexes, which resulted in the linearization of circular plasmid DNA. This finding was supported by studying the growth of MDA-MB-231 breast cancer cells upon treatment with both Cu(II) complexes; IC50 values of 5.34 ± 1.02 µM and 0.83 ± 0.18 µM were obtained for [1](ClO4)2 and [2](ClO4)2, respectively. This validates their affinity towards DNA, and these insights can be further utilized for non-platinum based economical metallodrug development based on first row transition metals.

Mononuclear cobalt(II) complexes with polypyridyl ligands: Synthesis, characterization, DNA interactions and in vitro cytotoxicity towards human cancer cells.

Mononuclear cobalt(II) complexes [CoII(L1)Cl2]; 1, [CoII(L1)(bpy)Cl]PF6; 2, [CoII(L1)(phen)Cl]PF6; 3 and [CoII(L2)Cl2]; 4 (where L1 = N,N-bis(pyridin-2-ylmethyl)aniline, L2 = (2,4,6-trimethyl-N,N-bis(pyridin-2-ylmethyl)aniline, bpy = 2,2/-bipyridine, phen = 1,10-phenanthroline) were synthesized and characterized by different analytical and spectroscopic methods. All the complexes were structurally identified by single-crystal X-ray crystallography. Penta-coordinated complex 1 adopted distorted trigonal bipyramidal and hexacoordinated complexes 2 and 3 having distorted octahedral geometry whereas tetra-coordinated complex 4 has distorted tetrahedral geometry. The interactions of salmon sperm DNA (ss-DNA) with complexes (1-4) were investigated by absorbance, fluorescence spectroscopy and molecular docking studies. All the complexes are very susceptible to DNA binding and the binding affinity (Kb) follows the order 3 (2.05 × 104 M -1) > 4 (1.40 × 104 M -1) > 2 (1.36 × 104 M -1) > 1 (1.34 × 104 M -1) indicating they have superior DNA binding ability. The Stern-Volmer constant (Ksv) ranges from 1.10 × 104 M -1 to 1.95 × 104 M -1 suggesting weak or moderate binding with DNA. DNA cleavage study in plasmid DNA reveals very efficient DNA cleavage factors even in the absence of any external agents. Using multiple biochemical assays, we have demonstrated that 1-4 induces apoptosis of human cancer cells with IC50 values of 26.48 ± 1.45 µM, 10.89 ± 0.55 µM, 7.63 ± 0.4 µM and 37.67 ± 2.06 µM, respectively in A549 lung adenocarcinoma cells and 14.45 ± 0.73 µM, 1.97 ± 0.1 µM, 0.98 ± 0.05 µM and 24.43 ± 1.22 µM, respectively in MDA-MB-231 breast adenocarcinoma cells.

Mononuclear Co(II) polypyridyl complexes: synthesis, molecular structure, DNA binding/cleavage, radical scavenging, docking studies and anticancer activities.

Mononuclear Co(II) complexes [CoII(L)Cl2]; 1, [CoII(L)(bpy)Cl]PF6; 2, [CoII(L)(phen)Cl]PF6; 3 and [CoII(L)(pic)Cl]; 4, (where L = N,N-bis(pyridin-2-ylmethyl)aniline, bpy = 2,2'-bipyridine, phen = 1,10-phenanthroline, pic = picolinic acid) were systematically synthesized and characterized by different analytical and spectroscopic methods. All the complexes were structurally identified by single-crystal X-ray diffraction analysis. Penta-coordinated complex 1 adopted a distorted trigonal bipyramidal geometry, whereas hexacoordinated complexes 2-4 have distorted octahedral geometry. The interactions of salmon sperm DNA (ss-DNA) with our synthesized complexes 1-4 were investigated by absorbance and fluorescence spectroscopy. All the complexes are very susceptible to DNA binding and exhibited binding affinities (Kb) in the order of ∼104 M-1, indicating their strong interaction with ss-DNA. The Stern-Volmer constant (Ksv) ranged from 0.46 ± 0.01 × 104 to 1.08 ± 0.04 × 104 M-1, suggesting weak or moderate binding with DNA. Agarose gel electrophoresis revealed the DNA cleavage activity in vitro for 2-4, which could efficiently cleave the supercoiled plasmid DNA without any external agents; however, with the addition of H2O2, the cleavage property was enhanced. Live-cell imaging and other biochemical assays demonstrated the ability of Co(II) complexes 1-4 to induce significant cytotoxicity in A549 lung cancer cells with IC50 values of 32.14 ± 1.3 µM, 3.14 ± 0.16 µM, 15.78 ± 0.72 µM and 18.45 ± 0.92 µM, and in MDA-MB-231 breast cancer cells with IC50 values of 20.42 ± 0.92 µM, 0.41 ± 0.02 µM, 2.31 ± 0.12 µM and 9.67 ± 0.35 µM, respectively.

Design, synthesis, structural, spectral, and redox properties and phenoxazinone synthase activity of tripodal pentacoordinate Mn(II) complexes with impressive turnover numbers.

Catechol oxidase (CO) and phenoxazinone synthase (PHS) are two enzymes of immense significance due to their capability to oxidize catechols and o-aminophenols to o-quinones and phenoxazinones, respectively. In this connection two mononuclear manganese complexes with the molecular framework [MnII(Ln)Cl]Cl {L1: tris((1H-benzo[d]imidazol-2-yl)methyl)amine; n = 1 and L2: tris(N-methylbenzimidazol-2-ylmethyl)amine; n = 2} have been designed to be potential catalysts for OAPH (o-aminophenol) oxidation. Both the ligands and their corresponding metal complexes have been successfully synthesized and thoroughly characterized by different spectroscopic and analytical techniques such as FT-IR, 1H NMR, UV-vis spectroscopy, EPR spectroscopy and ESI mass spectroscopy. The molecular structures of [MnII(L1)Cl]Cl (1) and [MnII(L2)Cl]Cl (2) have been revealed by a single-crystal X-ray diffraction study. The spectral properties and redox behaviour of both the complexes were examined. Under ambient conditions, 1 and 2 show excellent phenoxazinone synthase activity as both are very susceptible to oxidize o-aminophenol to phenoxazinone. The kinetic parameters for both complexes have been determined by analyzing the experimental spectroscopic data. The turnover numbers (kcat value) of these two complexes are extremely high, 440 h-1 and 234 h-1 for 1 and 2, respectively. The present report offers a thorough overview of information involving the role of the metal ions and their extent of phenoxazinone synthase mimicking activity. The oxidation of o-aminophenol to 2-amino-3H-phenoxazine-3-one (APX) by catalytic oxidation of oxygen (O2) by the reaction with transition metal complexes has been an important study for the last few decades. The current study evidently showed better performance of our synthesized Mn(II) complexes than all the predecessors. The plausible mechanism has been reiterated based on the experimental data via ESI-MS spectra and considering the concepts from the previously reported mechanisms involved in the formation of hydrogen peroxide (H2O2) as an intermediate substrate is fairly indicating the involvement of molecular oxygen in the catalytic cycle.

Near-IR light-induced photorelease of nitric oxide (NO) on ruthenium nitrosyl complexes: formation, reactivity, and biological effects.

Polypyridyl backbone nitrosyl complexes of ruthenium with the molecular framework [RuII(antpy)(bpy)NO+/˙]n+ [4](PF6)3 (n = 3), [4](PF6)2 (n = 2), where antpy = 4'-(anthracene-9-yl)-2,2':6',2''-terpyridine and bpy = 2,2'-bipyridine, were synthesized via a stepwise synthetic route from the chloro precursor [RuII(antpy)(bpy)(Cl)](PF6) [1](PF6) and [RuII(antpy)(bpy)(CH3CN)](PF6)2 [2](PF6)2 and [RuII(antpy)(bpy)(NO2)](PF6) [3](PF6). After column chromatographic purification, all the synthesized complexes were fully characterized using different spectroscopic and analytical techniques including mass spectroscopy, 1H NMR, FT-IR and UV-vis spectrophotometry. The Ru-NO stretching frequency of [4](PF6)3 was observed at 1941 cm-1, which suggests moderately strong Ru-NO bonding. A massive shift in the νNO frequency occurred at Δν = 329 cm-1 (solid) upon reducing [4](PF6)3 to [4](PF6)2. To understand the molecular integrity of the complexes, the structure of [3](PF6) was successfully determined by X-ray crystallography. The redox properties of [4](PF6)3 were thoroughly investigated together with the other precursor complexes. The rate constants for the first-order photo-release of NO from [4](PF6)3 and [4](PF6)2 were determined to be 8.01 × 10-3 min-1 (t1/2 ∼ 86 min) and 3.27 × 10-2 min-1 (t1/2 ∼ 21 min), respectively, when exposed to a 200 W Xenon light. Additionally, the photo-cleavage of Ru-NO occurred within ∼2 h when [4](PF6)3 was irradiated with an IR light source (>700 nm) at room temperature. The first-order rate constant of 9.4 × 10-3 min-1 (t1/2 ∼ 73 min) shows the efficacy of the system and its capability to release NO in the photo-therapeutic window. The released NO triggered by light was trapped by reduced myoglobin, a biologically relevant target protein. The one-electron reduction of [4](PF6)3 to [4](PF6)2 was systematically carried out chemically (hydrazine hydrate), electrochemically and biologically. In the biological reduction, it was found that the reduction is much slower with double-stranded DNA compared to a single-stranded oligonucleotide (CAAGGCCAACCGCGAGAAGATGAC). Moreover, [4](PF6)3 exhibited significant photo-toxicity to the VCaP prostate cancer cell line upon irradiation with a visible light source (IC50 ∼ 8.97 µM).