ASSOCIATIONS BETWEEN SCREENING FOR FUNCTIONAL JAW DISTURBANCES AND PATIENT REPORTED OUTCOMES ON JAW LIMITATIONS AND ORAL BEHAVIORS.

OBJECTIVES: Temporomandibular disorders (TMDs) is a collective term for pain and functional disturbances related to the jaw muscles and the temporomandibular joint. In contrast to screening for orofacial pain, knowledge is limited on the association between patient-reported outcomes and screening for joint-related functional jaw disturbances. Therefore, our aim was to evaluate the association between a screening question for functional jaw disturbances, and disease-specific outcome measures for functional jaw limitations and oral behaviors. METHODS: This study included 299 individuals (201 women; 20-69 years, median 37.0) in a general population sample from Västerbotten, Northern Sweden in 2014. A single screening question for functional jaw disturbances "Does your jaw lock or become stuck once a week or more?" was used to categorize individuals as cases or controls. Patient-reported outcomes on functional jaw disturbances were assessed with the 20-item jaw functional limitation scale (JFLS-20) and oral behaviors with the 21-item Oral Behaviors Checklist (OBC-21). RESULTS: The strongest predictive probability to have a positive screening outcome was functional jaw limitations related to mobility (AUCboot=0.78, 95 CI:0.71-0.86, P < .001), followed by limitations related to communication (AUCboot = 0.74, 95 CI:0.63-0.80, P < .001) and mastication (AUCboot = 0.73, 95 CI:0.66-0.81, P < .001). The frequency of oral behaviors was not significantly associated with a positive screening outcome (AUCboot = 0.65, 95 CI:0.55-0.72, P = .223). CONCLUSIONS: Self-reported functional limitations, but not oral behaviors, are strongly associated with a single screening question for frequent functional jaw disturbances. This finding provides support for incorporating a question on jaw catching/locking once a week or more in screening instruments for TMDs.

The Longitudinal Relationship between Jaw Catching/Locking and Pain.

Orofacial pain and joint-related dysfunction can negatively affect daily jaw function. A common cause for limitations in jaw movements is joint-related dysfunction such as various forms of catching and locking. However, knowledge is limited regarding the development and natural course of joint-related jaw dysfunction and its relationship to the onset and course of orofacial pain. Therefore, the aim was to evaluate the incidence, prevalence, and gender differences in jaw catching/locking over time and in relation to orofacial pain in the general population. Data from 3 validated screening questions on orofacial pain and jaw catching/locking were collected from all routine dental checkups in the Public Dental Health Services in Västerbotten, Sweden, from 2010 to 2017. Logistic generalized estimating equation was used to account for repeated observations and Poisson regression for incidence analysis. In total, 180,308 individuals (aged 5-104 y) were screened in 525,707 dental checkups. In 2010, based on 37,647 individuals, the prevalence of self-reported catching/locking was higher in women than in men (3.2% vs. 1.5%; odds ratio, 2.11; 95% confidence interval [CI], 1.83-2.43), and this relationship and magnitude remained similar throughout the study period. The annual incidence rate was 1.1% in women and 0.5% in men. Women were at a higher risk than men for reporting both first onset (incidence rate ratio [IRR], 2.29; 95% CI, 2.11-2.49) and persistent (IRR, 2.31; 95% CI, 2.04-2.63) catching/locking. For the onset subcohort (n = 135,801), an independent onset of orofacial pain or jaw catching/locking exclusively was reported by 84.1%, whereas a concurrent onset was reported by 13.4%. Our findings of higher incidence, prevalence, and persistence in women than in men indicate that the gender differences seen for orofacial pain are evident also for jaw catching/locking. The findings also suggest independent onset of self-reported catching/locking and orofacial pain, which reinforces the pathophysiological differences between these conditions.

How therapists in cognitive behavioral and psychodynamic therapy reflect upon the use of metaphors in therapy: a qualitative study.

BACKGROUND: Research suggests that metaphors are integral to psychotherapeutic practice. We wanted to explore how 10 therapists reflect upon the use of metaphors in therapy, and how they react to some metaphors expressed by patients treated for of major depressive disorder (MDD). METHODS: Five therapists practicing psychodynamic therapy (PDT) and five practicing cognitive behavioral therapy (CBT) were interviewed with a semi-structured qualitative interview. Transcripts were analyzed using a thematic analysis approach. RESULTS: Our analysis resulted in two main themes: the therapeutic use of metaphors, and conflicting feelings towards metaphors used by depressed patients. Most therapists said that they do not actively listen for metaphors in therapy and many said that they seldom use metaphors deliberately. While PDT-therapists appeared more attentive to patient-generated metaphors, CBT-therapists seemed more focused on therapist-generated metaphors. Most therapists did not try to alter the patient-generated metaphors they evaluated as unhelpful or harmful. Some therapists expressed strong negative feelings towards some of the metaphors used by patients. PDT-therapists were the most critical towards the metaphor of tools and the metaphor of depression as an opponent. CBT-therapists were the most critical towards the metaphor of surface-and-depth. CONCLUSIONS: These results remind us of the complexity of using metaphors in therapy, and can hopefully be an inspiration for therapists to reflect upon their own use of metaphors. Open therapeutic dialogue on the metaphor of tools, surface-depth and depression as an opponent may be necessary to avoid patient-therapist-conflicts. TRIAL REGISTRATION: Clinical Trial gov. Identifier: NCT03022071 . Date of registration: 16/01/2017.

The impact of gender of the examiner on orofacial pain perception and pain reporting among healthy volunteers.

OBJECTIVES: Pain on palpation of jaw muscles is a commonly used diagnostic criterion when examining patients with orofacial pain. It is not known, however, if pain reports are affected by the gender of the examiner. Our aim was to investigate if pressure pain threshold (PPT), pressure pain tolerance (PTol), and pain intensity assessed over the masseter muscles in healthy individuals are affected by the gender of the examiner. MATERIALS AND METHODS: Healthy, pain-free individuals were recruited on a voluntary basis. PPT and PTol were assessed using pressure algometry. At the PTol level, participants also rated pain intensity on a 0-10 numeric rating scale. Assessments of PPT and PTol were conducted with six repeated measurements performed twice, separately by one female and one male examiner, on each participant. RESULTS: In total, 84 participants (43 women; median age 24, IQR 6) were included. With a female examiner, women reported higher pain intensity than men (Mann Whitney U, p = 0.005). In the multivariable analysis, significantly higher PTol was predicted by male examiner. Also, a higher ratio between PTol and reported pain intensity was predicted by male examiner. CONCLUSIONS: The gender of the examiner influences pain reporting and perception in an experimental setting. This effect on pain perception related to gender of the examiner is probably related to normative gender behaviors rather than to biological alterations within the examined individual. CLINICAL RELEVANCE: In clinical and experimental settings, gender of the examiner may affect not only pain perception but also pain reporting, with potential implications for diagnostics in patients with pain.

Digging down or scratching the surface: how patients use metaphors to describe their experiences of psychotherapy.

BACKGROUND: In the present study, we wanted to explore which metaphors patients suffering from major depressive disorder (MDD) use to explain their experience of being in therapy and their improvement from depression. METHODS: Patients with MDD (N = 22) received either psychodynamic therapy (PDT) or cognitive behavioral therapy (CBT). They were interviewed with semi-structured qualitative interviews after ending therapy. The transcripts were analyzed using a method based on metaphor-led discourse analysis. RESULTS: Metaphors were organized into three different categories concerning the process of therapy, the therapeutic relationship and of improvement from depression. Most frequent were the metaphorical concepts of surface and depth, being open and closed, chemistry, tools, improvement as a journey from darkness to light and depression as a disease or opponent. CONCLUSIONS: Patient metaphors concerning the therapeutic experience may provide clinicians and researchers valuable information about the process of therapy. Metaphors offer an opportunity for patients to communicate nuances about their therapeutic experience that are difficult to express in literal language. However, if not sufficiently explored and understood, metaphors may be misinterpreted and become a barrier for therapeutic change. TRIAL REGISTRATION: Clinical Trial gov. Identifier: NCT03022071 . Date of registration: 16/01/2017.

Mechanisms of change and heterogeneous treatment effects in psychodynamic and cognitive behavioural therapy for patients with depressive disorder: a randomized controlled trial.

BACKGROUND: Major depressive disorder (MDD) is a prevalent psychiatric condition associated with significant disability, mortality and economic burden. Cognitive behavioral therapy (CBT) and psychodynamic psychotherapy (PDT) are found to be equally effective for patients with depression. However, many patients do not respond sufficiently to either treatment. To offer individualized treatment, we need to know if some patients benefit more from one of the two therapies. At present little is known about what patient characteristics (moderators) may be associated with differential outcomes of CBT and PDT, and through what therapeutic processes and mechanisms (mediators) improvements occur in each therapy mode. Presently only theoretical assumptions, sparsely supported by research findings, describe what potentially moderates and mediates the treatment effects of CBT and PDT. The overall aim of this study is to examine theoretically derived putative moderators and mediators in CBT and PDT and strengthen the evidence base about for whom and how these treatments works in a representative sample of patients with MDD. METHODS: One hundred patients with a diagnosis of MDD will be randomized to either CBT or PDT. Patients will be treated over 28 weeks with either CBT (one weekly session over 16 weeks and three monthly booster sessions) or PDT (one weekly session over 28 weeks). The patients will be evaluated at baseline, during the course of therapy, at the end of therapy, and at follow-up investigations 1 and 3 years post treatment. A large range of patient and observer rated questionnaires (specific preselected putative moderators and mediators) are included. DISCUSSION: The clinical outcome of this study may better guide clinicians when deciding what kind of treatment any individual patient should be offered. Moreover, the study aims to further our knowledge of what mechanisms lead to symptom improvement and increased psychosocial functioning. TRIAL REGISTRATION: ClinicalTrials.gov Identifier: NCT03022071.

Outcome of three screening questions for temporomandibular disorders (3Q/TMD) on clinical decision-making.

Patients with temporomandibular disorders (TMD) seem to go undetected and not adequately managed within dentistry. To identify these patients, three screening questions (3Q/TMD) have been introduced within dentistry in parts of Sweden. It is not known whether 3Q/TMD affects the clinical decision-making for these patients. The aim of this study was to evaluate the outcome of 3Q/TMD on the clinical decision-making and to analyse whether gender, age and the fee system the individual was assigned to were related to prescribed TMD treatment. This cohort study was carried out within the Public Dental Health service in Västerbotten, Sweden. As part of the routine dental check-up, a health declaration including 3Q/TMD was completed. The study population was randomly selected based on their 3Q/TMD answers. In total, 300 individuals with an affirmative answer to any of the 3Q/TMD, and 500 individuals with all negative answers were selected. The 3Q/TMD includes questions on weekly jaw-face-temple pain (Q1), pain on function (Q2) and catching/locking of the jaw (Q3). The 3Q/TMD was analysed in relation to prescribed treatment assessed from dental records. There was significantly more treatment performed or recommended for 3Q-positives (21·5%), compared to 3Q-negatives (2·2%) (P < 0·001). The odds ratio for TMD-related treatment for 3Q-positives versus 3Q-negatives was 12·1 (95% CI: 6·3-23·4). Although affirmative answers to the 3Q/TMD was related to TMD treatment, the majority of individuals with a screen positive still did not, according to dental records, receive assessment or treatment. Further studies are needed to better understand the clinical decision-making process for patients with TMD.

Validity of three screening questions (3Q/TMD) in relation to the DC/TMD.

Temporomandibular disorders (TMD) are common but seem to be largely undetected within general dental care. To improve dentists' awareness of these symptoms, three screening questions (3Q/TMD) have been introduced. Our aim was to validate 3Q/TMD in relation to the diagnostic criteria for TMD (DC/TMD), while taking into account the severity level of the symptoms. The study population consisted of 7831 individuals 20-69 years old, who had their routine dental check-up at the Public Dental Health Service in Västerbotten, Sweden. All patients answered a health declaration, including the 3Q/TMD regarding frequent temporomandibular pain, pain on movement and catching/locking of the jaw. All 3Q-positives (at least one affirmative) were invited for examination in randomised order. For each 3Q-positive, a matched 3Q-negative was invited. In total, 152 3Q-positives and 148 3Q-negatives participated. At examination, participants answered 3Q/TMD a second time, before they were examined and diagnosed according to DC/TMD. To determine symptom's severity, the Graded Chronic Pain Scale and Jaw Functional Limitation Scale-20 (JFLS-20) were used. In total, 74% of 3Q-positives and 16% of 3Q-negatives met the criteria for DC/TMD pain or dysfunction (disc displacements with reduction and degenerative joint disorder were excluded). Fifty-five per cent of 3Q-positives had a TMD diagnosis and CPI score ≥3 or a JFLS-20 score ≥5, compared to 4% of 3Q-negatives. The results show that the 3Q/TMD is an applicable, cost-effective and valid tool for screening a general adult population to recognise patients in need of further TMD examination and management.

Recombinant human prothrombin (MEDI8111) prevents bleeding in haemophilia A and B mice.

BACKGROUND: Haemophilia A and B are treated with FVIII and FIX replacement therapy. Treatment may be complicated by inhibitory antibodies that require bypass therapy such as FEIBA(®) in which prothrombin (FII) is suggested to be the main active component. METHODS: To evaluate the effect of FII on haemophilia recombinant human (rh) FII (MEDI8111) or plasma-derived human FII (pdhFII) was given as single doses to anaesthetized haemophilia A and B mice 3 min before tail transection and rhFVIII or rhFIX was used for comparison. After tail transection, automatic bleeding registration was used to continuously measure blood loss (BL) and bleeding time (BT). Thrombin generation and plasma concentrations of human FVIII, FIX, FII and thrombin-antithrombin complex (TAT) were measured. RESULTS: Blood loss and BT were dose-dependently decreased by rhFVIII or rhFIX. The concentrations that decreased BL and BT for rhFVIII by 50% (EC50) were 0.06 and 0.01 IU mL(-1) and for rhFIX 0.07 and 0.07 IU mL(-1) , respectively. Administration of rhFVIII and rhFIX dose-dependently increased thrombin generation potential but did not affect TAT. MEDI8111 and pdhFII dose-dependently decreased BL and BT in haemophilia A mice, EC50 37 and 87 and 100 and 155 mg L(-1) respectively. In haemophilia B mice given MEDI8111 EC50 was for BL 56 mg L(-1) and for BT 67 mg L(-1) . TAT and thrombin generation increased dose-dependently for MEDI8111 and pdhFII. CONCLUSION: MEDI8111 dose-dependently decreased bleeding and increased procoagulant activity in haemophilia A and B mice and suggest that MEDI8111 may be useful for preventing bleeding in patients with haemophilia A and B.

Temporomandibular pain and jaw dysfunction at different ages covering the lifespan--A population based study.

BACKGROUND: Temporomandibular pain and jaw dysfunction can have a negative effect on daily life, but these conditions are not well recognized in the health care systems. The general aim was to examine the cross-sectional prevalence of frequent temporomandibular pain and jaw dysfunction in men and women across the lifespan. METHODS: The analysis was based on data from 137,718 individuals (mean age 35 years, SD 22.7) who answered three questions (3Q/TMD) included in the digital health declaration in the Public Dental Health care in the county of Västerbotten, Sweden; Q1: 'Do you have pain in your temple, face, jaw or jaw joint once a week or more?'; Q2: 'Does it hurt once a week or more when you open your mouth or chew?'; and Q3: 'Does your jaw lock or become stuck once a week or more?' RESULTS: The prevalence of frequent temporomandibular pain (Q1) was 5.2% among women and 1.8% among men (p < 0.0001). The prevalence of frequent pain on jaw movement (Q2) was 2.5% among women and 0.9% among men (p < 0.0001). The prevalence of frequent locking of the jaw (Q3) was 2.7% among women and 1.2% among men (p < 0.0001). CONCLUSIONS: The study shows that the cross-sectional prevalence of temporomandibular pain and jaw dysfunction varies during the lifespan. For men and women, respectively, symptoms increase during adolescence, peak in middle age and then gradually diminish. The prevalence of these symptoms is significantly higher among women except from the first and last decades of a 100-year lifespan.

Effect of tonsillar herniation on cyclic CSF flow studied with computational flow analysis.

BACKGROUND AND PURPOSE: The Chiari I malformation, characterized by tonsils extending below the foramen magnum, has increased CSF velocities compared with those in healthy subjects. Measuring the effect of tonsillar herniation on CSF flow in humans is confounded by interindividual variation. The goal of this study was to determine the effect of herniated tonsils on flow velocity and pressure dynamics by using 3D computational models. MATERIALS AND METHODS: A previously described 3D mathematic model of the normal subarachnoid space was modified by extending the tonsils inferiorly. The chamber created was compared with the anatomy of the subarachnoid space. Pressures and velocities were calculated by CFA methods for sinusoidal flow of a Newtonian fluid. Results were displayed as 2D color-coded plots and 3D animations. Pressure gradients and flow velocities were compared with those in the normal model. Velocity distributions were also compared with those in clinical images of CSF flow. RESULTS: The model represented grossly the subarachnoid space of a patient with Chiari I malformation. Fluid flow patterns in the Chiari model were complex, with jets in some locations and stagnant flow in others. Flow jets, synchronous bidirectional flow, and pressure gradients were greater in the Chiari model than in the normal model. The distribution of flow velocities in the model corresponded well with those observed in clinical images of CSF flow in patients with Chiari I. CONCLUSIONS: Tonsillar herniation per se increases the pressure gradients and the complexity of flow patterns associated with oscillatory CSF flow.

Characterization of cyclic CSF flow in the foramen magnum and upper cervical spinal canal with MR flow imaging and computational fluid dynamics.

CSF flow has been shown to exhibit complex patterns in MR images in both healthy subjects and in patients with Chiari I. Abnormal CSF flow oscillations, according to prevailing opinion, cause syringomyelia and other clinical manifestations that affect some patients with the Chiari I malformation. For this article, we reviewed the literature on PC MR of CSF flow, collected the published CFD studies relevant to CSF flow, and performed flow simulations. PC MR creates cine and still images of CSF flow and measurements of flow velocities. CFD, a technique used to compute flow and pressure in liquid systems, simulates the CSF flow patterns that occur in a specific geometry or anatomy of the SAS and a specific volume of flow. Published PC MR studies show greater peak CSF velocities and more complex flow patterns in patients with Chiari I than in healthy subjects, with synchronous bidirectional flow one of the characteristic markers of pathologic flow. In mathematic models of the SAS created from high-resolution MR images, CFD displays complex CSF flow patterns similar to those shown in PC MR in patients. CFD shows that the pressure and flow patterns vary from level to level in the upper spinal canal and differ between patients with Chiari and healthy volunteers. In models in which elasticity and motion are incorporated, CFD displays CSF pressure waves in the SAS. PC MR and CFD studies to date demonstrate significant alterations of CSF flow and pressure patterns in patients with Chiari I. CSF flow has nonlaminar complex spatial and temporal variations and associated pressure waves and pressure gradients. Additional simulations of CSF flow supplemented by PC MR will lead to better measures for distinguishing pathologic flow abnormalities that cause syringomyelia, headaches, and other clinical manifestations in Chiari I malformations.

CSF flow dynamics at the craniovertebral junction studied with an idealized model of the subarachnoid space and computational flow analysis.

BACKGROUND AND PURPOSE: How CSF flow varies with the anatomy of the subarachnoid space has not been sufficiently well studied. The goal of this study was to develop an idealized 3D computational model of the subarachnoid space and then to use this model to study the detailed spatiotemporal effects of anatomic variations on CSF pressures and velocities. MATERIALS AND METHODS: We created a geometric model with a computer-assisted design program. The model contained a central structure for the brain and spinal cord axis and a second surrounding structure for the peripheral borders of the subarachnoid space. Model dimensions were adjusted to capture the main characteristics of the normal human posterior fossa and cervical spinal anatomy. CSF flow was modeled as water with a sinusoidal flow pattern in time. Velocities and pressures during craniocaudal and caudocranial flow were calculated with computational fluid dynamics (CFD) software. Simulated flow was compared with published phase-contrast MR imaging measurements of CSF flow in healthy human subjects. RESULTS: The model contained geometric characteristics of the posterior fossa and spinal canal. Flow velocities varied with the time in the cycle and location in space. Flow velocities had spatial variations that resembled those in healthy human subjects. Reynolds numbers were moderate, showing a laminar flow regime. Pressure varied uniformly along the long axis of the model during craniocaudal and caudocranial flow. CONCLUSIONS: In an idealized geometric approximation of the human subarachnoid space, CSF velocities and pressures can be studied in spatiotemporal detail with mathematic models.

Injuries in special transportation services for elderly and disabled--a multi-methodology approach to estimate incidence and societal costs.

OBJECTIVE: Previous research has shown that elderly and disabled travelers using Special Transportation Services (STS) are injured without being involved in a vehicle crash. In order to estimate the true costs for these vehicle-related injuries, the focus needs to be adjusted towards an incident/traveler-oriented perspective. The aim of the project was thus to utilize such a perspective, in order to make a best estimation of the true costs for injury incidents, related to STS in Sweden. METHODS: In order to address the chosen perspective, a mixed-method approach was used, involving quantitative as well as qualitative research methods applied on four different sets of data, the hospital-based material (n=32), two sets of STS material (n=127), and interview-based material (n=1,000). RESULTS: The results showed that the injury incidence rate in STS is considerable, i.e., 3.2 per 100,000 trips (ranging from 1.5-1.9 in STS taxis and 3.6-5.6 in STS special vehicles). However, this high incidence rate is not due to road traffic crashes, but to non-collision injury incidents involving elderly and frail passengers, easily sustaining injuries from minor to moderate external violence. Typically, this violence is affecting an older female STS user, while entering and exiting the vehicle. The true costs were estimated to be $35 million per annum or $2.6 per trip. CONCLUSION: Future injury prevention measures should thus focus on safety in entering and exiting procedures.

Diagnosis of Smith-Lemli-Opitz syndrome from stored filter paper blood specimens.

BACKGROUND: Smith-Lemli-Opitz (SLO) syndrome is a recessively inheritable metabolic disease with deficiency of cholesterol and accumulation of dehydrocholesterols, caused by a defect in the last step of cholesterol biosynthesis. Biochemical methods for identification of affected individuals, even prenatally, have been developed. Reliable genetic counselling is now possible. AIM: To find a method of proving or disproving whether a child in whom SLO syndrome had been suspected but not confirmed during lifetime had in fact died of the SLO syndrome. METHODS: Lipid extracts of stored filter paper blood specimens collected at the national neonatal metabolic screening were used. The ratio of dehydrocholesterols to cholesterol was measured by combined gas chromatography-mass spectrometry. RESULTS: The ratio of 8-dehydrocholesterol to cholesterol in stored filter paper specimens clearly distinguished affected infants from normal infants. SLO syndrome was thus proven in two children who had died more than seven years earlier. CONCLUSION: It is possible to diagnose SLO syndrome from dried paper specimens, even when the samples were collected more than a decade ago. Genetic counselling is available for families of affected children who died before the discovery of the defect in cholesterol synthesis.

Genome stability of Bacillus thuringiensis subsp. israelensis isolates.

Swedish soil isolates biochemically classified as Bacillus thuringiensis subsp. israelensis were further examined for genetic diversity by multilocus enzyme electrophoresis (MLEE), random amplified polymorphic DNA analysis (RAPD), pulse field gel electrophoresis (PFGE), and Southern blotting, and were compared with reference strains. All the tested strains belonging to the Bt. israelensis serotype H14 were found to be identical, as judged from the RAPD analysis. MLEE analysis gave a similar result; only one H14 strain was found to differ from the remaining H14 strains by one null allele. PFGE analysis confirmed a very close relationship between the H14 strains but revealed an SfiI restriction fragment of variable size. Southern blot analyses were carried out with probes for the chromosomally encoded flagellin gene(s) and the plasmid-encoded mosquitocidal toxins. All probes gave similar hybridization patterns in the H14 strains. The mosquito toxin probes hybridized only to the H14 strains, except for one probe hybridizing to strain 6:3, which was originally isolated from the same soil sample as strains 6:11 and 6:12. Because the RAPD, MLEE, and PFGE analyses showed that strain 6:3 appears to be unrelated to strains 6:11 and 6:12, the presence of a mosquito toxin sequence in strain 6:3 may suggest that gene transfer has occurred.

Localization of putative virulence genes on a physical map of the bacillus thuringiensis subsp. gelechiae chromosome

The insect pathogen Bacillus thuringiensis (Bt) has earlier been shown to possess virulence factors in addition to the crystal toxins. Bt subsp. gelechiae strain Bt13 lacks crystals but is still virulent to lepidopteran insects. Among the virulence co-expressed genes are two phospholipases; phosphatidylinositol-specific phospholipase C (PI-PLC) and phosphatidylcholine-degrading phospholipase C (PC-PLC), flagellin, and beta-lactamase I. In addition to these putative virulence factors the toxic neutral metalloprotease immune inhibitor A (InA) has been identified. In this paper we report a circular 5.9 Mb combined physical and genetic map of the of the Bt subsp. gelechiae chromosome. The genes encoding PI-PLC, PC-PLC, InA, flagellin, and beta-lactamase I are shown to be scattered over the chromosome. The PLC-encoding genes have been cloned from Bt13, and DNA sequencing showed that the Bt subsp. gelechiae PLC genes are >90% identical to their previously cloned equivalents from Bt or B. cereus. An HD-1 crystal toxin (cryIA) gene probe was found to hybridize to the Bt13 chromosome, but not to extrachromosomal elements.

Genetic diversity of Bacillus cereus/B. thuringiensis isolates from natural sources.

The genetic diversity and relationships among 154 Bacillus cereus/B. thuringiensis isolates recovered from soil samples from five geographic areas in Norway were investigated with multilocus enzyme electrophoresis (MEE). Cluster analysis revealed two major groups (designated cluster I and cluster II) separated at genetic distance greater than 0.55. Cluster I included 62 electrophoretic types (ETs) originating from all five locations, whereas, in cluster II, all but one isolate were from the same location. The isolates were also serotyped with B. thuringiensis flagellar antisera, and 28 distinct serotypes were identified. In general, serotyping did not show correlation to the genetic diversity of the isolates. The presence of IS231- and IS240-like transposable elements was detected in 14% of the strains of cluster II only. Parasporal crystals were observed in three strains; ten other strains were toxic to Trichoplusia ni. We conclude that B. cereus/B. thuringiensis from soil exhibit a high degree of recombination.

Adhesion and cytotoxicity of Bacillus thuringiensis to cultured Spodoptera and Drosophila cells.

Two Bacillus thuringiensis strains were tested for the ability to adhere to cultured Spodoptera and Drosophila insect cells. The wild-type strain is virulent and motile and readily adheres to and kills both types of insect cells. The avirulent mutant strain, which lacks flagella and several other of the proposed virulence factors, does not adhere to the insect cells and does not kill these cells efficiently. Purified flagella bind to insect cells; addition of anti-flagella serum abolishes cell binding and reduces the killing efficiency. Both bacteria and culture supernatant from the wild-type strain, but not from the mutant, are cytotoxic. Of the factors known to be reduced in the avirulent mutant, such as flagellin and phosphatidylcholine (PC) degrading or phosphatidylinositol-specific phospholipase C (PLC), only PC-PLC is shown to be cytotoxic.

Cloning and sequencing of a beta-lactamase-encoding gene from the insect pathogen Bacillus thuringiensis.

A beta-lactamase (Bla)-encoding gene (bla) from Bacillus thuringiensis (Bt) was cloned and the nucleotide (nt) sequence was determined. Both the nt sequence and deduced amino acid sequences reveal that the Bt Bla is very similar to that of B. cereus and other group A Bla. The transcription start point was also determined. Comparison of the upstream region of Bt bla with that of other genes suggested the presence of three sequence elements that might be involved in promoter function: the -10 (TCGGTGAT) and -35 (TTAT) sequences, an A+T-rich region (5'TACTAGCTATAATTTTTTAGT) and an inverted repeat sequence (5'-GAGATAGAGGC[GCTACTATCTC).