RESUMO
Recently, two fresh water species, " Candidatus Brocadia anammoxidans" and " Candidatus Kuenenia stuttgartiensis", and one marine species, " Candidatus Scalindua sorokinii", of planctomycete anammox bacteria have been identified. " Candidatus Scalindua sorokinii" was discovered in the Black Sea, and contributed substantially to the loss of fixed nitrogen. All three species contain a unique organelle--the anammoxosome--in their cytoplasm. The anammoxosome contains the hydrazine/hydroxylamine oxidoreductase enzyme, and is thus the site of anammox catabolism. The anammoxosome is surrounded by a very dense membrane composed almost exclusively of linearly concatenated cyclobutane-containing lipids. These so-called 'ladderanes' are connected to the glycerol moiety via both ester and ether bonds. In natural and man-made ecosystems, anammox bacteria can cooperate with aerobic ammonium-oxidising bacteria, which protect them from harmful oxygen, and provide the necessary nitrite. The cooperation of these two groups of ammonium-oxidising bacteria is the microbial basis for a sustainable one reactor system, CANON (completely autotrophic nitrogen-removal over nitrite) to remove ammonia from high strength wastewater.
Assuntos
Bactérias Anaeróbias/metabolismo , Água Doce/microbiologia , Compostos de Amônio Quaternário/metabolismo , Água do Mar/microbiologia , Anaerobiose , Reatores Biológicos , OxirreduçãoRESUMO
A bacterial artificial chromosome (BAC) library has been established from genomic DNA isolated from the trematode parasite of human, Schistosoma mansoni. This library consists of more than 21,000 recombinant clones carrying inserts in the pBeloBAC11 vector. The mean insert size was 100 kb, representing an approximate 7.95-fold genome coverage. Library screening with eight chromosome-specific or single-copy gene probes yielded between 1 and 9 positive clones, and none of those tested was absent from the library. End sequences were obtained for 93 randomly selected clones, and 37 showed sequence identity to S. mansoni sequences (ESTs, genes, or repetitive sequences). A preliminary analysis by fluorescence in situ hybridization localized 8 clones on schistosome chromosomes 1 (2 clones), 2, 3, 5, Z, and W (3 clones). This library provides a new resource for the physical mapping and sequencing of the genome of this important human pathogen.
Assuntos
Cromossomos Bacterianos/genética , DNA de Helmintos/genética , Biblioteca Gênica , Schistosoma mansoni/genética , Animais , Sequência de Bases , Mapeamento Cromossômico , Clonagem Molecular , Sondas de DNA , Desoxirribonucleases de Sítio Específico do Tipo II , Hibridização in Situ Fluorescente , Dados de Sequência Molecular , Sequências Repetitivas de Ácido Nucleico , Sequências Repetidas TerminaisRESUMO
Jacobsen syndrome is a haploinsufficiency disorder caused, most frequently by terminal deletion of part of the long arm of chromosome 11, with breakpoints in 11q23.3-11q24.2. Inheritance of an expanded p(CCG)n trinucleotide repeat at the folate-sensitive fragile site FRA11B has been implicated in the generation of the chromosome breakpoint in several Jacobsen syndrome patients. The majority of such breakpoints, however, map distal to this fragile site and are not linked with its expression. To characterize these distal breakpoints and ultimately to further investigate the mechanisms of chromosome breakage, a 40-Mb YAC contig covering the distal long arm of chromosome 11 was assembled. The utility of the YAC contig was demonstrated in three ways: (1) by rapidly mapping the breakpoints from two new Jacobsen syndrome patients using FISH; (2) by demonstrating conversion to high resolution PAC contigs after direct screening of PAC library filters with a YAC clone containing a Jacobsen syndrome breakpoint; and (3) by placing 23 Jacobsen syndrome breakpoints on the physical map. This analysis has suggested the existence of at least two new Jacobsen syndrome breakpoint cluster regions in distal chromosome 11.
Assuntos
Anormalidades Múltiplas/genética , Deleção Cromossômica , Cromossomos Humanos Par 11/genética , Mapeamento Físico do Cromossomo/métodos , Cromossomos Artificiais de Levedura , Mapeamento de Sequências Contíguas , Humanos , Síndrome , Translocação Genética/genéticaRESUMO
Miyoshi myopathy (MM) is an early adult-onset, autosomal recessive disorder characterized by weakness and muscular atrophy starting in the distal muscles. The disease locus has been previously mapped by linkage analysis to chromosome 2p using the microsatellite marker D2S291. Initial haplotype analysis of markers in families from three different origins (North American, Japanese, and Tunisian) suggested that the MM gene is located in a 4-cM region flanked by markers D2S292 on the telomeric side and D2S286 on the centromeric side. To delineate critical recombination events revealing a more refined localization of the MM gene, we have determined the pattern of segregation of 12 marker loci in two consanguineous families of Tunisian origin. In this study we have: (1) detected recombination events with the disease locus in one family, placing the MM gene most likely between markers D2S443 (CHLC.GGAA4D07.1876) and D2S2109; (2) generated a yeast artificial chromosome contig that spans approximately 3.8 megabases and extends from marker D2S358 to marker D2S286; (3) physically mapped 21 polymorphic markers, 5 genes, 3 STSs, and 1 EST within this contig; (4) detected and mapped a new polymorphism within this interval, allowing us to further reduce the MM locus to a 360-kilobase segment; (5) mapped the gene for the cytoskeletal protein beta-adducin within the MM candidate region, failing to find a consistent pattern of mutation of this gene in our MM patients; (6) excluded seven other candidate myopathy genes from the Miyoshi locus.
Assuntos
Mapeamento Cromossômico/métodos , Distrofias Musculares/genética , Proteínas de Ligação a Calmodulina/genética , Cromossomos Artificiais de Levedura/genética , Mapeamento de Sequências Contíguas , DNA/genética , Saúde da Família , Feminino , Ligação Genética , Predisposição Genética para Doença/genética , Genótipo , Haplótipos , Humanos , Masculino , Repetições de Microssatélites , Linhagem , Polimorfismo GenéticoRESUMO
Strategies to construct the physical map of the Trypanosoma cruzi nuclear genome have to capitalize on three main advantage of the parasite genome, namely (a) its small size, (b) the fact that all chromosomes can be defined, and many of them can be isolated by pulse field gel electrophoresis, and (c) the fact that simple Southern blots of electrophoretic karyotypes can be used to map sequence tagged sites and expressed sequence tags to chromosomal bands. A major drawback to cope with is the complexity of T. cruzi genetics, that hinders the construction of a comprehensive genetic map. As a first step towards physical mapping, we report the construction and partial characterization of a T. cruzi CL-Brener genomic library in yeast artificial chromosomes (YACs) that consists of 2.770 individual YACs with a mean insert size of 365 kb encompassing around 10 genomic equivalents. Two libraries in bacterial artificial chromosomes (BACs) have been constructed, BACI and BACII. Both libraries represent about three genome equivalents. A third BAC library (BAC III) is being constructed. YACs and BACs are invaluable tools for physical mapping. More generally, they have to be considered as a common resource for research in Chagas disease.
Assuntos
Animais , Mapeamento Cromossômico , Genoma de Protozoário , Trypanosoma cruzi/genética , Cromossomos Artificiais de Levedura , Células Clonais , Sitios de Sequências RotuladasRESUMO
Heterotaxy is the failure of the developing embryo to establish normal left-right asymmetry, which is often associated with multiple malformations. Previous studies have identified different mutations in the cytoplasmic tail of the connexin 43 (cx 43) gene in six patients from a series of six sporadic cases with defects of laterality and severe heart malformations. These cases showed that of the genes involved in lateralization defects with autosomal recessive transmission, cx 43 was the most important. This result was challenged by two different teams, which, on sequencing only the carboxyl terminal end of the cx 43 gene in 30 patients, found no mutations. To assess the responsibility of the cx 43 gene in human autosomal recessive lateralization defects, we tested its involvement in a selected group of 25 patients (19 familial cases) with a wide variety of lateralization defects and cardiovascular malformations. The whole coding sequence and direct flanking sequences were screened for mutations, both by single strand conformation analysis and direct fluorescent sequencing. We could only detect a single base pair insertion in the 3' untranslated region of one patient. To test the possibility of mutations in other parts of the cx 43 gene, the gene was located onto the physical map of chromosome 6, and flanking polymorphic markers were genotyped. Haplotype analysis excluded the cx 43 gene locus in nearly all of the familial cases of lateralization defects. Thus, our results do not support the suggestion that this gene is implicated in human autosomal recessive lateralization defects.
Assuntos
Anormalidades Múltiplas/genética , Conexina 43/genética , Genes Recessivos , Cardiopatias Congênitas/genética , Padronização Corporal/genética , Mapeamento Cromossômico , Feminino , Testes Genéticos , Genótipo , Humanos , Masculino , Mutação , LinhagemRESUMO
Granular dystrophy Groenouw type I (CDGG1), Reis-Bücklers (CDRB), lattice type I (CDL1) and Avellino (ACD) are four 5q31-linked human autosomal dominant corneal dystrophies. Clinically, they show progressive opacification of the cornea leading to severe visual handicap. The nature of the deposits remains unknown in spite of amyloid aetiology ascribed to the last two. We generated a YAC contig of the linked region and, following cDNA selection, recovered the beta ig-h3 gene. In six affected families we identified missense mutations. All detected mutations occurred at the CpG dinucleotide of two arginine codons: R555W in one CDGG1, R555Q in one CDRB, R124C in two CDL1 and R124H in two ACD families. This suggests, as the last two diseases are characterized by amyloid deposits, that R124 mutated kerato-epithelin (the product of beta ig-h3) forms amyloidogenic intermediates that precipitate in the cornea. Our data establish a common molecular origin for the 5q31-linked corneal dystrophies.
Assuntos
Cromossomos Humanos Par 5 , Distrofias Hereditárias da Córnea/genética , Proteínas da Matriz Extracelular , Proteínas de Neoplasias/genética , Mutação Puntual , Fator de Crescimento Transformador beta , Processamento Alternativo , Sequência de Bases , Células Cultivadas , Mapeamento Cromossômico , Cromossomos Artificiais de Levedura , Córnea/metabolismo , Primers do DNA , Fosfatos de Dinucleosídeos , Éxons , Genes Dominantes , Ligação Genética , Humanos , Íntrons , Dados de Sequência Molecular , Reação em Cadeia da Polimerase , Pele/metabolismoRESUMO
Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)n trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATATC/ATA)n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).
Assuntos
Fragilidade Cromossômica , Cromossomos Humanos Par 16 , DNA Satélite , Amplificação de Genes , Repetições Minissatélites , Composição de Bases , Sequência de Bases , Southern Blotting , Sítios Frágeis do Cromossomo , Clonagem Molecular , DNA Satélite/química , Humanos , Dados de Sequência Molecular , Reação em Cadeia da Polimerase , Polimorfismo GenéticoRESUMO
The distal part of 11q13, which contains several genes relevant to human diseases, has been poorly mapped as part of genome-wide mapping efforts. In the prospect of drawing a fine-scale integrated map of the area containing KRN1 and OMP, we have established a framework of markers by hybridization to DNA of somatic cell hybrids and by fluorescence in situ hybridization (FISH) on metaphase chromosomes. The probes studied were used to isolate 27 YACs and 16 cosmids that could be organized in three contigs covering approximately 6 Mb. These contigs were separated by two gaps that are likely to contain sequences underrepresented in YAC libraries. They were then integrated based on long-range restriction mapping and DNA-fiber FISH into a high-resolution physical map, which covers a 5.5-Mb region and includes 36 anonymous markers and 10 genes. This map will be used to search for genes within the 2/3 of this region where none have been localized as yet. It will also lay the ground for the characterization of an amplicon surrounding GARP in breast cancer and for the search of disease genes within this region.
Assuntos
Mapeamento Cromossômico , Cromossomos Humanos Par 11 , Animais , Cromossomos Artificiais de Levedura , Sondas de DNA , Humanos , Células Híbridas , Hibridização in Situ Fluorescente , Camundongos , Mapeamento por RestriçãoRESUMO
Thrombocytosis is a characteristic clinical feature in patients with myelocytic malignancies and chromosomal rearrangements of 3q21 and 3q26, sometimes called the '3q21q26 syndrome'. The function of thrombopoietin (TPO) in megakaryocytopoiesis and thrombopoiesis as well as its chromosomal location, marked TPO as a candidate gene for malignancies with 3q rearrangements combined with dysmegakaryopoiesis. In this study 12 cases with inv(3)(q21q26) or t(3;3)(q21;q26) were analyzed by means of PFGE, but no rearrangements near the TPO locus were detectable. Six YACs containing the TPO locus were isolated and characterized. By dual color in situ hybridization using a YAC from 3q26 containing the EVI1 gene and a YAC from the TPO locus, the localization of the human TPO gene could be refined to 3q27-q28 about 15-20 Mbp telomeric to the 3q26 breakpoints occurring in myeloid malignancies. TPO levels were analyzed in the serum of three patients and were found to be in the normal range. These results confirm the findings of two previous studies that thrombopoietin expression is not the main cause of thrombocytosis in the 3q21q26 syndrome.
Assuntos
Cromossomos Humanos Par 3 , Rearranjo Gênico , Trombocitose/genética , Trombopoetina/genética , Quebra Cromossômica , Mapeamento Cromossômico , Cromossomos Artificiais de Levedura , Eletroforese em Gel de Campo Pulsado , Regulação da Expressão Gênica , Humanos , Hibridização in Situ Fluorescente , Reação em Cadeia da Polimerase , Trombocitose/sangue , Trombopoetina/sangueRESUMO
Leber's congenital amaurosis (LCA, MIM 204,000), the earliest and most severe form of inherited retinopathy, accounts for at least 5% of all inherited retinal dystrophies. This autosomal recessive condition is usually recognized at birth or during the first months of life in an infant with total blindness or greatly impaired vision, normal fundus and extinguished electroretinogram (ERG). Nystagmus (pendular type) and characteristic eye poking are frequently observed in the first months of life (digito-ocular sign of Franceschetti). Hypermetropia and keratoconus frequently develop in the course of the disease. The observation by Waardenburg of normal children born to affected parents supports the genetic heterogeneity of LCA. Until now, however, little was known about the pathophysiology of the disease, but LCA is usually regarded as the consequence of either impaired development of photoreceptors or extremely early degeneration of cells that have developed normally. We have recently mapped a gene for LCA to chromosome 17p13.1 (LCA1) by homozygosity mapping in consanguineous families of North African origin and provided evidence of genetic heterogeneity in our sample, as LCA1 accounted for 8/15 LCA families in our series. Here, we report two missense mutations (F589S) and two frameshift mutations (nt 460 del C, nt 693 del C) of the retinal guanylate cyclase (RETGC, GDB symbol GUC2D) gene in four unrelated LCA1 probands of North African ancestry and ascribe LCA1 to an impaired production of cGMP in the retina, with permanent closure of cGMP-gated cation channels.
Assuntos
Cegueira/congênito , Guanilato Ciclase/genética , Mutação , Atrofias Ópticas Hereditárias/enzimologia , Retina/enzimologia , Cegueira/enzimologia , Cegueira/genética , Cromossomos Humanos Par 17 , GMP Cíclico/metabolismo , Mutação da Fase de Leitura , Homozigoto , Humanos , Dados de Sequência Molecular , Atrofias Ópticas Hereditárias/genética , Células Fotorreceptoras/metabolismo , Mapeamento por RestriçãoRESUMO
Neuroblastoma shows remarkable heterogeneity, ranging from spontaneous regression to progression toward highly malignant tumors. In search of genetic abnormalities that could explain this variability, we have characterized neuroblastoma tumors by using multiple fluorescent hybridizations. Our results indicate that chromosome 17 is rearranged very frequently in the form of unbalanced translocations with numerous chromosomal partners, all leading to the presence of supernumerary copies of a 25 Mb chromosomal region originating from 17q23.1-qter. Additional 17q material was detected in more than 90% of untreated high-grade neuroblastomas and, along with 1p36 deletion, should represent the most frequent genetic abnormality of neuroblastoma observed until now.
Assuntos
Cromossomos Humanos Par 17 , Neuroblastoma/genética , Southern Blotting , Neoplasias da Medula Óssea/genética , Aberrações Cromossômicas , Transtornos Cromossômicos , Cromossomos Artificiais de Levedura , Cromossomos Humanos Par 14 , Humanos , Hibridização in Situ Fluorescente , Linfoma/genética , PrognósticoAssuntos
Cromossomos Humanos Par 1 , Degeneração Macular/genética , Fosfoproteínas/genética , TATA Box , Fatores de Transcrição/genética , Sequência de Bases , Células Cultivadas , Mapeamento Cromossômico , DNA Complementar , Humanos , Hibridização in Situ Fluorescente , Dados de Sequência MolecularRESUMO
The Chediak-Higashi syndrome (CHS) is a severe autosomal recessive condition, features of which are partial oculocutaneous albinism, increased susceptibility to infections, deficient natural killer cell activity, and the presence of large intracytoplasmic granulations in various cell types. Similar genetic disorders have been described in other species, including the beige mouse. On the basis of the hypothesis that the murine chromosome 13 region containing the beige locus was homologous to human chromosome 1, we have mapped the CHS locus to a 5-cM interval in chromosome segment 1q42.1-q42.2. The highest LOD score was obtained with the marker D1S235 (Zmax = 5.38; theta = 0). Haplo-type analysis enabled us to establish D1S2680 and D1S163, respectively, as the telomeric and the centromeric flanking markers. Multipoint linkage analysis confirms the localization of the CHS locus in this interval. Three YAC clones were found to cover the entire region in a conting established by YAC end-sequence characterization and sequence-tagged site mapping. The YAC contig contains all genetic markers that are nonrecombinant for the disease in the nine CHS families studied. This mapping confirms the previous hypothesis that the same gene defect causes CHS in human and beige pheno-type in mice and provides a genetic framework for the identification of candidate genes.
Assuntos
Síndrome de Chediak-Higashi/genética , Mapeamento Cromossômico , Cromossomos Humanos Par 1/genética , Animais , Cromossomos Artificiais de Levedura/genética , Feminino , Marcadores Genéticos , Haplótipos , Humanos , Escore Lod , Masculino , Camundongos , Linhagem , Sitios de Sequências RotuladasRESUMO
Developmentally regulated genes in Drosophila, which are conserved through evolution, are potential candidates for key functions in biological processes such as cell cycle, programmed cell death, and cancer. We report cloning and characterization of the human homologue of the Drosophila seven in absentia gene (HUMSIAH), which codes for a 282 amino acids putative zinc finger protein. HUMSIAH is localized on human chromosome 16q12-q13. This gene is activated during the physiological program of cell death in the intestinal epithelium. Moreover, human cancer-derived cells selected for suppression of their tumorigenic phenotype exhibit constitutively elevated levels of HUMSIAH mRNA. A similar pattern of expression is also displayed by the p21waf1. These results suggest that mammalian seven in absentia gene, which is a target for activation by p53, may play a role in apoptosis and tumor suppression.
Assuntos
Apoptose/genética , Regulação da Expressão Gênica , Genes Supressores de Tumor , Proteínas Nucleares/genética , Proteínas/genética , Homologia de Sequência de Aminoácidos , Sequência de Aminoácidos , Animais , Cromossomos Humanos Par 16 , DNA Complementar/genética , Biblioteca Gênica , Humanos , Hibridização in Situ Fluorescente , Dados de Sequência Molecular , Ubiquitina-Proteína Ligases , Dedos de ZincoRESUMO
The limb-girdle muscular dystrophies (LGMD) are a genetically heterogeneous group of disorders, different forms of which have been mapped to at least six distinct genetic loci. We have mapped an autosomal recessive form of LGMD (LGMD2B) to chromosome 2p13. Two other conditions have been shown to map to this region or to the homologous region in mouse: a gene for a form of autosomal recessive distal muscular dystrophy, Miyoshi myopathy, shows linkage to the same markers on chromosome 2p as LGMD2B, and an autosomal recessive mouse mutation mnd2, in which there is rapidly progressive paralysis and muscle atrophy, has been mapped to mouse chromosome 6 to a region showing conserved synteny with human chromosome 2p12-p13. We have assembled a 6-cM YAC contig spanning the LGMD2B locus and have mapped seven genes and 13 anonymous polymorphic microsatellites to it. Using haplotype analysis in the linked families, we have narrowed our region of interest to a 0-cM interval between D2S2113 and D2S2112/D2S145, which does not overlap with the critical region for mnd2 in mouse. Use of these most closely linked markers will help to determine the relationship between LGMD2B and Miyoshi myopathy. YACs selected from our contig will be the starting point for the cloning of the LGMD2B gene and thereby establish the biological basis for this form of muscular dystrophy and its relationship with the other limb-girdle muscular dystrophies.
Assuntos
Cromossomos Humanos Par 2 , Distrofias Musculares/genética , Animais , Sequência de Bases , Mapeamento Cromossômico , Cromossomos Artificiais de Levedura , Primers do DNA , Feminino , Ligação Genética , Marcadores Genéticos , Haplótipos , Humanos , Hibridização in Situ Fluorescente , Masculino , Camundongos , Dados de Sequência Molecular , LinhagemRESUMO
The human Chromosome (Chr) 21q22.1 region contains several genes for cytokines and neurotransmitters and the gene for superoxide dismutase (mutant forms of which can cause familial amyotrophic lateral sclerosis). A region of approximately 5.8 Mb encompassing D21S82 and the glycinamide ribonucleotide transformylase (GART) loci was covered by overlapping YAC clones, which were contiguously ordered by clone walking with sequence-tagged site (STSs). A total of 76 markers, including 29 YAC end-specific STSs, were unambiguously ordered in this 5.8-Mb region, and the average interval between markers was 76 kb. Restriction maps of the YAC clones with rare-cutting enzymes were simultaneously prepared, and the restriction sites were aligned to obtain a consensus restriction map of the proximal region of the 21q22.1 band. The restriction map made from 44 overlapping YACs contains 54 physically assigned STSs. By integrating the consensus map of the adjacent 1.8-Mb region, we obtained a fine physical map spanning 6.5 Mb of human Chr 21q22.1. This map contains 24 precisely positioned end-specific STSs and 12 NotI-linking markers. More than 39 potential CpG islands were identified in this region and were found to be unevenly distributed. This physical map and the YACs should be useful as a reference map and as a resource for further structural analysis of the Giemsa-negative band (R-band) of Chr 21q22.1.
Assuntos
Mapeamento Cromossômico/métodos , Cromossomos Humanos Par 21/genética , Sequência de Bases , Bandeamento Cromossômico , Cromossomos Artificiais de Levedura , Cromossomos Humanos Par 21/ultraestrutura , Ilhas de CpG , Primers do DNA/genética , Marcadores Genéticos , Humanos , Dados de Sequência Molecular , Sitios de Sequências RotuladasRESUMO
We have generated a physical map of human chromosome bands 20q11.2-20q13.1, a region containing a gene involved in the development of one form of early-onset, non-insulin-dependent diabetes mellitus, MODY1, as well as a putative myeloid tumor suppressor gene. The yeast artificial chromosome contig consists of 71 clones onto which 71 markers, including 20 genes, 5 expressed sequence tags, 32 simple tandem repeat DNA polymorphisms, and 14 sequence-tagged sites have been ordered. This region spans about 18 Mb, which represents about 40% of the physical length of 20q. Using this physical map, we have refined the location of MODY1 to a 13-centimorgan interval (approximately equal to 7 Mb) between D20S169 and D20S176. The myeloid tumor suppressor gene was localized to an 18-centimorgan interval (approximately equal to 13 Mb) between RPN2 and D20S17. This physical map will facilitate the isolation of MODY1 and the myeloid tumor suppressor gene.
Assuntos
Cromossomos Artificiais de Levedura , Cromossomos Humanos Par 20 , Diabetes Mellitus Tipo 2/genética , Genes Supressores de Tumor , Leucemia Mieloide/genética , Sequência de Bases , Mapeamento Cromossômico , DNA/isolamento & purificação , Primers do DNA , Suscetibilidade a Doenças , Eletroforese em Gel de Ágar , Feminino , Marcadores Genéticos , Haplótipos , Humanos , Hibridização in Situ Fluorescente , Masculino , Dados de Sequência Molecular , Linhagem , Polimorfismo Genético , Sequências Repetitivas de Ácido Nucleico , Sitios de Sequências RotuladasRESUMO
Juvenile nephronophthisis (NPH) is a genetically heterogeneous disorder representing the most frequent inherited cause of chronic renal failure in children. We recently assigned a gene (NPH1) to the 2q13 region which is responsible for approximately 85% of cases. Cloning this region in a yeast artificial chromosome contig revealed the presence of low copy repeats. Large-scale rearrangements were detected in 80% of the patients belonging to inbred or multiplex NPH1 families and in 65% of the sporadic cases. Surprisingly, these rearrangements seem to be, in most cases, large homozygous deletions of approximately 250 kb involving an 100 kb inverted duplication. This suggests a common genetic disease-causing mechanism, which could be responsible for the highest frequency of large rearrangements reported in an autosomal recessive trait. Our findings are also of major clinical interest, as they permit the diagnosis in the majority of sporadic cases without the need for kidney biopsy.
Assuntos
Cromossomos Humanos Par 2 , Homozigoto , Doenças Renais Císticas/genética , Nefropatias/genética , Deleção de Sequência , Sequência de Bases , Southern Blotting , Criança , Consanguinidade , Eletroforese em Gel de Campo Pulsado , Feminino , Humanos , Medula Renal , Masculino , Dados de Sequência Molecular , Reação em Cadeia da Polimerase , Mapeamento por Restrição , TelômeroRESUMO
Detailed physical maps of the human genome are important resources for the identification and isolation of disease genes and for studying the structure and function of the genome. To improve the definition of the 8p12-p21 chromosomal region, an integrated physical and genetic map was constructed extending from the genes. NEFL to FGFR1. The map comprises a series of contigs (the larger of these being around 9 Mb) of yeast artificial chromosomes (YACs) spanning the proximal region of deletion involved in a broad range of human cancers, including breast carcinomas, and in the Werner syndrome. In addition, losses of heterozygosity at 8p markers and linkage analysis of breast cancer families were also detailed. Finally, several genes potentially involved in 8p-associated diseases, namely GTF2E2, PPP2CB, and HGL, were precisely mapped within the YAC contigs. The reported map and contigs of YACs should facilitate the search for putative genes involved in sporadic and familial breast cancer as well as in the Werner syndrome.