Multidisciplinary staff perceived barriers and enablers to early mobilization of patients with burns in the ICU.

BACKGROUND: Complex challenges face clinicians managing critically ill patients with burns, particularly in the context of enhancing outcomes after a stay in ICU. Compounding this, a dearth of research explores the specific and modifiable factors that impact early mobilization in the ICU environment. AIM: To explore the barriers and enablers of early functional mobilization for patients with burns in the ICU from a multidisciplinary perspective. DESIGN: A qualitative phenomenological study. METHODS: Semi-structured interviews supplemented by online questionnaires conducted with 12 multidisciplinary clinicians (four doctors, three nurses and five physical therapists) who previously managed burn patients at a quaternary level ICU. Data were thematically analysed. RESULTS: Four main themes: patient, ICU clinicians, the workplace and the physical therapist were identified as impacting on early mobilization. Subthemes identified barriers or enablers to mobilization but all were strongly influenced by overarching theme of the clinician's "emotional filter." Barriers included high levels of pain, heavy sedation and low levels of clinician exposure to treating patients with burns. Enablers included higher levels of clinician's experience and knowledge about burn management and benefits of early mobilization; increased coordinated staff resources when undertaking mobilization; and, open communication and positive culture towards early mobilization across the multidisciplinary team. CONCLUSION: Patient, clinician and workplace barriers and enablers were identified to influencing the likelihood of achieving early mobilization of patients with burns in the ICU. Emotional support for staff through multidisciplinary collaboration and development of structured burns training program were key recommendations to address barriers and strengthen enablers to early mobilization of patients with burns in the ICU.

Reconstruction of an idiopathic hemipalatal hypoplasia: report of a case.

Idiopathic hemipalatal hypoplasia is rare and leads to speech problems and the regurgitation of fluids, and the reconstruction of asymmetrical velopharyngeal incompetence is a challenge to the cleft surgeon. We present a case in a 5-year-old boy, and introduce the one-stage surgical technique that we used to resolve it.

Comparison of Anyplex II RV16 assay with conventional methods for detection of respiratory viruses.

Early detection of viral etiologies of acute respiratory tract infections of patients affects management and disease control in pediatric patients. In this study, the performance of Anyplex II RV16 assay (Seegene, Seoul, Korea) was evaluated by comparing with viral culture and direct immunofluorescence staining of clinical specimens for detection of respiratory viruses in patients. A total of 168 respiratory specimens were collected from 122 patients from November 2012 to May 2013 at the time of admission to the University of Malaya Medical Centre (UMMC), Kuala Lumpur, Malaysia. The Anyplex II RV16 assay, viral culture, and direct immunofluorescence staining were positive in 74.4%, 18.5% and 14.9% of the specimens, respectively. HRV was the predominant virus detected by the Anyplex II RV16 assay. In 47 cases, two or more respiratory viruses were detected by the Anyplex II RV16 assay, which were missed by conventional methods. The performance of the Anyplex II RV16 assay was better than viral culture and direct immunofluorescence staining of clinical specimens for the detection of respiratory viruses. The implementation of the Anyplex II RV16 assay in hospital laboratories will provide rapid diagnosis of major viral infections of the respiratory tract.

Comparison of Anyplex II RV16 assay with conventional methods for detection of respiratory viruses

Early detection of viral etiologies of acute respiratory tract infections of patients affects management and disease control in pediatric patients. In this study, the performance of Anyplex II RV16 assay (Seegene, Seoul, Korea) was evaluated by comparing with viral culture and direct immunofluorescence staining of clinical specimens for detection of respiratory viruses in patients. A total of 168 respiratory specimens were collected from 122 patients from November 2012 to May 2013 at the time of admission to the University of Malaya Medical Centre (UMMC), Kuala Lumpur, Malaysia. The Anyplex II RV16 assay, viral culture, and direct immunofluorescence staining were positive in 74.4%, 18.5% and 14.9% of the specimens, respectively. HRV was the predominant virus detected by the Anyplex II RV16 assay. In 47 cases, two or more respiratory viruses were detected by the Anyplex II RV16 assay, which were missed by conventional methods. The performance of the Anyplex II RV16 assay was better than viral culture and direct immunofluorescence staining of clinical specimens for the detection of respiratory viruses. The implementation of the Anyplex II RV16 assay in hospital laboratories will provide rapid diagnosis of major viral infections of the respiratory tract.

First Report of a Novel Begomovirus Associated with Yellow Vein Disease of Browne's Blechum (Blechum pyramidatum).

Browne's Blechum (Blechum pyramidatum) is a common weed found in fields and waste grounds in the Philippines. A disease was observed causing begomovirus-like yellow/chlorotic leaf veins and shortened internodes of Browne's Blechum plants on the island of Luzon, Philippines; disease incidence ranged from 10 to 50% in fields in 2012. Samples were collected from two plants with symptoms from each of Laguna and Quezon provinces and one plant without symptoms from Laguna Province. All four samples from plants with symptoms tested positive for begomovirus by PCR using primer pair PAL1v1978B/PAR1c715H (2), but the symptomless plant sample did not. However, no virus DNA-B component was detected in any of the samples using either general detection primer pair DNABLC1/DNABLV2 or DNABLC2/DNABLV2 (1). Using abutting primers AFPH12W1-R2F (TCTGGATCCATTGTTGAACGAGT) and AFPH12W1-R2R (CCGGGATCCCACATTGTTAAACA), a complete DNA-A component sequence was obtained for a Laguna isolate (GenBank Accession No. KF446659) and for a Quezon isolate (KF446660). The Laguna and Quezon isolate sequences were 2,764 and 2,756 nucleotides, respectively, and shared 90.6% nucleotide sequence identity. Both had six open reading frames (ORFs)-two in the virus sense (V1 and V2) and four in the complementary sense (C1 to C4)-and the geminivirus conserved sequence (TAATATTAC). Based on BLASTn searching of GenBank and sequence analysis using MEGALIGN (DNASTAR), both isolates should be considered as a new begomovirus (tentatively named Blechum yellow vein virus, BlYVV) since their DNA-A sequences share less than 89% nucleotide identity with any other begomovirus. Both DNA sequences had the highest nucleotide identity (84.8 to 87.6%) with Papaya leaf curl Guangdong virus isolates (AJ558122, AY650283, FJ495184, FJ869907, and JN703795). To our knowledge, this is the first report of a previously unidentified begomovirus associated with yellow vein disease of this species. References: (1) S. K. Green et al. Plant Dis. 85:1286, 2001. (2) W. S. Tsai et al. Plant Pathol. 60:787, 2011.

First Report of Bhendi yellow vein mosaic virus Associated with Yellow Vein Mosaic of Okra (Abelmoschus esculentus) in Thailand.

A disease of okra (Abelmoschus esculentus) causing yellowing veins and mosaic on leaves and fruit has emerged in Thailand. Incidences of 50 to 100% diseased plants were observed in fields in Kanchanaburi and Nakhon Pathom provinces in 2009 and 2010, respectively. Leaf samples were collected from three and four diseased plants in Kanchanaburi and Nakhon Pathom, respectively. All seven samples tested positive for begomovirus by PCR using universal primer pair PAL1v1978B/PAR1c715H (3). One sample from Kanchanaburi also tested positive by ELISA using Okra mosaic virus (Genus Tymovirus) antiserum (DSMZ, Braunschweig, Germany). When the nucleotide sequences of the 1.5 kb begomovirus PCR products were compared they were found to share 99.1 to 99.5% identity with each other, and 97.5 to 97.7% identity to Bhendi yellow vein mosaic virus Okra isolate from India (GenBank Accession No. GU112057; BYVMV-[IN: Kai:OY: 06]). The complete DNA-A sequence for a Kanchanaburi isolate (JX678967) was obtained using abutting primers WTHOK6FL-V/-C (WTHOK6FL-V: 5'-GCGAAGCTTAGATAACGCTCCTT-3'; WTHOK6FL-C: 5'-TCCAAGCTTTGAGTCTGCAACGT-3'), while that of a Nakhon Pathom isolate (JX678966) was obtained with primers WTHOK6FLV/WTHOK2FL-C (WTHOK2FL-C: 5'-TCCAAGCTTTGAGTCTGCATCGT-3'). The DNA-A sequences of both isolates are 2,740 nucleotides in length and share 99.6% identity. Each has the geminivirus conserved sequence (TAATATTAC), two open reading frames (ORFs) in the virus sense (V1 and V2) and four in the complementary sense (C1 to C4). Based on BLASTn searching GenBank and sequence analysis using MegAlign (DNASTAR), both DNA-A sequences have greatest nucleotide identity (96.2 to 96.4%) with BYVMV-[IN: Kai:OY: 06] from India. Also, BYVMV-associated betasatellite DNA (1.4 kb) was detected in all begomovirus-positive samples, except one sample from Nakhon Pathom (1). However, no virus DNA-B was detected in any of the samples using either general detection primer pair DNABLC1/DNABLV2 or DNABLC2/DNABLV2 (2). Okra infected with BYVMV has been reported in South Asia in Bangladesh, India, and Pakistan. To the best of our knowledge, this is the first report of BYVMV associated with Okra Yellow Vein Mosaic Disease in Southeast Asia. Since fruits with symptoms are regarded as low quality and have little market value, even low incidence of the disease is likely to cause significant reductions in marketable yield. Strategies for managing BYVMV in okra in South and Southeast Asia should be sought, including the breeding and selecting of resistant varieties. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) W. S. Tsai et al. Plant Pathol. 60:787, 2011.

Urinary bladder relaxation through activation of opioid µ-receptors induced by loperamide is increased in diabetic rats.

The role of opioid µ-receptor activation in the improvement of overactive bladder (OAB) remains obscure. Thus, we used loperamide to activate opioid µ-receptors for urinary bladder relaxation and compared the differences between normal and diabetic rats. Urinary bladder strips were isolated from Wistar rats that did or did not receive streptozotocin (STZ) injection for analysis of isometric tension. Samples were contracted with either acetylcholine (ACh) or KCl, and decrease of muscle tone (relaxation) was characterized after treatment with loperamide. Specific antagonists were used for pretreatment to compare the changes in loperamide-induced relaxation. As compared with normal rats, loperamide produced a more marked relaxation in bladder strips of STZ-diabetic rats in a dose-dependent manner. This relaxation by loperamide was attenuated by glibenclamide at a dose sufficient to block ATP-sensitive K(+) (K(ATP)) channels. In addition, this action of loperamide was abolished by protein kinase A (PKA) inhibitor and enhanced by the inhibitor of phosphodiesterase for cyclic AMP (cAMP). However, treatment with forskolin, an activator of adenylate cyclase, resulted in no difference in relaxation in normal and diabetic rats. The action of loperamide was abolished by cyprodime and naloxone, but was not modified by naloxonazine at a dose sufficient to block opioid µ-1 receptors. A higher expression of opioid µ-receptors in diabetic rats was observed. Our results suggest that the increase in urinary bladder relaxation in STZ-diabetic rats by loperamide is mainly induced through activation of opioid µ-receptors linked to the cAMP-PKA pathway to open K(ATP) channels.

First Report of Squash leaf curl Philippines virus Infecting Chayote (Sechium edule) in Taiwan.

Young shoots and leaves of chayote (Sechium edule (Jacq.) Sw.) are commonly consumed as a vegetable in Taiwan. In Hualien County, the major chayote-production area of Taiwan, as much as 15% of chayote plants were not marketable between September and October 2010 because of mosaic symptoms on the leaves. Three symptomatic leaves were collected from each of three fields in Hualien. All nine samples tested positive for a begomovirus by PCR using general primer pair PAL1v1978B/PAR1c715H (3) and negative for Zucchini yellow mosaic virus, Cucumber mosaic virus, Cucumber green mottle mosaic virus, Melon yellow spot virus, Papaya ringspot virus - type W, Watermelon mosaic virus, and Watermelon silver mottle virus by ELISA (2). On the basis of the high nucleotide sequence identity (97.7 to 99.6%) of the 1.5-kb begomoviral DNA-A fragments, all nine samples were considered infected by the same begomovirus species. The 1.5-kb sequences had greatest nucleotide sequence identity (96.6 to 97.8%) with Squash leaf curl Philippines virus (SLCPHV) pumpkin isolate from Taiwan (1) (GenBank Accession No. DQ866135; SLCPHV-TW[TW:Pum:05]). One sample was selected to complete viral genomic DNA analysis. Abutting primer pairs PKA-V/C (PKA-V: 5'-AACGGATCCACTTATGCACGATTTCCCT-3'; PKA-C: 5'-TAAGGATCCCACATGTTGTGGAGCA-3') and PKB-V/C (PKB-V: 5'-TGTCCATGGATTGATGCGTTATCGGA-3'; PKB-C: 5'-TGACCATGGCATTTCCGAGATCTCCCA-3'') were used to amplify the complete DNA-A and DNA-B, respectively. The sequences of DNA-A (GenBank Accession No. JF146795) and DNA-B (GenBank Accession No. JF146796) contain 2,734 and 2,715 nucleotides, respectively. The geminivirus conserved sequence TAATATTAC was found in both DNA-A and -B. The DNA-A has two open reading frames (ORFs) in the virus sense (V1 and V2) and four in the complementary sense (C1 to C4). The DNA-B also had one ORF each in the virus sense (BV1) and the complementary sense (BC1). When compared by BLASTn in GenBank and analyzed by MEGALIGN software (DNASTAR, Madison, WI), they were found to have greatest nucleotide identity (98.0 to 99.0% of DNA-A and 96.7% of DNA-B) with SLCPHV isolates from Taiwan. In addition, SLCPHV caused similar symptoms on leaves when transmitted to healthy chayote by viruliferous whitefly. In Taiwan, SLCPHV has been detected and sequenced from naturally infected melon (GenBank Accession No. EU479710), pumpkin (GenBank Accession No. DQ866135), and wax gourd (GenBank Accession No. EU310406). To our knowledge, this is the first report of SLCPHV infecting chayote plants in Taiwan. The prevalence of SLCPHV infection on different cucurbit crops should be taken into consideration for managing viral diseases in Taiwan. References: (1) W. S. Tsai et al. Plant Dis. 91:907, 2007. (2) W. S. Tsai et al. Plant Dis. 94:923, 2010. (3) W. S. Tsai et al. Online publication. doi: 10.1111/j.1365-3059.2011.02424.x. Plant Pathol., 2011.

First Report of Tomato yellow leaf curl Thailand virus Associated with Pepper Leaf Curl Disease in Taiwan.

Whitefly-transmitted begomoviruses (family Geminiviridae, genus Begomovirus) cause severe epidemic and high yield losses on pepper (Capsicum annuum) crops in many areas of the world. In Taiwan, pepper plants showing leaf curling, blistering, distortion, mild vein yellowing, and stunting were observed in fields in Tainan County in 2007, but with disease incidence less than 10%. However, disease incidence of more than 70% was observed in some fields in Pingtung, Kaohsiung, Chiayi, and Yunlin counties in 2009. Two symptomatic samples in 2007 and three for each county in 2009 were collected for begomovirus detection. Viral DNA was extracted and tested for the presence of begomoviral DNA-A, DNA-B, and associated satellite DNA by PCR using primer pairs PAL1v1978/PAR1c715 (4), DNABLC1/DNABLV2 (2), and Beta01/Beta02 (1), respectively. The expected 1.5-kb PCR product for DNA-A and 2.6-kb for DNA-B were obtained from all samples. However, DNA-beta was not detectable in any of the samples. One positive sample from each, Pingtung (LG6-2), Kaoshiung (LJ3-5), Tainan (P2-4), Chiayi (SG4-3), and Yunlin (HW2-2), were selected for further molecular characterization of DNA-A and DNA-B. On the basis of the sequences of the 1.5-kb DNA-A and 2.6-kb DNA-B PCR product, specific PCR primers were designed to obtain the complete DNA-A and DNA-B sequences for pepper-infecting begomovirus isolate LG6-2 (GenBank Accession Nos. GU208515 and GU208519), LJ3-5 (GenBank Nos. GU208516 and GU208520), P2-4 (GenBank Nos. EU249457 and EU249458), SG4-3 (GenBank Nos. GU208517 and GU208521), and HW2-2 (GenBank Nos. GU208518 and GU208522). The five isolates each contained the begomoviral conserved nonanucleotide sequence-TAATATTAC in DNA-As and DNA-Bs, six open reading frames (ORFs AV1, AV2, AC1, AC2, AC3, and AC4) in DNA-As, and two open reading frames (ORFs BV1 and BC1) in DNA-Bs. Sequence comparison by MegAlign software (DNASTAR, Inc. Madison, WI) showed that the five pepper-infecting begomovirus isolates had 99% nucleotide sequence identity in DNA-As and DNA-Bs and so they are considered isolates of the same species. BLASTn analysis with begomovirus sequences available in the GenBank database at the National Center for Biotechnology Information (Bethesda, MD) indicated that the DNA-As and DNA-Bs of the five isolates had the highest nucleotide sequence identity of 99% each with the respective DNA-A and DNA-B of Tomato yellow leaf curl Thailand virus (TYLCTHV; GenBank Nos. EF577266 and EF577267), a recently emerging bipartite begomovirus infecting tomato in Taiwan (3). On the basis of the DNA-A sequence comparison and the International Committee on Taxonomy of Viruses demarcation of species at 89% sequence identity, these virus isolates belong to the species TYLCTHV. The isolate P2-4 was found transmissible to C. annuum 'Early Calwonder' by whitefly (Bemisia tabaci biotype B) and induced the same leaf curling, blistering, and mild vein yellowing symptoms as those observed in pepper fields. To our knowledge, this is the first report of a begomovirus infecting pepper in Taiwan. The presence of TYLCTHV in the major pepper-production areas should be taken into consideration for pepper disease management and in developing begomovirus resistant pepper cultivars for Taiwan. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) F.-J. Jan et al. Plant Dis. 91:1363, 2007 (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Complete nucleotide sequences of okra isolates of Cotton leaf curl Gezira virus and their associated DNA-beta from Niger.

Okra (Abelmoschus esculentus) is a major crop in Niger. In the fall of 2007, okra leaf curl disease was observed in Niger and the begomovirus and DNA-beta satellite were found associated with the disease. The complete nucleotide sequences of DNA-A (FJ469626 and FJ469627) and associated DNA-beta satellites (FJ469628 and FJ469629) were determined from two samples. This is the first report of molecular characterization of okra-infecting begomovirus and their associated DNA-beta from Niger. The begomovirus and DNA-beta have been identified as Cotton leaf curl Gezira virus and Cotton leaf curl Gezira betasatellite, respectively, which are reported to also infect okra in Egypt, Mali and Sudan.

Identification of a New Begomovirus Associated with Yellow Leaf Curl Diseases of Tomato and Pepper in Sulawesi, Indonesia.

Whitefly-transmitted geminiviruses (family Geminiviridae, genus Begomovirus) cause severe disease epidemics of tomato and pepper in Indonesia. Four tomato-infecting begomoviruses have been reported from Java Island; Ageratum yellow vein virus (AYVV), Tomato leaf curl Java virus (ToLCJV), Tomato yellow leaf curl Indonesia virus (TYLCIDV), and Pepper yellow leaf curl Indonesia virus (PepYLCIDV) (4). The latter was also found to infect peppers. In 2006, symptoms typical of those caused by begomoviruses, leaf curling, blistering, yellowing, and stunting, were observed in tomato and pepper fields in North Sulawesi with incidence as high as 100%. Three symptomatic tomato leaf samples from each of two fields in the Langowan area and one from each of two fields in the Tompaso area, as well as one pepper sample from each of two fields in the Langowan area and two from a field in the Tompaso area were collected. Using the primer pair PAL1v1978/PAR1c715 (3), a begomovirus DNA-A was detected by PCR in all the tomato samples, in the two pepper samples from Langowan, and in one of the Tompaso pepper samples. A begomovirus DNA-B component or virus-associated satellite DNA were not found in any of the samples by PCR using the DNA-B general primer pairs DNABLC1/DNABLV2 and DNABLC2/DNABLV2 (2) and the satellite detection primer pair Beta01/Beta02 (1). The PCR-amplified 1.5-kb fragment from one positive sample each from the four tomato and three pepper fields were sequenced and found to have high nucleotide (nt) sequence identity (>95.0%). An abutting primer pair (IndV: 5'CCCGGATCCTCTAATTCATCCCT3'; IndC: 5'GACGGATCCCACATGTTTGCCA3') was designed to amplify the full-length genomes of the four tomato (GenBank Accession Nos. FJ237614, FJ237615, FJ237616, and FJ237617) and three pepper (GenBank Accession Nos. FJ237618, FJ237619, and FJ237620) begomoviruses. The sequences of all seven begomovirus isolates were 2,750 or 2,751 bp long and contained the conserved nonanucleotide sequence-(TAATATTAC), two open reading frames (ORFs) in the virion-sense and four ORFs in the complementary sense. Sequence comparisons using MegAlign software (DNASTAR, Madison, WI) showed the four tomato and three pepper isolates to have high nt identity (>95.1%). BLASTn analysis and comparison of the sequences with others available in the GenBank database ( www.ncbi.nlm.nih.gov ) show that the isolates of this study have the highest nt sequence identity (66.5%) with PepYLCIDV (Accession No. DQ083765) and less than 66.5% nt identity with other begomoviruses including those reported from Indonesia. On the basis of the currently accepted begomovirus species demarcation threshold of 89% nt identity, the tomato and pepper begomovirus isolates from North Sulawesi constitute a distinct species in the genus Begomovirus for which the name Tomato leaf curl Sulawesi virus (ToLCSuV) is proposed. Phylogenetic analysis shows the ToLCSuV isolates form a cluster distinct from other Indonesian begomoviruses as well as begomoviruses from the neighboring Philippines. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) S. K. Green et al. Plant Dis. 85:1286, 2001. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) W. S. Tsai et al. Plant Dis. 90:831, 2006.

Evaluation of optimal cerebral perfusion pressure in severe traumatic brain injury.

Traumatic brain injury (TBI) is a major cause of death and disability. In the 2000 guidelines, one of the suggestions for TBI treatment was to maintain cerebral perfusion pressure (CPP) < or = 70 mmHg. But in the 2003 guidelines, the suggestion was changed to < or = 60 mmHg. There have been some discrepancies of opinions about this recommendation in recent publications. In this study, we retrospectively reviewed 305 severe TBI (STBI) patients with Glasgow Coma Scales (GCS) < or = 8 between January 1, 2002 and March 31, 2003. The study group was stratified according to use or nonuse of intracranial pressure (ICP) monitoring, ICP levels, ages, and GCS levels in order to test the correlation between CCP and the prognosis. The patients < 50-year-old, with higher GCS level, with ICP monitoring, and with ICP levels < 20 mmHg had lower mortality rates and better prognosis (GOS) (p < 0.05 or 0.001). The patients in the GCS 3-5 subgroup had a significantly lower mortality and better prognosis if the CPP value was maintained higher than 70 mmHg (p < 0.05) The optimal CPP maintained < or = 60 mmHg did not fit in all STBI patients. Our study concludes that it is critical to maintain CPP substantially higher in lower GCS level patients.

Intracranial pressure fluctuation during hemodialysis in renal failure patients with intracranial hemorrhage.

Coagulopathy in renal failure patients often makes them vulnerable to intracranial hemorrhage. Emergency decompression to remove the hematoma and to stop bleeding is always indicated. After the surgery, hemodialysis (HD) should be arranged to maintain the BUN/Cr. level, and I/O balance. During HD, intracranial pressure in all of the patients in this study fluctuated. This phenomenon always resulted in neurological deterioration in acute or chronic renal failure. We present intracranial pressure (ICP) changes during HD in five acute or chronic renal failure patients with intracranial hemorrhage. They all underwent craniectomy or craniotomy with ICP monitors implantation. Different HD protocols were arranged for these patients and then we observed clinical results. ICP elevated during HD and resulted in severe brain swelling. This situation was one of the clinical presentations of dialysis disequilibrium syndrome (DDS). Four patients died because of this complication and one survived. ICP fluctuation seemed to be correlated with the fluid amount and frequency of HD. The prevalence and pathophysiology of DDS remain unclear. Renal failure patient with intracranial hemorrhage may be complicated with DDS when HD was performed. An attempt to reduce the fluid amount and to increase the frequency of HD might help these patients.

Effect of hyperbaric oxygen on patients with traumatic brain injury.

Hyperbaric oxygen therapy (HBOT) is the medical therapeutic use of oxygen at a higher atmospheric pressure. The United States Food and Drug Administration have approved several clinical applications for HBOT, but HBOT in traumatic brain injury (TBI) patients has still remained in controversial. The purpose of our study is to evaluate the benefit of HBOT on the prognosis of subacute TBI patients. We prospectively enrolled 44 patients with TBI from November 1, 2004 to October 31, 2005. The study group randomly included 22 patients who received HBOT after the patients' condition stabilization, and the other 22 corresponding condition patients were assigned into the matched control group who were not treated with HBOT. The clinical conditions of the patients were evaluated with the Glasgow Coma Scale (GCS) and Glasgow Outcome Scale (GOS) before and 3 to 6 months after HBOT. The GCS of the HBOT group was improved from 11.1 to 13.5 in average, and from 10.4 to 11.5 (p < 0.05) for control group. Among those patients with GOS = 4 before the HBOT, significant GOS improvement was observed in the HBOT group 6 months after HBOT. Based on this study, HBOT can provide some benefits for the subacute TBI patients with minimal adverse side effects.

Hypofractionated CyberKnife stereotactic radiosurgery for acoustic neuromas with and without association to neurofibromatosis Type 2.

CyberKnife stereotactic radiosurgery (CKSRS) has been proved effective in treating intra-cranial lesions. To treat acoustic neuroma (AN) patients with or without neurofibromatosis Type 2 (NF2) associations, the functional preservation of hearing, trigeminal nerve, and facial nerve are important. Twenty-one patients were treated with hypofractionated CKSRS. Fourteen non-NF2 and seven NF2 patients were enrolled. Cranial nerve function, audiograms, and magnetic resonance images (MRI) were monitored. Mean follow-up was 15 month. Tumors with volumes ranging from 0.13 to 24.8 cm3 (mean 5.4 cm3) were irradiated with the marginal dose 1800-2000 cGy/3 fractions. Tumors were treated with an 80 to 89% isodose line (mean 83%) and mean 97.9% tumor coverage. Two patients experienced hearing deterioration (16.7%) in the non-NF2 group, and 3 patients (50%) in the NF2 group. No facial or trigeminal dysfunction, brain stem toxicity, or cerebellar edema occurred. Tumor regression was seen in 9 patients (43%) and stable in 12 patients (57%). 100% tumor control rate was achieved. Hypofractionated CKSRS was not only effective in tumor control but also excellent in hearing preservation for non-NF2 AN. But for NF2 patients, although the tumor control was remarkable, hearing preservation was modest as in non-NF2 patients.

First Report and Molecular Characterization of DNA A of Three Distinct Begomoviruses Associated with Tomato Leaf Curl Disease in Ghana.

Tomato leaf curl disease is reported to be widespread in Ghana and to cause severe yield losses (4). So far, the causal agent has not been identified. Thirty-three tomato (Solanum lycopersicum L.) samples with symptoms such as curling, yellowing, small leaves, and stunting were collected from the Ashanti Region, the main tomato-production area in Ghana, including three samples from Akumandan in the autumn of 2007 and 30 samples from Kumasi in the spring of 2008. The observed leaf curl disease incidence in the farmer's field in Kumasi was approximately 75%. Viral DNAs were extracted from the 33 samples and tested for the presence of begomoviral DNA-A, DNA-B, and associated satellite DNA by PCR with previously described primers (1,3). The expected 1.4-kb DNA-A begomovirus fragment was obtained from one of the samples from Akumadan and from 25 samples from Kumasi. DNA-B and DNA-beta were not detected by PCR. The 1.4-kb PCR products from all positive samples were cloned and sequenced. Sequence comparison by MegAlign software (DNASTAR, Inc., Madison, WI) showed three distinct virus groups. One isolate from each group was selected and specific primers were designed to complete the DNA-A sequence. The DNA-As of GH5-3 (group 1), GOTB2-2 (group 2), and GHK2 (group 3) isolates consisted of 2,803 (GenBank Accession No. EU350585), 2,794 (GenBank Accession No. EU847739), and 2,792 nt (GenBank Accession No. EU847740) respectively. All contain the geminiviral conserved nonanucleotide sequence TAATATTAC in the intergenic region and the six predicted open reading frames (ORFs V1, V2, C1, C2, C3, and C4). BLASTn analysis was conducted with geminivirus sequences available in the GenBank database at National Center for Biotechnology Information (Bethesda, MD). Further sequence comparisons were performed by Clustal V algorithm of MegAlign software with the representative isolates of begomovirus species reported by Fauquet et al (2) and the sequences that showed high scores in BLASTn search. The DNA-A sequence of isolate GHK2 from Kumasi showed highest sequence identity (96.5%) with Tomato yellow leaf curl Mali virus (TYLCMLV; GenBank Accesssion No. AY502934). The DNA-A sequence of GH5-3 and GOTB2-2 isolates had 87.5% sequence identity with each other. Both had highest sequence identities of 76.7 and 77.6%, respectively, with Tomato leaf curl Antsiranana virus, Madagascar (GenBank Accession No. AM701764). They constitute two distinct begomovirus species based on DNA-A sequence comparisons and the International Committee on Taxonomy of Viruses proposed species demarcation of 89% sequence identity. The names Tomato leaf curl Ghana virus for isolate GH5-3 and Tomato leaf curl Kumasi virus for isolate BOTB2-2 are proposed, respectively. To our knowledge, this is the first report of molecular characterization of begomoviruses associated with tomato leaf curl disease in Ghana and of the presence of three distinct tomato begomoviruses. This presence should be considered for recommending or developing stable begomovirus resistant tomato cultivars for Ghana. References: (1) R. W. Briddon et al. Mol. Biotechnol. 20:315, 2002. (2) C. M. Fauquet et al. Arch. Virol. 153:783, 2008. (3) S. K. Green et al. Plant Dis. 85:1286, 2001. (4) D. Horna et al., eds. Online publication. Int. Food Policy Res. Inst. PBS Policy Brief 2, 2007.

First Report of Tomato yellow leaf curl Thailand virus in Taiwan.

During the 2006 winter and 2007 spring seasons, tomato lines carrying the Ty2 gene, which confers resistance to the Tomato leaf curl Taiwan virus (GenBank Accession No. U88692), showed severe yellowing, leaf curl, and stunting symptoms in several locations in Tainan County, Taiwan. Whiteflies were found to be associated with symptomatic plants, and disease incidences of almost 100% were observed. The presence of a new resistance breaking begomovirus was suspected. Six symptomatic leaf samples of three different tomato plants from each infected field were collected in Liouying (LY3, 7, and 8) and Sigang (SG9, 13, and 18) townships in Tainan County. Viral DNAs were extracted (2), and PCR with previously described primers was used to detect the presence of begomoviral DNA-A (4), DNA-B (3), and associated satellite DNA (1). Begomoviral DNA-A was detected in all tested samples. The PCR-amplified 1.5-kb viral DNA-A from one positive sample from each location (LY3 and SG18) was cloned and sequenced. On the basis of the 1.5 kb DNA-A sequences, specific primers were designed for cloning and sequencing the complete viral DNA-A, which was 2,744 bp for both the Liouying (GenBank Accession No. EF577266) and Sigang (GenBank Accession No. EF577264) isolates. Sequence analyses were conducted with DNAMAN sequence analysis software (Lynnon Corporation, Vaudreuil, Quebec, Canada). The DNA-A of both isolates contained the conserved nanonucleotides-TAATATTAC and six open reading frames, including two in the virus sense (AV1 and AV2) and four in the complementary sense (AC1 to AC4). On the basis of their 99.5% nucleotide identity, they are considered isolates of the same species. BLASTn analysis and sequence comparison with those available in the GenBank database ( http://www.ncbi.nlm.nih.gov ) indicated that the two isolates had the highest nucleotide identity (more than 98.4%) with the DNA-A of the Tomato yellow leaf curl Thailand virus (TYLCTHV; GenBank Accession No. AY514631). Virus-associated satellite DNA was not found in any of the samples. However, DNA-B was detected in all six samples, providing further evidence that the two isolates were the same as the bipartite TYLCTHV. All samples, except the LY3, were also found to be infected with Tomato leaf curl Taiwan virus (ToLCTWV), as indicated by a positive PCR reaction using the ToLCTWV-specific primer pair KD-PAV1 (5'ATCGTGTTGGGAAGAGGTTT3') and KD-PAC1 (5'GGAGAAAGCTCCCAAAGATT3'). A pure TYLCTHV isolate of LY3 was obtained in Lycopersicum esculentum TK70 by transmission with Bemisia tabaci Biotype B. The isolated TYLCTHV was found to infect L. esculentum H24 (resistant to ToLCTWV) and induce typical yellow leaf curl symptoms. To our knowledge, this is the first report of the presence of TYLCTHV in Taiwan. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) R. L. Gilbertson et al. J. Gen. Virol. 72:2843, 1991. (3) S. K. Green et al. Plant Dis. 85:1286, 2001. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Lipoprotein lipase gene S447X polymorphism modulates the relation between central obesity and serum lipids, a twin study.

OBJECTIVE: To investigate the impact of lipoprotein lipase (LPL) gene S447X polymorphism on the relation between central obesity and lipid levels. DESIGN: A total of 961 adult twin pairs were included from the program of Chinese Twin Registry, between 2001 and 2002. Central obesity was defined as waist circumference > or =90 cm for male and > or =80 cm for female. Two statistical methods were performed to test the modification effect of S447X polymorphism of LPL gene on the relation between central obesity and lipid levels: one was Generalized Estimating Equation (GEE) models for all twin pairs and the other was co-twin matched case-control analysis in 82 central obesity discordant monozygotic twin pairs. RESULTS: In GEE models for all twins, central obesity was significantly associated with serum lipids except for high-density lipoprotein (HDL), while X447 allele had favorable effects on the levels of triglyceride (TG), HDL and TG to HDL ratio (TG/HDL). The interactions of S447X polymorphism and central obesity were statistically significant for TG/HDL and HDL. In central obesity discordant monozygotic twin pairs, central obesity was significantly related with 26.2% increase of TG and 27.2% increase of TG/HDL in S/S447 genotype, while in 447X allele carrier, central obesity was significantly related with 13.7% increase of HDL. CONCLUSION: These results suggest that LPL gene S447X polymorphism modifies the relation between central obesity and serum lipids, which also stresses the importance of reducing waist circumference to improve serum lipids for people with central obesity, especially those with S/S447 genotype.