Truncated SCRIB isoform promotes breast cancer metastasis through HNRNP A1 mediated exon 16 skipping.

Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.

Effects of Jet Milling on the Physicochemical Properties of Buckwheat Flour and the Quality Characteristics of Extruded Whole Buckwheat Noodles.

The effects of jet milling on the physicochemical properties of buckwheat flour and the quality characteristics of extruded whole buckwheat noodles (WBN) were investigated in this study. The results reveal that the application of jet milling significantly reduced the particle size of buckwheat flour. As a result, the damaged starch content, water solubility index, water absorption index and swelling power of buckwheat flour all increased. It was worth noting that moderately ground buckwheat flour powder (D50 = 65.86 µm) had the highest pasting viscosity and gel hardness. The breaking rate and cooking loss of extruded whole buckwheat noodles made from the above powder were reduced by 33% and 16%, respectively. Meanwhile, they possessed the highest lightness and firmest network structure. Jet milling increased the soluble dietary fiber (SDF) content from 3.45% to 4.39%, and SDF further increased to 5.28% after noodle extrusion. This study was expected to provide a reference for exploiting high-quality gluten-free noodles from the perspective of milling.

Inhibitory Effects of Polyphenols-Rich Components From Three Edible Seaweeds on Inflammation and Colon Cancer in vitro.

Polyphenols from edible seaweeds display various health benefits which have not been adequately studied. This study aimed to characterize the composition of extractable polyphenol-rich components (EPCs) and non-extractable polyphenol-rich components (NEPCs) from three edible seaweeds (i.e., Laminaria japonica, Ulva lactuca, and Porphyra tenera) and evaluate their anti-inflammatory capacities in activated macrophages and anticancer properties in colon cancer cells. Both EPCs and NEPCs from three edible seaweeds against lipopolysaccharides (LPS) stimulated nitric oxide in activated macrophages. Immunoblotting and qRT-PCR indicated that EPCs and NEPCs regulated the expression levels of proinflammatory enzymes, proinflammatory cytokines, and antioxidant enzymes in macrophages. Furthermore, EPCs and NEPCs lowered the viability of colon cancer cells, while normal colon cells were not affected. Additionally, EPCs and NEPCs induced cellular apoptosis and led to G0/G1 cell cycle arrest in HCT116 cells. Overall, these results provide a rationale for future animal and human studies designed to examine the anti-inflammatory and chemopreventive capacities of polyphenols-rich components from L. japonica, U. lactuca, and P. tenera.

Bioactive Components From Gracilaria rubra With Growth Inhibition on HCT116 Colon Cancer Cells and Anti-inflammatory Capacity in RAW 264.7 Macrophages.

Gracilaria rubra is rich in bioactive compounds with various potential health benefits. This study aimed to elucidate the profile of both extractable bioactive components (EBCs) and non-extractable bioactive components (NEBCs) of G. rubra and determine their anti-colon cancer and anti-inflammatory activities. Both EBCs and NEBCs displayed strong suppressive effects on the viability of HCT116 cells, which causes cell cycle arrest, induces cellular apoptosis, and regulates the expression of cyclin-dependent kinases (CDKs) and tumor suppressor proteins. Additionally, EBCs and NEBCs from G. rubra displayed anti-inflammatory functions via inhibiting the production of nitric oxide (NO), reactive oxygen species (ROS), and proinflammatory cytokines in activated macrophages and regulating the expression levels of cyclooxygenase-2 (COX-2), inducible nitric oxide synthase (iNOS), NADPH-quinone oxidoreductase-1 (NQO-1), and heme oxygenase 1 (HO-1). These findings provide a rationale for animal and human studies designed to evaluate the chemopreventive and anti-inflammatory potential of these bioactive compounds from G. rubra.

Maternal Vit D supplementation in AMA mice and the role of Vit D/VDR signaling in the offspring's cognition.

OBJECTIVE: To explore the molecular mechanism underlying the effect of maternal vitamin D (Vit D) supplementation before pregnancy in advanced maternal age (AMA) mice on the offspring's cognitive function. METHODS: Thirty-two-week-old female mice either received 10 IU/g body weight vitamin D3 dissolved in 200 µl corn oil (32W+VD group), or 200 µl corn oil (32W group) per day for one week. Another group of eight-week-old female mice received the same amount of corn oil as 32W group was set as normal reproductive age control (8W group). Then the three groups of female mice were mating with ten-week-old male mice at 2:1 ratio, the offspring were weaned at the age of 3 weeks and housed until the age of 6 weeks. Vit D metabolites and enzymes involved in Vit D metabolism were measured in both mothers and their offspring. Vit D receptor (VDR) and synaptic markers were determined in the offspring hippocampus. Vit D response elements in HIF-1α promoter were predicted, and VDR transcriptional target genes and related signaling molecules were also detected. RESULTS: Vit D intervention markedly improved the serum 1,25 dihydroxy vitamin D3 (1,25(OH)2D3) concentration in early pregnancy, middle pregnancy and late pregnancy stages in AMA mice. The hippocampal 1,25(OH)2D3 levels in the offspring showed the similar pattern. Subsequently, the expression of Cyp27b1, the gene encoding enzyme that converts 25(OH)D3 to 1,25(OH)2D3, in the hippocampus of the offspring from AMA mice was significantly lower than that of the offspring from normal female mice, and was restored by Vit D supplementation. VDR (Vit D receptor), which mediates the cellular actions of active 1,25(OH)2D3, was also rescued by Vit D supplementation, especially in dentate gyrus (DG) region of hippocampus. Concurrently, the synaptic markers NR1, NR2A, and PSD-93 in the hippocampus were reversed in 32W+VD group. Finally, we found that Vit D supplementation may affect PI3K-AKT, PLC-ERK1/2, and p38-MAPK signaling molecules by mediating HIF1α expression via VDR. CONCLUSION: Our findings highlight the biological significance of maternal Vit D supplementation before pregnancy on Vit D metabolism, and signaling molecules in the offspring, underlying the potential mechanism of the cognitive impairment in the offspring born to AMA mice.

SRSF1 promotes the inclusion of exon 3 of SRA1 and the invasion of hepatocellular carcinoma cells by interacting with exon 3 of SRA1pre-mRNA.

Steroid receptor RNA activator 1 (SRA1) has been described as a novel transcriptional co-activator that affects the migration of cancer cells. Through RT-PCR, we identified that skipping exon 3 of SRA1 produces two isoforms, including the truncated short isoform, SRA1-S, and the long isoform, SRA1-L. However, the effect of these two isomers on the migration of HCC cells, as well as the specific mechanism of exon 3 skipping remain unclear. In this study, we found up regulated expression of SRSF1 and SRA1-L in highly metastatic HCCLM3, as well as in HCCs with SRSF1 demonstrating the strongest correlation with SRA1-L. In contrast, we observed a constitutively low expression of SRA1-S and SRSF1 in lowly metastatic HepG2 cells. Overexpression of SRSF1 or SRA1-L promoted migration and invasion by increasing the expression of CD44, while SRA1-S reversed the effect of SRSF1 and SRA1-L in vitro. In addition, lung metastasis in mice revealed that, knockdown of SRSF1 or SRA1-L inhibited the migration of HCC cells, while SRA1-L overexpression abolished the effect of SRSF1 knockout and instead promoted HCC cells migration in vivo. More importantly, RNA immunoprecipitation and Cross-link immunoprecipitation analyses showed that SRSF1 interacts with exon 3 of SRA1 to up regulate the expression of SRA1-L in HCC cells. RNA pull-down results indicated that SRSF1 could also bind to exon 3 of SRA1 in vitro. Finally, minigene -MS2 mutation experiments showed that mutation of the SRA1 exon 3 binding site for SRSF1 prevented the binding of SRA1 pre-mRNA. In summary, our results provide experimental evidence that SRA1 exon 3 inclusion is up regulated by SRSF1 to promote tumor invasion and metastasis in hepatocellular carcinoma.

Skipping of exon 10 in Axl pre-mRNA regulated by PTBP1 mediates invasion and metastasis process of liver cancer cells.

The Axl gene is known to encode for a receptor tyrosine kinase involved in the metastasis process of cancer. In this study, we investigated the underlying molecular mechanism of Axl alternative splicing. Methods: The expression levels of PTBP1 in hepatocellular carcinoma (HCC) tissues were obtained from TCGA samples and cell lines. The effect of Axl-L, Axl-S, and PTBP1 on cell growth, migration, invasion tumor formation, and metastasis of liver cancer cells were measured by cell proliferation, wound-healing, invasion, xenograft tumor formation, and metastasis. Interaction between PTBP1 and Axl was explored using cross-link immunoprecipitation, RNA pull-down assays and RNA immunoprecipitation assays. Results: Knockdown of the PTBP1 and exon 10 skipping isoform of Axl (Axl-S), led to impaired invasion and metastasis in hepatoma cells. Immunoprecipitation results indicated that Axl-S protein binds more robustly with Gas6 ligand than Axl-L (exon 10 including) and is more capable of promoting phosphorylation of ERK and AKT proteins. Furthermore, cross-link immunoprecipitation and RNA-pulldown assays revealed that PTBP1 binds to the polypyrimidine sequence(TCCTCTCTGTCCTTTCTTC) on Axl-Intron 9. MS2-GFP-IP experiments demonstrated that PTBP1 competes with U2AF2 for binding to the aforementioned polypyrimidine sequence, thereby inhibiting alternative splicing and ultimately promoting Axl-S production. Conclusion: Our results highlight the biological significance of Axl-S and PTBP1 in tumor metastasis, and show that PTBP1 affects the invasion and metastasis of hepatoma cells by modulating the alternative splicing of Axl exon 10.

PTBP1 enhances exon11a skipping in Mena pre-mRNA to promote migration and invasion in lung carcinoma cells.

Alternative splicing (AS) events occur in the majority of human genes. AS in a single gene can give rise to different functions among multiple isoforms. Human ortholog of mammalian enabled (Mena) is a conserved regulator of actin dynamics that plays an important role in metastasis. Mena has been shown to have multiple splice variants in human tumor cells due to AS. However, the mechanism mediated Mena AS has not been elucidated. Here we showed that polypyrimidine tract-binding protein 1 (PTBP1) could modulate Mena AS. First, PTBP1 levels were elevated in metastatic lung cancer cells as well as during epithelial-mesenchymal transition (EMT) process. Then, knockdown of PTBP1 using shRNA inhibited migration and invasion of lung carcinoma cells and decreased the Mena exon11a skipping, whereas overexpression of PTBP1 had the opposite effects. The results of RNA pull-down assays and mutation analyses demonstrated that PTBP1 functionally targeted and physically interacted with polypyrimidine sequences on both upstream intron11 (TTTTCCCCTT) and downstream intron11a (TTTTTTTTTCTTT). In addition, the results of migration and invasion assays as well as detection of filopodia revealed that the effect of PTBP1 was reversed by knockdown of Mena but not Mena11a+. Overexpressed MenaΔ11a also rescued the PTBP1-induced migration and invasion. Taken together, our study provides a novel mechanism that PTBP1 modulates Mena exon11a skipping, and indicates that PTBP1 depends on the level of Mena11a- to promote lung cancer cells migration and invasion. The regulation of Mena AS may be a potential prognostic marker and a promising target for treatment of lung carcinoma.

Therapeutic effects of the rhSOD2-Hirudin fusion protein on bleomycin-induced pulmonary fibrosis in mice.

Idiopathic pulmonary fibrosis (IPF) is a disease with a poor prognosis and high mortality, posing a major threat to human health. Increased levels of inflammatory cytokines, reactive oxygen species and coagulation cascade have been extensively reported in IPF. We previously fused Hirudin and human manganese superoxide dismutase (hSOD2) to generate a dual-feature fusion protein, denoted as rhSOD2-Hirudin fusion protein. In this study, 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) and Hydroxyproline (HYP) assays were used to investigate the effects of rhSOD2-Hirudin protein on thrombin-induced fibroblast proliferation and collagen accumulation in vitro. Subsequently, the mice model of pulmonary fibrosis induced by bleomycin was used for evaluating the anti-inflammatory and anti-fibrotic effects of rhSOD2-Hirudin protein in vivo. Results showed that rhSOD2-Hirudin protein could inhibit the proliferation of fibroblasts and reduce the HYP production in vitro by inhibiting the activity of thrombin. In vivo experiments showed that lung inflammation and fibrosis were significantly decreased in rhSOD2-Hirudin protein-treated mice. Furthermore, rhSOD2-Hirudin protein treatment reduced profibrotic protein and gene expression while reducing the number of inflammatory cells in the lung. In conclusion, rhSOD2-Hirudin protein can effectively attenuate pulmonary fibrosis in vitro and in vivo, mainly by inhibiting the activity of thrombin meanwhile increasing SOD2 levels prevent cells from being damaged by reactive oxygen species, thereby mitigating IPF progression. This study provided important information on the feasibility and efficacy of rhSOD2-Hirudin protein as a novel therapeutic agent for IPF.

miR-330-3p promotes lung cancer cells invasion, migration, and metastasis by directly targeting hSOD2b.

Lung cancer is a serious threat to human health. Studies have revealed that human manganese superoxide dismutase (hSOD2) and miRNAs play an essential role in the metastasis process of lung cancer. However, the miRNAs that associated with hSOD2 and involved in metastasis, remain elusive. After databases analysis and dual luciferase reporter validation, we demonstrated that miR-330-3p expression inversely correlated with hSOD2b expression level, and that miR-330-3p directly targeted the 3'untranslated region (3'UTR) of hSOD2b. Furthermore, overexpression of miR-330-3p promoted whereas knockdown of miR-330-3p inhibited invasion/migration and the epithelial-mesenchymal transition (EMT) process of lung cancer cells in vitro. Knockdown of miR-330-3p inhibited metastasis of lung cancer cells in vivo. Moreover, miR-330-3p-mediated enhancement of invasion/migration in 95-D cells could be rescued by over-expression of hSOD2. In conclusion, we demonstrated that miR-330-3p promoted metastasis of lung cancer cells by suppressing hSOD2b expression and unveiled a new clinical application of miR-330-3p in the therapy of lung cancer.

Effects of ration level and feeding frequency on digestibility in juvenile soft-shelled turtle, Pelodiscus sinensis.

The effects of ration level and feeding frequency on digestibility in juvenile soft-shelled turtle, Pelodiscus sinensis, were investigated. Four ration levels 1.5%, 2.5%, 4.0% and satiation (6.0% BW/d) were used. Apparent digestibility (AD) of dry matter (DMAD), protein (PAD) and protein real digestibility (PRD) were significantly affected by ration level, but not by feeding frequency when the ration level was similar. However, the feeding frequency affected the AD, DMAD, PAD and PRD significantly when the turtles were fed to satiation. The relationship between fecal protein content (Y) and protein intake (X) can be expressed as a quadric equation: Y=-0.1742+0.1476X-0.0003X(2) (r(2)=0.876, n=27, F=93.92, P<0.01).

[Effect of salinity and body weight on the oxygen consumption of Oreochromis niloticus x O. mossambicus].

The effects of salinity and body weight on oxygen consumption of Taiwan red tilapia (Oreochromis niloticus x O. mossambicus) were studied. The fish was divided into three groups by their body weight: 1.57-4.87 g (G1), 7.07-18.23 g (G2) and 31.50-52.41 g (G3). The results showed that oxygen consumption at different salinities was significantly different (P < 0.01). The rates of oxygen consumption in G1 and G2 were highest, with 0.41 mg O2.g-1.h-1 for G1, and 0.34 mg O2.g-1.h-1 for G2 respectively at salinity 7@1000; while G3 had highest level with 0.30 mg O2.g-1.h-1 at 35@1000. The lowest oxygen consumption level appeared at different salinities with the different body weight. The lowest level in G1, 0.27 mg O2.g-1.h-1, appeared at salinity 14@1000. G2 and G3 had lowest oxygen consumption level at 21@1000, with 0.22 mg O2.g-1.h-1 and 0.13 mg O2.g-1.h-1 respectively. ANOV showed that oxygen consumption was significantly affected by the interaction of salinity and body weight.