RESUMO
PURPOSE: The aim of this study was to investigate the effect of individualized ocular refraction customized (IORC) spectacle lenses with different actual amounts of peripheral myopic defocus (MD) on myopia control over 1 year. These lenses compensate for the original peripheral refraction via the free-form surface on the back of the lens. METHODS: This 1-year, double-masked randomised clinical trial included 184 myopic schoolchildren aged 8-12 years. Participants were randomised to receive IORC lenses with high (IORC-H group, +4.50 D), medium (IORC-M group, +3.50 D) or low (IORC-L group, +2.50 D) MD or single-vision (SV) lenses. The spherical equivalent refractive error (SER) and axial length (AL) were measured at baseline and 6-monthly intervals. RESULTS: After 1 year, the mean (SD) changes in SER were -0.18 (0.37), -0.36 (0.37), -0.52 (0.39) and -0.60 (0.42) D for the IORC-H, IORC-M, IORC-L and SV groups, respectively. Compared with the SV group, the effects of slowing myopia progression were 70%, 40% and 13% for the IORC-H (difference of 0.47 D, p < 0.001), IORC-M (difference of 0.32 D, p = 0.001) and IORC-L (difference of 0.15 D, p > 0.05) groups, respectively. The mean (SD) changes in AL were 0.12 (0.16), 0.23 (0.17), 0.29 (0.17) and 0.36 (0.17) mm for the IORC-H, IORC-M, IORC-L and SV groups, respectively. The axial elongation was 67%, 36% and 19% lower in the IORC-H (difference of 0.25 mm, p < 0.001), IORC-M (difference of 0.15 mm, p < 0.001) and IORC-L (difference of 0.10 mm, p = 0.04) groups, respectively, compared with the SV group. The IORC-H group exhibited significantly less axial elongation than the IORC-M and IORC-L groups (p = 0.01 and p < 0.001, respectively). CONCLUSION: Compared with the IORC-M and IORC-L lenses, the IORC-H lens was found to have superior efficacy in inhibiting myopic progression and slowing eye growth in schoolchildren, with better myopia control efficacy in younger children.
RESUMO
Purpose: Individualized ocular refraction customization (IORC) lenses can be individually adjusted depending on the initial relative peripheral refraction to determine the myopic defocus (MD). We aimed to compare visual performance of children wearing IORC lenses with different amounts of MD to determine whether higher MD resulted in greater visual compromise. Methods: This study included 184 myopic children aged eight to 12 years, and 172 completed the trial. The participants were randomly assigned to wear IORC lenses with low (IORC-L, 2.50 D), medium (IORC-M, 3.50 D), or high (IORC-H, 4.50 D) MD or single-vision spectacle lenses (SVL). Distance and near best-corrected visual acuity (BCVA), contrast sensitivity function (CSF) and questionnaires were evaluated at baseline and after six and 12 months. Results: CSF over all frequencies and distance and near BCVA were not affected by lens design (all P > 0.05). The SVL group outperformed the three IORC lens groups in terms of ghosting images at baseline, and IORC-H and IORC-M groups outperformed IORC-L group (all P < 0.001); however, no differences were observed at the six- or 12-month visit. There were no significant differences among the four groups for any other subjective variables at any of the follow-up visits regarding vision clarity, vision stability, eyestrain, dizziness, headache, or overall vision satisfaction (all P > 0.05). Conclusions: The IORC lenses with an actual MD of 4.50 D provided acceptable objective and subjective visual performance and were well tolerated by children. Translational Relevance: IORC lenses with an actual MD of 4.50 D provided acceptable visual performance.
Assuntos
Sensibilidades de Contraste , Óculos , Miopia , Refração Ocular , Acuidade Visual , Humanos , Criança , Miopia/terapia , Miopia/fisiopatologia , Feminino , Masculino , Acuidade Visual/fisiologia , Refração Ocular/fisiologia , Sensibilidades de Contraste/fisiologia , China , Inquéritos e Questionários , População do Leste AsiáticoRESUMO
Parkinson's disease (PD) is a progressive late-onset neurodegenerative disease leading to physical and cognitive decline. Mutations of leucine-rich repeat kinase 2 (LRRK2) are the most common genetic cause of PD. LRRK2 is a complex scaffolding protein with known regulatory roles in multiple molecular pathways. Two prominent examples of LRRK2-modulated pathways are Wingless/Int (Wnt) and nuclear factor of activated T-cells (NFAT) signaling. Both are well described key regulators of immune and nervous system development as well as maturation. The aim of this study was to establish the physiological and pathogenic role of LRRK2 in Wnt and NFAT signaling in the brain, as well as the potential contribution of the non-canonical Wnt/Calcium pathway. In vivo cerebral Wnt and NFATc1 signaling activity was quantified in LRRK2 G2019S mutant knock-in (KI) and LRRK2 knockout (KO) male and female mice with repeated measures over 28 weeks, employing lentiviral luciferase biosensors, and analyzed using a mixed-effect model. To establish spatial resolution, we investigated tissues, and primary neuronal cell cultures from different brain regions combining luciferase signaling activity, immunohistochemistry, qPCR and western blot assays. Results were analyzed by unpaired t-test with Welch's correction or 2-way ANOVA with post hoc corrections. In vivo Wnt signaling activity in LRRK2 KO and LRRK2 G2019S KI mice was increased significantly ~ threefold, with a more pronounced effect in males (~ fourfold) than females (~ twofold). NFATc1 signaling was reduced ~ 0.5-fold in LRRK2 G2019S KI mice. Brain tissue analysis showed region-specific expression changes in Wnt and NFAT signaling components. These effects were predominantly observed at the protein level in the striatum and cerebral cortex of LRRK2 KI mice. Primary neuronal cell culture analysis showed significant genotype-dependent alterations in Wnt and NFATc1 signaling under basal and stimulated conditions. Wnt and NFATc1 signaling was primarily dysregulated in cortical and hippocampal neurons respectively. Our study further built on knowledge of LRRK2 as a Wnt and NFAT signaling protein. We identified complex changes in neuronal models of LRRK2 PD, suggesting a role for mutant LRRK2 in the dysregulation of NFAT, and canonical and non-canonical Wnt signaling.
Assuntos
Modelos Animais de Doenças , Serina-Treonina Proteína Quinase-2 com Repetições Ricas em Leucina , Fatores de Transcrição NFATC , Doença de Parkinson , Via de Sinalização Wnt , Animais , Serina-Treonina Proteína Quinase-2 com Repetições Ricas em Leucina/genética , Serina-Treonina Proteína Quinase-2 com Repetições Ricas em Leucina/metabolismo , Fatores de Transcrição NFATC/metabolismo , Fatores de Transcrição NFATC/genética , Doença de Parkinson/genética , Doença de Parkinson/metabolismo , Doença de Parkinson/patologia , Masculino , Camundongos , Feminino , Técnicas de Introdução de Genes , Camundongos Knockout , Neurônios/metabolismo , Encéfalo/metabolismo , Encéfalo/patologia , Mutação , HumanosRESUMO
This study aims to systematically review the clinical features and outcome indicators in randomized controlled trial(RCT) of traditional Chinese medicine(TCM) intervention in septic kidney injury and provide a reference for optimizing clinical study design and building the core outcome set(COS) of TCM treatment of septic kidney injury. Computer searches were conducted on PubMed, Cochrane Library, EMbase, Web of Science, CNKI, Wanfang, VIP, and SinoMed to find published RCT of TCM intervention in septic kidney injury in the past five years, extract the basic characteristics, intervention measures, outcome indicators, and other data of included studies, and conduct descriptive analysis. 53 RCTs were included, and the sample size was mostly concentrated in 60-80 cases, with abdominal infection being the most common(15 articles, 83.3%) and the TCM syndrome of blood stasis being the most frequent(9 articles, 50.0%). The frequency of intervention methods from high to low were TCM decoction(28 articles, 52.8%), Chinese patent medicine(22 articles, 41.5%), and combined TCM therapy(3 articles, 7.5%); the intervention time of the trial was more than 7 d(34 articles, 69.4%). The risk of bias in included studies was unclear. A total of 84 outcome indicators were involved, which were divided into 9 fields, including 63 physical and chemical tests(305 times, 72.2%), 4 kinds of disease degree(48 times, 11.6%), 4 kinds of clinical effective rate(15 times, 3.6%), 1 kind of quality of life(1 time, 0.2%), 2 kinds of economic evaluation(14 times, 3.3%), 1 kind of TCM disease(9 times, 2.1%), 2 kinds of long-term prognosis(16 times, 3.8%), 2 kinds of safety events(6 times, 1.4%), and 5 other indicators(8 times, 0.7%). The cumulative frequency was 422 times, among which the outcome indicators with higher frequency were inflammatory factors(42 articles, 79.2%) and markers of renal function and kidney injury(40 articles, 75.5%). Only 1(1.9%) of the included articles mentioned primary and secondary outcome indicators, and 6 articles(11.3%) mentioned safety events, 13 articles(24.5%) mentioned economic assessment. The RCT quality of TCM intervention in septic renal injury was generally low, and the reference standards for sepsis, kidney injury, and TCM syndrome diagnosis were not uniform. There are some problems in outcome indicators, such as unclear distinction between primary and secondary indicators, neglect of endpoint indicators, lack of application of TCM characteristic indicators, and insufficient attention to safety events and economic assessment. It is suggested that the quality of clinical research methodology should be improved in the future, and the COS should be constructed to provide high-level evidence-based evidence for TCM intervention in septic kidney injury.
RESUMO
Disaster plant pathology addresses how natural and human-driven disasters impact plant diseases and the requirements for smart management solutions. Local to global drivers of plant disease change in response to disasters, often creating environments more conducive to plant disease. Most disasters have indirect effects on plant health through factors such as disrupted supply chains and damaged infrastructure. There is also the potential for direct effects from disasters, such as pathogen or vector dispersal due to floods, hurricanes, and human migration driven by war. Pulse stressors such as hurricanes and war require rapid responses, whereas press stressors such as climate change leave more time for management adaptation but may ultimately cause broader challenges. Smart solutions for the effects of disasters can be deployed through digital agriculture and decision support systems supporting disaster preparedness and optimized humanitarian aid across scales. Here, we use the disaster plant pathology framework to synthesize the effects of disasters in plant pathology and outline solutions to maintain food security and plant health in catastrophic scenarios. We recommend actions for improving food security before and following disasters, including (i) strengthening regional and global cooperation, (ii) capacity building for rapid implementation of new technologies, (iii) effective clean seed systems that can act quickly to replace seed lost in disasters, (iv) resilient biosecurity infrastructure and risk assessment ready for rapid implementation, and (v) decision support systems that can adapt rapidly to unexpected scenarios. [Formula: see text] Copyright © 2024 The Author(s). This is an open access article distributed under the CC BY 4.0 International license.
Assuntos
Doenças das Plantas , Doenças das Plantas/prevenção & controle , Humanos , Patologia Vegetal , Desastres , Mudança Climática , Segurança AlimentarRESUMO
BACKGROUND: Sarcopenia may be associated with hepatocellular carcinoma (HCC) following hepatectomy. But traditional single clinical variables are still insufficient to predict recurrence. We still lack effective prediction models for recent recurrence (time to recurrence < 2 years) after hepatectomy for HCC. AIM: To establish an interventable prediction model to estimate recurrence-free survival (RFS) after hepatectomy for HCC based on sarcopenia. METHODS: We retrospectively analyzed 283 hepatitis B-related HCC patients who underwent curative hepatectomy for the first time, and the skeletal muscle index at the third lumbar spine was measured by preoperative computed tomography. 94 of these patients were enrolled for external validation. Cox multivariate analysis was per-formed to identify the risk factors of postoperative recurrence in training cohort. A nomogram model was developed to predict the RFS of HCC patients, and its predictive performance was validated. The predictive efficacy of this model was evaluated using the receiver operating characteristic curve. RESULTS: Multivariate analysis showed that sarcopenia [Hazard ratio(HR) = 1.767, 95%CI: 1.166-2.678, P < 0.05], alpha-fetoprotein ≥ 40 ng/mL (HR = 1.984, 95%CI: 1.307-3.011, P < 0.05), the maximum diameter of tumor > 5 cm (HR = 2.222, 95%CI: 1.285-3.842, P < 0.05), and hepatitis B virus DNA level ≥ 2000 IU/mL (HR = 2.1, 95%CI: 1.407-3.135, P < 0.05) were independent risk factors associated with postoperative recurrence of HCC. Based on the sarcopenia to assess the RFS model of hepatectomy with hepatitis B-related liver cancer disease (SAMD) was established combined with other the above risk factors. The area under the curve of the SAMD model was 0.782 (95%CI: 0.705-0.858) in the training cohort (sensitivity 81%, specificity 63%) and 0.773 (95%CI: 0.707-0.838) in the validation cohort. Besides, a SAMD score ≥ 110 was better to distinguish the high-risk group of postoperative recurrence of HCC. CONCLUSION: Sarcopenia is associated with recent recurrence after hepatectomy for hepatitis B-related HCC. A nutritional status-based prediction model is first established for postoperative recurrence of hepatitis B-related HCC, which is superior to other models and contributes to prognosis prediction.
Assuntos
Carcinoma Hepatocelular , Hepatite B , Neoplasias Hepáticas , Sarcopenia , Humanos , Carcinoma Hepatocelular/cirurgia , Sarcopenia/complicações , Sarcopenia/diagnóstico por imagem , Hepatectomia/efeitos adversos , Estudos Retrospectivos , Neoplasias Hepáticas/cirurgia , Hepatite B/complicaçõesRESUMO
BACKGROUND: Exercise therapy can improve muscle mass, strengthen muscle and cardiorespiratory function, and may be an excellent adjunctive treatment option for Duchenne muscular dystrophy. METHODS: This article investigates the effects of 10 weeks of treadmill training on skeletal muscle in control and mdx mice. Hematoxylin and eosin (H&E) staining was used to detect the morphometry of skeletal muscle; the grip strength test, suspension test, and rotarod test were used to detect limb muscle strength of mice, and Aurora Scientific Instruments were used to detect in vivo Muscle Stimulation Measuring Maximum Force of pre-fatigue and post-fatigue. The expression levels of myogenic proteins, ubiquitination markers, autophagy pathway proteins, and the proportion of different muscle fiber types were detected. RESULTS: The experimental results show that running exercise can significantly improve the muscle mass of mdx mice, promote muscle strength, endurance, and anti-fatigue ability, reverse the pathological state of skeletal muscle destruction in mdx mice, and promote muscle regeneration. WB experiments showed that running inhibited the ubiquitination and degradation of muscle protein in mdx mice, inhibited AKT activation, decreased phosphorylated FoxO1 and FoxO3a, and restored the suppressed autophagic flux. Running enhances muscle strength and endurance by comprehensively promoting the expression of Myh1/2/4/7 fast and slow muscle fibers in mdx mice. CONCLUSIONS: Running can inhibit the degradation of muscle protein in mdx mice, and promote the reuse and accumulation of proteins, thereby slowing down muscle loss. Running improves skeletal muscle mass by activating autophagic flux and inhibiting ubiquitination degradation in mdx mice.
Assuntos
Distrofia Muscular de Duchenne , Corrida , Animais , Camundongos , Camundongos Endogâmicos mdx , Camundongos Endogâmicos C57BL , Músculo Esquelético/metabolismo , Corrida/fisiologia , Proteínas Musculares/metabolismo , Autofagia , Modelos Animais de DoençasRESUMO
BACKGROUND: Acute lung injury (ALI) is a serious lung disease characterized by acute and severe inflammation. Upregulation of ACE2 and inhibition of the NF-κB signaling pathway attenuate LPS-induced ALI. OBJECTIVE: To explore whether Zang Siwei Qingfei Mixture inhibits the development of ALI through the ACE2/NF-κB signaling pathway. METHODS: Alveolar type II epithelial cells (AEC II) were identified by immunofluorescence staining and flow cytometry. C57BL/6J mice were treated with LPS to establish an ALI model. Cell viability was assessed using CCK8 assays. The levels of ACE, ACE2, p-p38/p38, p- ERK1/2/ERK1/2, p-JNK/JNK, p-IκBα/IκB-α, p-NF-κBp65 were analyzed by Western blotting. ELISA was applied to detect the levels of TNF-a, IL-6, AGT, and Ang1-7. HE staining was used to observe lung injury. The mRNA expression of ACE, ACE2, and Mas was measured by RTqPCR. RESULTS: AEC II cells were successfully isolated. Treatment with Zang Siwei Qingfei mixture resulted in a decrease in ACE, p-p38/p38, p-ERK1/2/ERK1/2, p-JNK/JNK, p-IκBα/IκB-α, p- NF-κBp65 levels, while increasing ACE2 levels. Zang Siwei Qingfei mixture also led to a reduction in TNF-α, IL6, and AGT levels, while increasing Ang1-7 level. Histological analysis showed that Zang Siwei Qingfei Mixture treatment improved the alveolar structure of ALI mice and reduced inflammatory infiltration. The pretreatment with MLN-4760, an ACE2 inhibitor, resulted in opposite effects compared to Zang Siwei Qingfei Mixture treatment. CONCLUSION: Zang Siwei Qingfei mixture attenuates ALI by regulating the ACE2/NF-κB signaling pathway in mice. This study provides a theoretical foundation for the development of improved ALI treatments.
RESUMO
BACKGROUND: Evidence on the influence of programmed death-ligand 1 (PD-L1) expression on the efficacy of epidermal growth factor receptor tyrosine kinase inhibitors (EGFR-TKIs) in EGFR-mutant non-small cell lung cancer (NSCLC) patients is at variance. METHODS: A single-center retrospective study was conducted to evaluate the influence of PD-L1 expression on the efficacy of EGFR-TKIs for NSCLC patients with EGFR mutation. Clinical information was retrieved from electronic medical records. The patients were divided into three subgroups according to PD-L1 expression level: PD-L1 < 1% (negative), PD-L1 1%-49% and PD-L1 ≥ 50%. The clinicopathological features, overall response rate (ORR), progression-free survival (PFS) and comutation information were collected and compared between the three subgroups. RESULTS: A total of 117 patients were included. For PD-L1 < 1%, PD-L1 1%-49% and PD-L1 ≥ 50% group, there were 39 (33.3%), 51 (43.5%) and 27 (23.0%) patients respectively, and the ORR was 43.2%, 64.0%, and 51.9%, respectively (p = 0.162), and the median progression-free survival (mPFS) was 22.0 months (95% CI: 14.0-29.9 months), 15.4 months (95% CI: 8.9-21.8 months) and 13.0 months (95% CI: 10.6-15.3 months), respectively (log-rank, p = 0.01). The mPFS was negatively correlated with PD-L1 expression level (r = -0.264, p = 0.041) and PD-L1 expression was an independent risk factor for worse PFS of EGFR-TKIs in multivariate Cox regression. Patients with concurrent TP53 mutation had shorter PFS (p = 0.039) and the patients harboring both mutant TP53 and positive PD-L1 had the shortest PFS (p = 0.006). CONCLUSIONS: The efficacy of EGFR-TKIs was influenced by the baseline PD-L1 expression. Higher PD-L1 expression was associated with shorter PFS. The combined indicators of TP53 and PD-L1 identified subgroups showing divergent benefits from EGFR-TKIs.
Assuntos
Carcinoma Pulmonar de Células não Pequenas , Neoplasias Pulmonares , Humanos , Carcinoma Pulmonar de Células não Pequenas/tratamento farmacológico , Carcinoma Pulmonar de Células não Pequenas/genética , Carcinoma Pulmonar de Células não Pequenas/metabolismo , Neoplasias Pulmonares/tratamento farmacológico , Neoplasias Pulmonares/genética , Neoplasias Pulmonares/metabolismo , Antígeno B7-H1 , Estudos Retrospectivos , Receptores ErbB/metabolismo , Mutação , Inibidores de Proteínas Quinases/farmacologia , Inibidores de Proteínas Quinases/uso terapêuticoRESUMO
Objective: This study aimed to investigate directional influences in the association between adiposity and physical activity (PA) from pre-puberty to early adulthood. Methods: In the Calex-study, height, weight, body fat and leisure-time physical activity (LTPA) were measured at age11.2-years, 13.2-years and 18.3-years in 396 Finnish girls. Body fat was measured by dual-energy X-ray absorptiometry, calculating fat mass index (FMI) as total fat mass in kilograms divided by height in meters squared. LTPA level was evaluated using a physical activity questionnaire. In the European Youth Heart Study (EYHS), height, weight and habitual PA were measured at age 9.6-years, 15.7-years and 21.8-years in 399 Danish boys and girls. Habitual PA and sedentary behaviour were assessed with an accelerometer. Directional influences of adiposity and PA were examined using a bivariate cross-lagged path panel model. Results: The temporal stability of BMI from pre-puberty to early adulthood was higher than the temporal stability of PA or physical inactivity over the same time period both in girls and boys. In the Calex-study, BMI and FMI at age 11.2-years were both directly associated with LTPA at age 13.2-years (ß = 0.167, p = 0.005 and ß = 0.167, p = 0.005, respectively), whereas FMI at age 13.2-years showed an inverse association with LTPA at age 18.3-years (ß = - 0.187, p = 0.048). However, earlier LTPA level was not associated with subsequent BMI or FMI. In the EYHS, no directional association was found for physical inactivity, light-, moderate-, and vigorous-PA with BMI during the follow-up in girls. In boys, BMI at age 15.7-years was directly associated with moderate PA (ß = 0.301, p = 0.017) at age 21.8-years, while vigorous PA at age 15.7-years showed inverse associations with BMI at age 21.8-years (ß = - 0.185, p = 0.023). Conclusion: Our study indicates that previous fatness level is a much stronger predictor of future fatness than level of leisure-time or habitual physical activity during adolescence. The directional associations between adiposity and physical activity are not clear during adolescence, and may differ between boys and girls depending on pubertal status.
Assuntos
Adiposidade , Exercício Físico , Masculino , Feminino , Adolescente , Humanos , Adulto , Criança , Adulto Jovem , Estudos Longitudinais , Índice de Massa Corporal , Obesidade , PuberdadeRESUMO
Breast cancer is one of the most common malignant tumors with high mortality due to metastases. SCRIB, a scaffold protein mainly distributed in the cell membrane, is a potential tumor suppressor. Mislocalization and aberrant expression of SCRIB stimulate the EMT pathway and promote tumor cell metastasis. SCRIB has two isoforms (with or without exon 16) produced by alternative splicing. In this study we investigated the function of SCRIB isoforms in breast cancer metastasis and their regulatory mechanisms. We showed that in contrast to the full-length isoform (SCRIB-L), the truncated SCRIB isoform (SCRIB-S) was overexpressed in highly metastatic MDA-MB-231 cells that promoted breast cancer metastasis through activation of the ERK pathway. The affinity of SCRIB-S for the catalytic phosphatase subunit PPP1CA was lower than that of SCRIB-L and such difference might contribute to the different function of the two isoforms in cancer metastasis. By conducting CLIP, RIP and MS2-GFP-based experiments, we revealed that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) promoted SCRIB exon 16 skipping by binding to the "AG"-rich sequence "caggauggaggccccccgugccgag" on intron 15 of SCRIB. Transfection of MDA-MB-231 cells with a SCRIB antisense oligodeoxynucleotide (ASO-SCRIB) designed on the basis of this binding sequence, not only effectively inhibited the binding of hnRNP A1 to SCRIB pre-mRNA and suppressed the production of SCRIB-S, but also reversed the activation of the ERK pathway by hnRNP A1 and inhibited the metastasis of breast cancer. This study provides a new potential target and a candidate drug for treating breast cancer.
Assuntos
Neoplasias da Mama , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B , Humanos , Feminino , Ribonucleoproteína Nuclear Heterogênea A1/genética , Ribonucleoproteína Nuclear Heterogênea A1/metabolismo , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo A-B/metabolismo , Neoplasias da Mama/genética , Isoformas de Proteínas/genética , Isoformas de Proteínas/metabolismo , Processamento Alternativo , Éxons/genética , Proteínas de Membrana/genética , Proteínas de Membrana/metabolismo , Proteínas Supressoras de Tumor/metabolismoRESUMO
BACKGROUND: This study adopted a quasi-experimental design to examine the effect of a 7-week mindfulness intervention on the psychological coping ability and shooting performance of college-level male basketball athletes in Macau. METHODS: A total of 43 male college basketball athletes in Macau were selected as the participants. Besides the regular basketball training, the intervention group (n = 23) received a 7-week mindfulness training; the weekly mindfulness intervention session lasted around one hour according to the mindfulness training manual for athletes, while the control group (n = 20) did not receive any mindfulness training. Before and immediately after the 7-week intervention, all players performed the following tests: the "Five-Facet Mindfulness Questionnaire", the "Acceptance and Action Questionnaire", the "Sport Competition Anxiety Test", the "Mindfulness Attention Awareness Scale", and three shooting tests. An independent-sample t-test and a paired-sample t-test were used to analyze the between- and within-group differences. Moreover, a repeated measures ANOVA was used to assess the group, time, and group-by-time effects on psychological skills and shooting performances. RESULTS: The intervention resulted in both significant between-group and within-group differences in mindfulness level, acceptance level, attention level, three-point, and free-throw shooting performances (all p < 0.05, Cohen's d ranging from 0.565 to 1.117). CONCLUSION: While further study is necessary, the present study suggests that the 7-week mindfulness training program can significantly improve psychological outcomes and shooting performance in Macau college basketball athletes. Future studies involving competition settings and objective metrics will aid in verifying mindfulness as the prevalent practice among basketball practitioners and athletes.
Assuntos
Desempenho Atlético , Basquetebol , Atenção Plena , Humanos , Masculino , Atenção Plena/métodos , Macau , Desempenho Atlético/psicologia , Atletas/psicologiaRESUMO
In recent years, mindfulness-based interventions (MBIs) have been widely applied in competition sports with respect to athletic performance and mental health promotion, whereas evidence of randomized controlled trials (RCTs) has not been well summarized. Therefore, this study aimed to systematically review and meta-analyze the existing evidence on the effects of MBIs on improving athletic performance, mindfulness level, mindfulness-related psychological components (e.g., acceptance, self-compassion, flow), and mental health (e.g., burnout, stress, psychological well-being) among athletes. Following the PRISMA guidelines, a literature search was implemented on five electronic databases (Web of Science, PubMed, Scopus, ProQuest, and ScienceDirect) and relevant review papers. The article selection, risk of bias assessment, and data extraction were performed by two investigators independently. The standardized mean difference (SMD) was calculated to evaluate the effects of interventions using the random effect model. Among the 1897 original hits, thirty-two eligible RCT studies were included in the systematic review, of which seven were involved in the meta-analysis. The results showed that MBIs were effective in promoting athletes' athletic performances (by narrative synthesis), mindfulness-level (n = 3; SMD = 0.50, 95% CI = [0.17, 0.83]; I2 = 45%, p = 0.16), and mindfulness-related psychological components (n = 5; SMD = 0.81, 95% CI = [0.53, 1.10], I2 = 77%, p =0.001), while no significant intervention effects were found on the mental health of athletes (n = 4; SMD = -0.03, 95% CI = [-0.35, 0.29], I2 = 89%, p < 0.001). Our findings preliminarily support the potential effectiveness of MBIs, whereas more high-quality RCTs were needed in the future.
Assuntos
Desempenho Atlético , Atenção Plena , Humanos , Atenção Plena/métodos , Atletas , Saúde Mental , Autocompaixão , Ensaios Clínicos Controlados Aleatórios como AssuntoRESUMO
Severe fever with thrombocytopenia syndrome virus (SFTSV), a tick-borne Bunyavirus, causes an emerging hemorrhagic fever in humans with a high fatality in Asia. The tick vectors and hosts of SFTSV are not well studied. We evaluated SFTSV transmission in laboratory reared Haemaphysalis flava ticks. RT-PCR demonstrated that after acquisition feeding in SFTSV-infected rabbits, 10 % (4/40) engorged larvae, 25% (5/20) engorged nymphs, and 50% (5/10) engorged females of H. flava became SFTSV RNA positive; after engorged larvae and nymphs molted into nymphs and adults, respectively, 12.5% (3/24) newly molted nymphs and 20% (2/10) newly molted adults were SFTSV RNA positive. Among 30 engorged females that oviposited, 10% (3/30) clutches of eggs and 3.3% (1/30) colonies of larvae were RNA positive for SFTSV. RT-PCR also showed that 6 days after being infested with SFTSV-infected ticks, 100% (3/3) rabbits infested with larvae, 100% (2/2) rabbits infested with nymphs, and 100% (2/2) rabbits infested with adult ticks became SFTSV RNA positive. In conclusion, H. flava can acquire SFTSV from infected rabbits by feeding; there is transstadial and transovarial transmission of the virus and all three stages of H. flava can transmit SFTSV to rabbits by feeding. Thus, H. flava tick is an effective vector of SFTSV and may play a role in the transmission of SFTSV in wild animals and humans.
Assuntos
Ixodidae , Phlebovirus , Febre Grave com Síndrome de Trombocitopenia , Carrapatos , Animais , Humanos , Feminino , Coelhos , Ixodidae/genética , Phlebovirus/genética , RNARESUMO
BACKGROUND: Persons with suicidality including suicidal ideation (SI), suicide plans (SP) and/or suicide attempts (SA) are at higher risk for future suicide than those without suicidality. To reduce the risk of future suicide, it is important to understand symptoms of emotional distress that have the strongest links with SI, SP and SA. This network analysis examined item-level relations of depressive and anxiety symptoms with suicidality among adolescents during the COVID-19 pandemic. METHODS: Adolescents between 12 and 20 years of age were assessed with the Patient Health Questionnaire (PHQ-9), Generalized Anxiety Disorder Scale (GAD-7), and individual binary reponse (no/yes) items assessing SI, SP, and SA during the pandemic. The structure of depressive symptoms, anxiety symptoms and suicidality was characterized using "Expected Influence" and "Bridge Expected Influence" as centrality indices in the symptom network. Network stability was tested using a case-dropping bootstrap procedure. Node-specific predictive betweenness was computed to examine short paths of anhedonia, other depressive symptoms and anxiety symptoms with suicidality. A Network Comparison Test (NCT) was conducted to examine whether network characteristics differed based on gender. RESULTS: Prevalence rates of depressive symptoms, anxiety symptoms, and suicidality were 44.60 % (95% confidence interval (CI) = 41.53-47.67 %), 31.12 % (95%CI = 28.26-33.98 %), and 16.95 % (95%CI = 14.63-19.26 %), respectively, in the study sample. The network analysis identified GAD3 ("Worry too much") as the most central symptom, followed by GAD6 ("Irritability") and PHQ6 ("Guilt") in the sample. Additionally, PHQ6 ("Guilt"), GAD6 ("Irritability"), and PHQ2 ("Sad mood") were bridge nodes linking depressive and anxiety symptoms with suicidality. A flow network indicated that the connection between S ("Suicidality") and PHQ6 ("Guilt") reflected the strongest connection, followed by connections of S ("Suicidality") with GAD2 ("Uncontrollable worrying"), and S ("Suicidality") with PHQ2 ("Sad mood"). Finally, PHQ2 ("Sad mood") was the main bridge node linking anhedonia with other depressive and anxiety symptoms and suicidality in the sample. CONCLUSIONS: Findings highlight the potential importance of reducing specific depressive and anxiety symptoms as possible means of reducing suicidality among adolescents during the pandemic. Central symptoms and key bridge symptoms identified in this study should be targeted in suicide prevention for at-risk adolescents.
Assuntos
COVID-19 , Ideação Suicida , Humanos , Adolescente , Depressão/epidemiologia , Depressão/psicologia , Anedonia , Pandemias , COVID-19/epidemiologia , Ansiedade/epidemiologia , Ansiedade/psicologia , Humor IrritávelRESUMO
Skeletal muscle development is a multistep biological process regulated by a variety of myogenic regulatory factors, including MyoG, MyoD, Myf5, and Myf6 (also known as MRF4), as well as members of the FoxO subfamily. Differentiation and regeneration during skeletal muscle myogenesis contribute to the physiological function of muscles. Super enhancers (SEs) and enhancer RNAs (eRNAs) are involved in the regulation of development and diseases. Few studies have identified the roles of SEs and eRNAs in muscle development and pathophysiology. To develop approaches to enhance skeletal muscle mass and function, a more comprehensive understanding of the key processes underlying muscular diseases is needed. In this review, we summarize the roles of SEs and eRNAs in muscle development and disease through affecting of DNA methylation, FoxO subfamily, RAS-MEK signaling, chromatin modifications and accessibility, MyoD and cis regulating target genes. The summary could inform strategies to increase muscle mass and treat muscle-related diseases.
Assuntos
Músculo Esquelético , Fatores de Regulação Miogênica , Fatores de Regulação Miogênica/genética , Músculo Esquelético/fisiologia , RNA , Desenvolvimento Muscular/genética , Proteína MyoD/genética , Diferenciação Celular/genéticaRESUMO
Parkinson's disease (PD) is an age-related chronic neurodegenerative disease caused by the death and degeneration of dopaminergic neurons in the substantia nigra of the midbrain. The decrease of the neurotransmitter dopamine in the patient's brain leads to various motor symptoms. PD drugs mainly enhance dopamine levels but cannot prevent or slow down the loss of dopaminergic neurons. In addition, they exhibit significant side effects and addiction issues during long-term use. Therefore, it is particularly urgent to develop novel drugs that have fewer side effects, can improve PD symptoms, and prevent the death of dopaminergic neurons. The rhizome of Gastrodia elata Blume (Tianma) is a well-known medicinal herb and has long been used as a treatment of nervous system-related diseases in China. Several clinical studies showed that formula comprising Tianma could be used as an add-on therapy for PD patients. Pharmacological studies indicated that Tianma and its bioactive components can reduce the death of dopaminergic neurons, α-synuclein accumulation, and neuroinflammation in various PD models. In this review, we briefly summarize studies regarding the effects of Tianma and its bioactive components' effects on major PD features and explore the potential use of Tianma components for the treatment of PD.
RESUMO
Objective: To explore how a stringent campus lockdown affects the physical activity (PA), sleep and mental health of Chinese university students living in student dormitories during the COVID-19 pandemic. Methods: Data on PA, sleep and mental health were collected between 24 March and 4 April 2022 from 2084 university students (mean age = 22.4 years, 61.1% male students) via an online questionnaire distributed by the students' advisers of each dormitory. The Chinese short version of the International Physical Activity Questionnaire (IPAQ-C), Athens Insomnia Scale (CAIS) and General Health Questionnaire 12-item (GHQ-12) were applied. The Mann-Whitney test and Kruskal-Wallis tests were used to evaluate the PA profile differences between genders, before and during the lockdown period and between students' living environments. Chi-squared (χ2) or Fisher's exact test was used to assess changes in health behaviors by gender and students' living environment compared to before the lockdown. A mediation model was used to examine whether sleep disorder mediated the relationship between PA and mental health in different students' living environments. Results: Participants reported a significant decrease in weekly total PA levels (63.9%). Mean daily sedentary time increased by 21.4% and daily lying time increased by 10.7% compared to before lockdown. Among the participants, 21.2% had experienced insomnia, and 39.0% reported having high mental distress. Female students reported 10% higher rates of sleep disorders than male students (p < 0.001), and also experienced a higher incidence of mental disorders (p < 0.001). Students living with three roommates had a larger decrease in frequencies and durations of participation in light PA than other students (p < 0.001). PA was negatively associated with sleep and mental health, and sleep disorder was a mediating factor between PA and mental health in the students living with two and three roommates. Conclusion: This study showed that strict lockdowns within university dormitories during the COVID-19 pandemic had a negative effect on the health of university students by changing their health behaviors, physical activity and sleep. Our findings indicate a need for strategies to promote an active lifestyle for students in space-limited dormitories in order to maintain health during a prolonged lockdown.
RESUMO
(1) Background: Afatinib has been approved for patients with non-small cell lung cancer (NSCLC) carrying major uncommon epidermal growth factor receptor gene (EGFR) mutations. Dacomitinib, another second-generation tyrosine kinase inhibitor, has also shown promising potential for uncommon EGFR mutations. However, no comparative study has been conducted. (2) Methods: Two cohorts were employed: the AFANDA cohort, an ambispective cohort including 121 patients with uncommon EGFR mutations admitted to two tertiary hospitals in China, and an external validation afatinib cohort (ex-AC), extracted from the Afatinib Uncommon EGFR Mutations Database (N = 1140). The AFANDA cohort was divided into an afatinib cohort (AC) and a dacomitinib cohort (DC) for internal exploration. Objective response rate (ORR), progression-free survival (PFS), and adverse events (AEs) were assessed for comparison. Progression patterns and resistance mechanisms were explored. (3) Results: In total, 286 patients with advanced NSCLC carrying uncommon EGFR mutations treated with afatinib or dacomitinib were enrolled, including 79 in the AFANDA cohort (44 in the DC, 35 in the AC) and 207 in the ex-AC. In internal exploration, the ORR of the DC was significantly higher than that of the AC (60.5 vs. 26.7%, p = 0.008), but there was no significant difference in median PFS between the DC and the AC (12.0 months vs. 10.0 months, p = 0.305). Multivariate analysis confirmed an independent favorable effect of dacomitinib on PFS (hazard ratio (HR), 1.909; p = 0.047). In external validation, multivariate analysis confirmed the independent prognostic role of dacomitinib in PFS (HR, 1.953; p = 0.029). Propensity score matching analysis confirmed the superiority of dacomitinib over afatinib in terms of PFS in both univariate and multivariate analyses. Toxicity profiling analysis suggested more G1 (p = 0.006), but fewer G3 (p = 0.036) AEs in the DC than in the AC. Progression patterns revealed that the incidence of intracranial progression in the AC was significantly higher than that in the DC (50 vs. 21.1%, p = 0.002). Drug resistance analysis indicated no significant difference in the occurrence of T790M between the AC and the DC (11.8 vs. 15.4%, p = 0.772). (4) Conclusions: Compared with afatinib, dacomitinib demonstrated a more favorable activity with manageable toxicity and different progression patterns in patients with NSCLC carrying uncommon EGFR mutations.
RESUMO
Commercially wrist-worn devices often present inaccurate estimations of energy expenditure (EE), with large between-device differences. We aimed to assess the validity of the Apple Watch Series 6 (AW), Garmin FENIX 6 (GF) and Huawei Watch GT 2e (HW) in estimating EE during outdoor walking and running. Twenty young normal-weight Chinese adults concurrently wore three index devices randomly positioned at both wrists during walking at 6 km/h and running at 10 km/h for 2 km on a 400- meter track. As a criterion, EE was assessed by indirect calorimetry (COSMED K5). For walking, EE from AW and GF was significantly higher than that obtained by the K5 (p < 0.001 and 0.002, respectively), but not for HW (p = 0.491). The mean absolute percentage error (MAPE) was 19.8% for AW, 32.0% for GF, and 9.9% for HW, respectively. The limits of agreement (LoA) were 44.1, 150.1 and 48.6 kcal for AW, GF, and HW respectively. The intraclass correlation coefficient (ICC) was 0.821, 0.216 and 0.760 for AW, GF, and HW, respectively. For running, EE from AW and GF were significantly higher than the K5 (p < 0.001 and 0.001, respectively), but not for HW (p = 0.946). The MAPE was 24.4%, 21.8% and 11.9% for AW, GF and HW, respectively. LoA were 62.8, 89.4 and 65.6 kcal for AW, GF and HW, respectively. The ICC was 0.741, 0.594, and 0.698 for AW, GF and HW, respectively. The results indicate that the tested smartwatches show a moderate validity in EE estimations for outdoor walking and running.