Ionic liquid-assisted fabrication of metal-organic framework-derived indium oxide/bismuth oxyiodide p-n junction photocatalysts for robust photocatalysis against phenolic pollutants.

Constructing a p-n heterojunction is a feasible strategy to manipulate the dynamic behaviors of photogenerated carriers through an internal electric field. Herein, a novel highly efficient indium oxide/bismuth oxyiodide (In2O3/BiOI) p-n junction photocatalyst was fabricated using a facile ionic liquid-assisted precipitation method for the first time. The morphologies were modified by adding different amounts of acetic acid solution. Their hierarchical architecture was beneficial for adsorbing contaminants in wastewater, while the in-situ formed p-n heterojunction between BiOI and In2O3 facilitated interfacial charge transfer and improved the quantum efficiency. Their visible light-responsive photocatalytic activities were systematically investigated by photocatalytic o-phenylphenol (OPP) and 4-tert-butylphenol (PTBP) oxidation. The degradation rate of OPP over In2O3/BiOI-2 was up to 5.67 times higher than that for BiOI. The excellent activity of In2O3/BiOI should be attributed to the rapid interfacial charge transfer, depressed carrier recombination, and proper band potentials. Trapping experiments and electron paramagnetic resonance characterizations confirmed the generation of hydroxyl radicals (•OH) and superoxide radicals (•O2-), which have played a key role in decomposing pollutants. The intermediate products generated during the photocatalytic degradation of OPP were detected and identified by liquid chromatography-mass spectrometry. Meanwhile, their possible molecular structures and degradation pathways have also been inferred.

CdS quantum dots-decorated InOOH: Facile synthesis and excellent photocatalytic activity under visible light.

For the first time, CdS quantum dots (QDs)-decorated InOOH (CdS-In for short) was synthesized by a facile photodeposition method. The experiment results showed that CdS-In samples exhibited excellent activity and stability towards photocatalytic reduction of nitro aromatics. The conversion ratio of 4-nitroaniline (4-NA) over CdS-In sample that was prepared with photodeposition time of 120 min (CdS-In-120) reached up to 99.4% under visible light irradiation for 40 min, which was even higher than that achieved over commercial CdS (86.2%). Besides the significant enhancement of visible light absorption, quantum sized CdS were decorated evenly on the surface of InOOH, which was very beneficial for the high activity. Furthermore, the heterogeneous junction formed at the interface of CdS QDs and InOOH can significantly increase the separation efficiency of photogenerated charge carriers. Active species control experiment and electron spin resonance (ESR) technique have proved that photogenerated electrons are the main active species towards photocatalytic reduction of nitro aromatics. It is anticipated that our study would offer meaningful insights for exploring novel InOOH-based visible light photocatalysts towards efficient reduction of nitro aromatics.

Fabrication of MOF-derived tubular In2O3@SnIn4S8 hybrid: Heterojunction formation and promoted photocatalytic reduction of Cr(VI) under visible light.

Tubular In2O3@SnIn4S8 hierarchical hybrid photocatalyst was firstly fabricated by a two-step method. The morphology and composition were characterized by scanning electron microscope (SEM), X-ray photoelectron spectroscopy (XPS), and X-ray diffraction (XRD). The XRD results show that the obtained In2O3 microtubes were highly crystallized, while the SnIn4S8 flakes prepared at low temperature were poorly crystallized. The SEM image of the hybrid shows that numerous SnIn4S8 nanoflakes were assembled over the surface of In2O3 microtubes. In2O3 served as dispersing-templates have reduced the agglomeration of SnIn4S8 flakes. Meanwhile, the heterojunctions formed at the interfaces between In2O3 and SnIn4S8 could facilitate the interfacial charge transfer, as well as promote the photocatalytic activity of the hybrid. In the treatment of Cr(VI)-containing wastewater, the In2O3@SnIn4S8 hybrid not only exhibited strong adsorption ability, but also showed remarkably enhanced photocatalytic activity compared with pure SnIn4S8. The photocatalytic reaction constant k for In2O3@SnIn4S8 was approximately 2.54 times higher than that of SnIn4S8. The efficient activity of this hybrid photocatalyst should be ascribed to the promoted separation efficiency of electron/hole pairs, which was proved by the following three-dimensional excitation-emission matrix fluorescence spectra (3D EEMs), photocurrent responds, and EIS characterizations.

Photocatalytic purification of contaminated air in intensive care units by ZnSn(OH)6 nanoparticles.

The air purification in intensive care units (ICU) involving the removal of smog and volatile organic compounds (VOCs), disinfection, and sterilization are closely linked to important health issues. The environmental photocatalysis technology that could decompose gaseous pollutants into small molecular inorganic substances provides the potential solution. In a chamber of 30-m3 simulated ICU, photocatalytic purifier with ZnSn(OH)6 nanoparticles photocatalyst is set up to treat 10 VOCs with concentration below 2 ppm. Compared with regular purifiers of plasma and activated carbon, the present photocatalytic purifier can completely eliminate 10 varieties of low-concentration irritating VOCs without CO production. The continuous tests show that loading of 600 g ZnSn(OH)6 has capacity to treat large volumes of VOCs and remains high removal efficiencies up to 600-h operation. The results suggest that the photocatalytic purifier could be potentially applied for the treatment of contaminated indoor air particularly ICU. The mechanism of ZnSn(OH)6 photocatalysis is proposed to interpret the high performance and mineralization of the degradation process.

Synthesis of BiPO4 by crystallization and hydroxylation with boosted photocatalytic removal of organic pollutants in air and water.

Environmental photocatlytsis has been considered as a promising alternative strategy to address the current environmental threats and pressures. Fabrication of the photocatalysts with high efficiency, stability and bio-safety is the core of photocatalytic applications. Herein, we report a facile approach to synthesize monazite BiPO4 (SHTW) with high crystallization and hydroxylation. The wide bandgap of the SHTW can provide strong redox abilities to produce reactive species and mineralize organic pollutants. Its high crystallinity and dipole moment can promote separation and transportation of the photoexcited electron-hole pairs effectively. In addition, the hydroxylation can produce more highly oxidizing hydroxyl radicals and further improve charge carrier separation. Notably, the hydroxylation can be reborn and the high crystallization can be maintained during photocatalysis. Thus, a virtuous cycle can be established and organic pollutants can be removed efficiently. The mineralization rate of 146.1 µmol g-1 h-1 can be obtained on the SHTW for photocatalytic degradation of benzene, which is about 8.5 times higher than that of the commercial TiO2 (P25). Various dyes, dyes mixture and bisphenol A can all be completely degraded over the SHTW. It shows the potential application and value in environmental governance.

New insight into an efficient visible light-driven photocatalytic organic transformation over CdS/TiO2 photocatalysts.

Selective transformation of organics by visible-light-driven photocatalysis has been considered as a green and efficient strategy for the synthesis of fine chemicals. Herein, we fabricated mesoporous structured TiO2 with CdS nanoparticles successfully by a photodeposition method. The photocatalytic selective oxidation of benzyl alcohols and reduction of 4-nitroaniline were demonstrated over the as-prepared samples under visible-light irradiation. The CdS-decorated TiO2 with the photodeposition time of 90 min exhibited highest activity, which was higher than that of the commercial CdS, bare TiO2, CdS/P25, and CdS/SiO2. Further experimental results indicated that the higher performance was attributed to the moderate deposition of CdS forming a closely connected heterojunction with TiO2, which promoted the separation of photogenerated electrons and holes. Based on the results of active species detection, possible mechanisms for photocatalytic selective oxidation of benzyl alcohol and reduction of 4-nitroaniline were proposed. Our study may provide guidance for selective transformation of organics via construction of heterojunction photocatalysts.

Efficient light harvesting over a CdS/In2O3 photonic crystal photocatalyst for hydrogenation of 4-nitroaniline to p-phenylenediamine.

Efficient light harvesting was observed over CdS photodeposited on In2O3 photonic crystals during the photocatalytic hydrogenation of 4-nitroaniline to p-phenylenediamine. The highest conversion of 4-nitroaniline and selectivity of p-phenylenediamine over the In2O3 photonic crystal supported CdS were ∼93% and ∼99%, respectively, which were better than that achieved for commercial hexagonal CdS. The existence of the photonic crystal structure was responsible for the higher efficiency of In2O3 photonic crystal supported CdS. The ordered structure facilitated the mass transport. The elaborate tuning of the photonic band gap activated the slow photon enhancement effect on the blue edge for intensifying the light harvesting efficiency of CdS. Moreover, CdS supported on In2O3 photonic crystals exhibited higher photocatalytic stability than that on the In2O3 nanocrystals. The mechanism of photocatalytic hydrogenation over In2O3 photonic crystal supported CdS was discussed. Our results provided guidance for efficiently utilizing light for photocatalysis by applying photonic crystals as support.

Temperature-induced phase changes in bismuth oxides and efficient photodegradation of phenol and p-chlorophenol.

A novel, simple and efficient approach for photodegrading phenol and p-chlorophenol, based on BixOy, was reported for the first time. Monoclinic Bi2O4 was prepared by the hydrothermal treatment of NaBiO3·2H2O. A series of interesting phase transitions happened and various bismuth oxides (Bi4O7, ß-Bi2O3 and α-Bi2O3) were obtained by sintering Bi2O4 at different temperatures. The results demonstrated that the Bi2O4 and Bi4O7 phase had strong abilities towards the oxidative decomposition of phenol and p-chlorophenol and very high rates of TOC removal were observed. The characterization by XRD and XPS revealed that Bi(4+) in Bi2O4 and Bi(3.5+) in Bi4O7 were reduced to Bi(3+) during the reaction process. Singlet oxygen ((1)O2) was identified as the major reactive species generated by Bi2O4 and Bi4O7 for the photodegradation of p-chlorophenol and phenol. This novel approach could be used as a highly efficient and green technology for treating wastewaters contaminated by high concentrations of phenol and chlorophenols.

Immobilized Silver Nanoparticles on Chitosan with Special Surface State-Enhanced Antimicrobial Efficacy and Reduced Cytotoxicity.

Immobilized chitosan-Ag nanoparticles (CTS-Ag NPs) with special surface state have been synthesized successfully through immobilizing Ag NPs on the amino-enriched surface of CTS by reducing Ag (I) in situ. The antimicrobial efficiency and potency of CTS-Ag NPs against Escherichia coli and Staphylococcus aureus were studied. Our results reveal that surface-immobilized CTS-Ag NPs show better antimicrobial efficacy than several other reported monodisperse colloidal Ag NPs, because the unique surface state of our CTS-Ag NPs leads to both "contact killing" and "ion mediated killing" functions. Due to the synergetic effect of CTS and Ag NPs, the immobilized CTS-Ag NPs present a broader antimicrobial spectrum and a more effective antifungal activity against Monilia albican. In addition, CTS as an environment friendly dispersant can help to reduce the cytotoxicity of Ag NPs on higher organisms. The immobilized CTS-Ag NPs are stable and can maintain good disinfection potential after 6 months' shelf-time.

Relationship between surface hydroxyl groups and liquid-phase photocatalytic activity of titanium dioxide.

Both theories and experiments show that surface hydroxyl radicals (OH) are the most important intermediate species in the photocatalytic process. As a source of OH, surface hydroxyl (OH) groups play an important role in its generation. In this paper, the OH groups were divided into surface acidic hydroxyl (OH(a)) and surface basic hydroxyl (OH(b)) groups. From the detection by a method of surface acid-base, ion-exchange reactions, the total surface density of OH groups was about 9.58×10(-5) mol m(-2). The results measured by Fourier transform infrared spectroscopy, (1)H magnetic-angle spinning NMR and electron spin resonance techniques demonstrated that the role of OH(a) groups was greater than that of OH(b) groups on the generation of OH radicals. By degradation of methyl orange, rhodamine B and p-chlorophenol, the photocatalytic activities of the catalysts were directly influenced by the amount of OH groups.

TiO2 nanotube array-graphene-CdS quantum dots composite film in Z-scheme with enhanced photoactivity and photostability.

The most efficient solar energy utilization is achieved in natural photosynthesis through elaborate cell membrane with many types of molecules ingeniously transferring photogenerated electrons to reactants in a manner similar to the so-called Z-scheme mechanism. However, artificial photosynthetic systems based on semiconductor nanoparticles are inevitably accompanied by undesired non-Z-scheme electron transfer and back reactions, which adversely affect the photoactivity and photostability of the systems. Herein, we report on a novel Z-scheme system with an electrochemically converted graphene (GR) film as the electron mediator interlayer contacted with both TiO2 nanotube (TNT) array and CdS quantum dots (CdS QDs) on two sides. The obtained TiO2 nanotube array-graphene-CdS quantum dots (TNT-GR-CdS) composite film shows higher photoelectric response and photocatalytic activities than other bare TNT, TNT-CdS, TNT-GR, and TNT-CdS-GR. Moreover, compared to TNT-CdS, the activity stability is significantly improved, and the residual amount of Cd element in reaction solution is reduced ∼8 times over TNT-GR-CdS. Various measurements of photoelectrochemistry and radicals reveal that the enhanced photoactivity and photostabilities of TNT-GR-CdS are due to the efficient spatial separation of the photogenerated electron-hole pairs and the restricted photocorrosion of CdS via an efficient Z-scheme mechanism under simulated sunlight.

Photoelectrocatalytic degradation of rhodamine B on TiO2 photonic crystals.

As the inverse-opal structure facilitates the separation of electron-hole pairs and electron transfer, it may generate many radical species with strong oxidation capability. When a low bias voltage was applied on the TiO2 electrodes with inverse-opal structure, they exhibited more excellent photoelectrochemical properties and photoelectrocatalytic activity than TiO2 film under simulated solar light irradiation. When different types of active species scavengers were added, the different performances of TiO2 photonic crystals in rhodamine B degradation showed that besides ˙OH and holes, which were the main active species in the photocatalysis, O2˙(-) played a vital role in the photoelectrocatalytic degradation process. Furthermore, the stronger signal of ˙OH-trapping photoluminescence and the variation in the concentration of nitroblue tetrazolium reflected that more ˙OH and O2˙(-) could be generated in the photoelectrocatalysis than that in the photocatalysis, and O2˙(-) was partially obtained from the cathode surface. At last, the roles active species played in the photoelectrocatalytic and photocatalytic processes were compared, and the possible degradation mechanisms of TiO2 photonic crystals in photoelectrocatalytic and photocatalytic systems were put forward, which could provide a good insight into the mechanism of photoelectrocatalytic degradation on TiO2 photonic crystals.

A facile solvothermal method to produce ZnS quantum dots-decorated graphene nanosheets with superior photoactivity.

Zinc sulfide-graphene (ZnS-GR) nanocomposites with a high degree of dispersion and high coverage of ZnS quantum dots (QDs) have been synthesized by a facile solvothermal method without any dispersant, during which the formation of ZnS nanoparticles and the reduction of graphene oxide (GO) occur simultaneously. ZnS-GR nanocomposites exhibit much higher photoactivity than nanoparticle crystal ZnS (NPC-ZnS) prepared in the absence of graphene (GR), as evaluated by degradation of methylene blue (MB) in the liquid phase under ultraviolet (UV) light. Among them, the ZnS-GR nanocomposite with a 5% mass fraction of GR prepared at 120 ° C has the highest photocatalytic activity. The conversion and mineralization over MB are 96.7% and 57.1% respectively, which is much higher than that of NPC-ZnS. The high photoactivity of ZnS-GR nanocomposites can be ascribed to the integrated effect of an extremely high specific surface area and the excellent electron conductivity of GR and its significant influence on the morphology and structure of the samples. Moreover, it is found that the oxidation of MB is driven mainly by the participation of .OH radicals. Accordingly, a potential photocatalytic mechanism of ZnS-GR nanocomposites in the photocatalytic process has been proposed in this work. It is expected that our work could provide valuable information on the design of metal sulfide decorated GR with excellent properties.

Structuring ß-Ga2O3 photonic crystal photocatalyst for efficient degradation of organic pollutants.

Coupling photocatalysts with photonic crystals structure is based on the unique property of photonic crystals in confining, controlling, and manipulating the incident photons. This combination enhances the light absorption in photocatalysts and thus greatly improves their photocatalytic performance. In this study, Ga2O3 photonic crystals with well-arranged skeleton structures were prepared via a dip-coating infiltration method. The positions of the electronic band absorption for Ga2O3 photonic crystals could be made to locate on the red edge, on the blue edge, and away from the edge of their photonic band gaps by changing the pore sizes of the samples, respectively. Particularly, the electronic band absorption of the Ga2O3 photonic crystal with a pore size of 135 nm was enhanced more than other samples by making it locate on the red edge of its photonic band gap, which was confirmed by the higher instantaneous photocurrent and photocatalytic activity for the degradation of various organic pollutants under ultraviolet light irradiation. Furthermore, the degradation mechanism over Ga2O3 photonic crystals was discussed. The design of Ga2O3 photonic crystals presents a prospective application of photonic crystals in photocatalysis to address light harvesting and quantum efficiency problems through manipulating photons or constructing photonic crystal structure as groundwork.

Sensitive Marker of the Cisplatin-DNA Interaction: X-Ray Photoelectron Spectroscopy of CL.

The development of cisplatin and Pt-based analogues anticancer agents requires knowledge concerning the molecular mechanisms of interaction between such drugs with DNA. However, the binding dynamics and kinetics of cisplatin reactions with DNA determined by traditional approaches are far from satisfactory. In this study, a typical 20-base oligonucleotide (CGTGACAGTTATTGCAGGCG), as a simplified model representing DNA, was mixed with cisplatin in different molar ratios and incubation time. High-resolution XPS spectra of the core elements C, N, O, P, and Cl were recorded to explore the interaction between cisplatin and DNA. From deconvoluted Cl spectra we could readily differentiate the covalently bound chlorine from ionic chloride species in the cisplatin-oligo complexes, which displayed distinct features at various reaction times and ratios. Monitoring the magnitude and energy of the photoelectron Cl 2p signal by XPS could act as a sensitive marker to probe the interaction dynamics of chemical bonds in the reaction of cisplatin with DNA. At 37°C, the optimum incubation time to obtain a stable cisplatin-oligo complex lies around 20 hrs. This novel analysis technique could have valuable implications to understand the fundamental mechanism of cisplatin cytotoxicity and determine the efficiency of the bonds in treated cancer cells.

Novel approach to enhance photosensitized degradation of rhodamine B under visible light irradiation by the ZnxCd1-xS/TiO2 nanocomposites.

In order to exploit efficient photosensitizers with appropriate electronic states to enhance the transfer of electrons, ZnxCd1-xS/TiO2 nanocomposites were first synthesized by a simple hydrothermal method. The samples were characterized by X-ray diffraction, transmission electron microscopy, diffuse reflectance spectroscopy, X-ray photoelectron spectroscopy, electron spin resonance, and photoluminescence techniques. The results showed that the composite of the two inorganic semiconductors largely enhanced the photosensitized degradation of rhodamine B (RhB) under visible light irradiation (420 nm<λ<800 nm). These photocatalytic reactions were driven mainly by the light absorption of RhB molecules and to a lesser extent by the excitation of ZnxCd1-xS. They were supposed to arise mainly from the electron transferred from the adsorbed dye in its singlet excited state to the conduction band of ZnxCd1-xS and TiO2. Such a heterogeneous photocatalytic reaction has much significance in the degradation of organic pollutants in ordinary photocatalysis.

Rapid microwave hydrothermal synthesis of GaOOH nanorods with photocatalytic activity toward aromatic compounds.

GaOOH nanorods were synthesized from Ga(NO(3))(3) via a facile microwave hydrothermal method. The obtained sample was characterized by x-ray diffraction, N(2) sorption-desorption, UV-vis diffuse reflectance spectroscopy, transmission electron microscopy, electron spin resonance, and x-ray photoelectron spectroscopy. The results revealed that the as-synthesized sample was consisted of rod-like particles. It possessed a surface area of 14.3 m(2) g(-1), and a band gap of 4.75 eV. The photocatalytic property of GaOOH nanorods was evaluated by the degradation of aromatic compounds (such as benzene and toluene) in an O(2) gas stream under ultraviolet (UV) light illumination. The results demonstrated that GaOOH nanorods exhibited superior photocatalytic activity and stability as compared to commercial TiO(2) (P25, Degussa Co.) in both benzene and toluene degradation. In the extended (35 h) reaction test toward benzene, GaOOH maintained a high activity, and no obvious deactivation was observed. A possible mechanism of the photocatalysis over GaOOH is proposed.

Microwave hydrothermal synthesis of calcium antimony oxide hydroxide with high photocatalytic activity toward benzene.

A nanocrystalline CaSb2O5(OH)2 photocatalyst synthesized from CaCl2 and K2H2Sb2O7 was used to degrade benzene in the gas phase for the first time. The obtained sample was characterized by X-ray diffraction, N2 sorption-desorption, UV-vis diffuse reflectance spectroscopy, transmission electron microscopy, electron spin resonance, and X-ray photoelectron spectroscopy. The CaSb2O5(OH)2 sample had an average particle size of approximately 8 nm, a specific surface area of 101.8 m2 g(-1), and a band gap of 4.6 eV. Photocatalytic activity of the sample was mainly evaluated by the degradation of benzene in an O2 gas stream under ultraviolet light irradiation. The results demonstrated that the photoactivity of CaSb2O5(OH)2 was higher than that of commercial TiO2 (P25, Degussa Co.). In the photocatalytic degradation of benzene, it finally reached a steady conversion ratio of 29%. CaSb2O5(OH)2 has also exhibited activity toward other aromatic organic compounds. A possible mechanism of photocatalysis over CaSb2O5(OH)2 nanocrystals was proposed.

Efficient degradation of benzene over LaVO4/TiO2 nanocrystalline heterojunction photocatalyst under visible light irradiation.

A nanocrystal heterojunction LaVO4TiO2 visible light photocatalyst has been successfully prepared by a simple coupled method. The catalyst was characterized by powder X-ray diffraction, nitrogen adsorption-desorption, transmission electron microscopy, UV-vis diffuse reflectance spectroscopy, X-ray photoelectron spectra, photoluminescence, and electrochemistry technology.The results showed that the prepared nanocomposite catalysts exhibited strong photocatalytic activity for decomposition of benzene under visible light irradiation with high photochemical stability. The enhanced photocatalytic performance of LaVO4/TiO2 may be attributed to not only the matched band potentials but also interconnected heterojunction of LaVO4 and TiO2 nanoparticles.

Study on the photodegradation and microbiological degradation of pirimicarb insecticide by using liquid chromatography coupled with ion-trap mass spectrometry.

The intermediates of photodegradation and microbial degradation of pirimicarb insecticide were investigated by liquid chromatography coupled with ion-trap mass spectrometry (LC-IT-MS). Different intermediates were detected in the photodegradation and microbial degradation of pirimicarb. In the photodegradation of pirimicarb in aqueous solution 2-dimethylamino-5,6-dimethyl-4-hydroxypyrimidine (MW=167), 2-methylamino-5,6-dimethylpyrimidin-4-yl-dimethylcarbamate (MW=224) and 2-formylamino-5,6-dimethylpyrimidin-4-yl-dimethylcarbamate (MW=252) were the main products. It was found that 2-dimethylamino-5,6-dimethyl-4-hydroxypyrimidine (MW=167) was the major product in the microbial degradation of pirimicarb in soil.