RESUMO
Covalent triazine frameworks (CTFs) with tunable structure, fine molecular design and low cost have been regarded as a class of ideal electrode materials for lithium-ion batteries (LIBs). However, the tightly layered structure possessed by the CTFs leads to partial hiding of the redox active site, resulting in their unsatisfactory electrochemical performance. Herein, two CTFs (BDMI-CTF and TCNQ-CTF) with higher degree of structural distortion, more active sites exposed, and large lattice pores were prepared by dynamic trimerization reaction of cyano. As a result, BDMI-CTF as a cathode material for LIBs exhibits high initial capacity of 186.5 mAh/g at 50 mA g-1 and superior cycling stability without capacity loss after 2000 cycles at 1000 mA g-1 compared with TCNQ-CTF counterparts. Furthermore, based on their bipolar functionality, BDMI-CTF can be used as both cathode and anode materials for symmetric all-organic batteries (SAOBs), and this work will open a new window for the rational design of high performance CTF-based LIBs.
RESUMO
Based on the long bud stage phenotype of a new Lonicera japonica Flos variety "Huajin 6", using "Huajin 6" and "Da Mao Hua" as materials, probing the mechanism of its phenotype formation. Detection of endogenous Jasmonic acid hormones (JAs) content; the genes related to jasmonic acid (JA) synthesis were identified by transcriptome analysis of Lonicera japonica; flower buds and flowers of "Huajin 6" and "Da Mao Hua" were collected at different periods, and the qRT-PCR (quantitative real-time PCR) technique was used to analyze the trend of the expression of synthesis-related enzyme genes in Lonicera japonica Flos during the bud stage. The study found that the content of JAs in "Huajin 6" Lonicera japonica Flos was significantly lower than that in "Da Mao Hua"; applying exogenous methyl-jasmonate (MeJA) to "Huajin 6" can restore its flowering phenotype, making it close to wild type Lonicera japonica Flos; there are significant differences in the expression of two allene oxide synthase genes (AOS), three lipoxygenase genes (LOX), and two allene oxide cyclase genes (AOC) in the flowers and buds of "Huajin 6" and "Da Mao Hua" at different periods. It is hypothesized that the low expression of JA synthesis-related enzyme genes in " Huajin 6" leads to the blockage of JA synthesis, which causes the formation of the long bud phenotype. This study laid a certain foundation for the genetic breeding of Lonicera japonica, provided a new idea for the improvement of Lonicera japonica varieties, and provided a reference for the study of JAs in plant flower organs.
RESUMO
INTRODUCTION AND OBJECTIVES: Pulmonary vein isolation (PVI) technique has become the cornerstone of atrial fibrillation (AF) catheter ablation. The objective of this study was to assess the efficacy and safety of extended antrum ablation based on electrophysiological substrate mapping plus PVI in AF patients who underwent cryoballoon ablation. METHODS: In this observational study, a total of 121 paroxysmal AF patients and 80 persistent AF patients who did not achieve the procedure endpoint after cryoballoon ablation received extra extended antrum ablation (EAA) based on electrophysiological substrate mapping via radiofrequency ablation (EAA group). As a control group (PVI group), among paroxysmal AF and persistent AF patients, we conducted a propensity score-matched cohort, in whom only PVI was completed. RESULTS: The average follow-up time was 15.27±7.34 months. Compared with PVI group, paroxysmal AF patients in the EAA group had a significantly higher rate of AF-free survival (90.1% vs. 80.2%, p=0.027) and AF, atrial flutter, or atrial tachycardia (AFLAT) -free rate survival (89.3% vs. 79.3%, p=0.031). Persistent AF patients in the EAA group also had a significantly higher rate of AF-free survival (90.0% vs. 75.0%, p=0.016) and AFLAT-free survival (88.8% vs. 75.0%, p=0.029) than PVI group. Complication rates did not significantly differ between both groups, in either paroxysmal AF or persistent AF patients. CONCLUSION: Our findings demonstrate that extra extended antrum ablation based on electrophysiological substrate mapping is effective and safe. Moreover, the strategy can improve the outcome of AF cryoablation.
RESUMO
Salvia plebeia has been in use as traditional Chinese medicine (TCM) for more than 500 years. In this study, the complete chloroplast (cp) genome of S. plebeia was sequenced, assembled and compared to those of other five published Salvia cp genomes. It was found that the cp genome structure of S. plebeia was well conserved and had a total size of 151 062 bp. Four parameters were used to display the usage conditions of the codons of the amino acids in Salvia genus. Although the number of protein-coding genes in each species was the same, the total number of codons was different. Except for amino acids Trp and Met whose Relative Synonymous Codon Usage (RSCU) value of one condon was equal to 1, the remaining 19 amino acids had 1-3 preferred codons. The preferred codon names of each amino acid were coincident. The period size for the tandem repeats of six species ranged from 9 to 410 bp. Salvia cp genomes mainly possessed tandem repeats with a copy number less than or equal to 3. The sequence length of tandem repeats of the six species ranged from 25 to 824 bp. Highly viarable regions including four intergenic spacers and six partial genes were discovered as potential specific barcodes for Salvia species through cp genome-wide comparison. Finally, we performed phylogenetic analyses based on the complete cp genome and coding sequences respectively. These results provide information to help construct the cp genome library for Salvia, which may support studies of phylogenetics, DNA barcoding, population and transplastomics.
RESUMO
OBJECTIVE@#To study the single nucleotide polymorphisms (SNPs) in promoter region of the Jk gene and its allele frequency as well as distribution characteristics in the Chinese Han nationality population.@*METHODS@#127 blood samples containing 8 Jk(a-b-) and 119 samples (as control) taken randomly from voluntary blood donors of Chinese Han nationality persons in Shenzhen Blood Center were collected. The Kidd phenotypes were identified by using the serologic test and urea hemolysis test; the Jk promoter, exon 1-11 region and respective flanking area were amplified and sequenced, then the sequence information was analyzed.@*RESULTS@#8 Jk(a-b-) samples all carried JkB/JkB allele which belongs to 2 kind of Jk genotypes commonly observed in Chinese Han nationality population. 6 IVS5-1g>a and 2 896G>A were found in 8 Jk(a-b-) samples. Besides, all Jk(a-b-) samples were homozygous for JkB/JkB allele. Three SNPs-110(rs900974), -160(rs1484877) and -258(rs1484878) in promoter region of the Jk gene were found and sequenceds calculation of allele and genotype frequencies showed that the result accorded with Hardy-Weinberg equilibrium, indicating that the population in this study possesses representative characteristics of the Chinese Han nationality population.@*CONCLUSION@#The polymorphism of the Jk gene occurs in promoter region. This study calculates the allele frequencies of three SNPs-110(rs900974), -160(rs1484877) and -258(rs1484878) in promoter region of the Jk gene, and shows their distribution characteristics in distinct Kidd phenotypes. These findings provide the basic foundation for further population genetics research.
RESUMO
Objective:To study the chemical constituents in 95%ethanol extract of the whole plant of Camptosorus sibiricus and determine its antioxidant activity. Method:Compounds were isolated by a combination of various chromato-graphic techniques, including column chromatography over silica gel and Sephadex LH-20 and reversed-phase HPLC. Their structures were identified on the basis of physicochemical properties and spectral data reported in the literature. Result:Eleven compounds were identified as trans-p-coumaric acid (1),trans-p-coumaric acid 4-O-β-D-glucoside (2),cis-p-coumaric acid 4-O-β-D-glucoside (3),(E)-ferulic acid-4-O-β-D-glucoside (4),caffeic acid methyl ester (5),ferulic acid methyl ester (6),syringic acid (7),syringic acid-4-O-β-D-glucopyranoside (8),protocatechualdehyde (9),vanillain (10) and syringaldehyde (11),respectively. Conclusion:Compounds 3-11 are isolated from the genus Camptosorus for the first time. In the in vitro SOD-like activity assays,compounds 7,9-11 show an antioxidant activity with half maximal inhibitory concentration(IC50)values of 16.70,11.70,12.23 and 13.52 μmol·L-1,respectively.
RESUMO
Objective To investigate the effects of transcription factor 2(TCF2) overexpression on insulin resistance in HepG2 cells. Methods HepG2 cells were treated with high concentration of insulin(1×10-8mol/L) for 24 hours to induce insulin resistance (IR). Cells were divided into four groups:control group,IR group,IR+vector group and IR+TCF2 overexpression group. RT-qPCR and Western blot were performed to detect the expres-sion of TCF2. Glucose consumption and glycogen synthesis were assayed by glucose oxidase method and anthrone method respectively. Cell viability was evaluated by MTT assay. The activities of hexokinase and pyruvate kinase were detected by colorimetry. The protein level of IRS-1 and GLUT4 was detected by Western blot.Results Com-pared with control group,the decreased glucose consumption was observed in IR group(P<0.05),indicating that insulin-resistance model was established successfully. The mRNA and protein expression of TCF2 was remarkably down-regulated in IR group as compared with control group. Compared with IR group,overexpression of TCF2 sig-nificantly improved glucose consumption, liver glycogen content, and the activities of hexokinase and pyruvate kinase (P<0.05). Moreover,TCF2 overexpression up-regulated the protein expression of IRS-1 and GLUT4 (P<0.05).Conclusions TCF2 overexpression ameliorates insulin resistance of HepG2 cells.
RESUMO
<p><b>OBJECTIVE</b>To establish a method for determination of glycosyltransferase and to explore the enzyme A, B glycosyltransferase activity in human serum so as to lay the foundation for the determination of enzyme level and enzyme activity.</p><p><b>METHODS</b>The glycosyltransferase activity kit was used to draw phosphate standard curves in our laboratory. The A and B glycosyltransferase activity were determined by the standard curves.</p><p><b>RESULTS</b>The standard curves (y=2671.3x-0.596 R=0.9998) for determing glycosyltransferase activity suitable for use in our laboratory were drawn. At the same time the method was set up for determination of A, B glycosyltransferase in human serum.</p><p><b>CONCLUSION</b>The establised method of the determination of glycosyltransferase is suitable for common type of enzyme activity and suitable for the A, B glycosyltransferase in human serum.</p>
RESUMO
This study was purposed to investigate the molecular polymorphism of gypa gene in association with MN human blood group in Chinese Han population. The MN phenotypes of 202 random samples from unrelated Chinese Han volunteers were identified by serology techniques. The primer for gypa gene exon 2 were designed and synthesized according to reference sequences of NG-007470 gene from GenBank, the DNA of 202 samples was amplified by PCR, at the same time, the amplified products were analyzed by direct DNA sequencing. The results showed that all samples had 2 base substitutions at 1st and 56th nt of gypa exon 2, among them the MN phenotype heterozygote exited mainly in the form of 1A > C, 22T/C, 34A/G, 35T/G, 56T > C; the MM phenotype homozygote exited mainly in the form of 1A > C, 22C, 34G, 35T, 56T > C; the NN phenotype homozygote exited mainly in the form of 1A > C, 22T, 34A, 35G, 56T > C. It is concluded that the polymorphism of gypa gene in associated with MN blood group in Chinese Han population is decided by 5 nucleotide sites of 1, 22, 34, 35 and 56. The bases of 1 and 56 are non-functional gypa single nucleotide polymorphism.
Assuntos
Humanos , Povo Asiático , Genética , Sequência de Bases , Éxons , Genótipo , Glicoforinas , Genética , Sistema do Grupo Sanguíneo MNSs , Genética , Dados de Sequência Molecular , Polimorfismo Genético , Análise de Sequência de DNARESUMO
<p><b>OBJECTIVE</b>To compare the therapeutic effect and toxicity of chemotherapy, used alone or in combined with Shenqi Fuzheng Injection (SFI), for the treatment of advanced colorectal carcinoma (ACRC).</p><p><b>METHODS</b>One hundred and fifty-two patients with ACRC were equally randomized by digital table, to the treated group, treated by chemotherapy of FOLFOX regimen combined with SFI, and the control group treated by FOLFOX regimen alone. The therapeutic effect and adverse reaction of the treatment in patients were assessed.</p><p><b>RESULTS</b>The effective rate (CR +PR) was 63.2% (48/76) in the treated group and 46.1% (35/76) in the control group, showing significant difference between the two groups (P < 0.05). The median survival time in the two groups was 31 weeks and 28 weeks respectively. CD4/CD8 ratio was significantly increased in the treated group (1.56 +/- 0.21, 1.64 +/- 0.28, P < 0.05), but significantly decreased in the control group (1.58 +/- 0.22, 1.46 +/- 0.33, P < 0.01). Quality of life in the former group was higher than that in the latter group (P < 0.05). Times/case of nausea, vomiting, leukopenia occurring in the control group was more than those in the treated group A (P < 0.05).</p><p><b>CONCLUSION</b>By combining with SFI, some adverse reactions of chemotherapy (such as nausea, vomiting, leukopenia) and its influence on patients' immunity could be alleviated in treating ACRC, which might enhance the efficacy of chemotherapy, and improve the quality of life and prolong the median survival time in patients.</p>
Assuntos
Humanos , Protocolos de Quimioterapia Combinada Antineoplásica , Usos Terapêuticos , Neoplasias Colorretais , Tratamento Farmacológico , Medicamentos de Ervas Chinesas , Usos Terapêuticos , Fluoruracila , Usos Terapêuticos , Leucovorina , Usos Terapêuticos , Compostos Organoplatínicos , Usos Terapêuticos , Qualidade de Vida , Taxa de SobrevidaRESUMO
In order to elucidate the expression and molecular genetic background of ABO gene seven samples with ABO discrepancy further identified as bi-specific ABO gene were studied. All these samples were subjected to phenotyping by monoclonal and polyclonal antisera and were then genotyped by direct DNA sequencing and haplotype-sequencing at the exon 6 and 7 of ABO gene. As a result, six ABO dual-specific alleles were identified in Chinese population. An antigen expressed by these B (A) or Cis-AB individuals varied from very low level to the normal level, compared with common A blood group samples. In conclusion, molecular genetic backgrounds of two pairs out of four samples in all samples were the same, however, the ABO expression showed diverse.
Assuntos
Humanos , Sistema ABO de Grupos Sanguíneos , Genética , Povo Asiático , Genética , Análise Mutacional de DNA , Eritrócitos , Biologia Celular , Metabolismo , Éxons , Genética , Glicosiltransferases , Química , GenéticaRESUMO
In order to study the polymorphism of Landsteiner-Wiener (LW) blood group gene in Chinese population, peripheral blood samples anticoagulated with EDTA from 160 unrelated volunteer blood donors were randomly collected, and genomic DNA were extracted. 160 DNA samples were analyzed for exon 1 of LW gene by direct DNA sequencing, and detected for LWa/LWb allele by improved PCR-SSP genotyping. The results showed that all LW allele in 160 donors were LWa homozygous, and the LWa allele occurred commonly. In conclusion, LWa allele occurs with incidence of 100% of donors in this study, while LWb allele has not been found in Chinese population.
Assuntos
Humanos , Alelos , Povo Asiático , Genética , Doadores de Sangue , Antígenos de Grupos Sanguíneos , Genética , Moléculas de Adesão Celular , Genética , Éxons , Genética , Homozigoto , Polimorfismo Genético , Análise de Sequência de DNARESUMO
<p><b>OBJECTIVE</b>To study the expression of vascular endothelial growth factor (VEGF) and metastin in colorectal carcinoma and their association with the clinicopathological features of the malignancy.</p><p><b>METHODS</b>VEGF and metastin expressions were examined immunohistochemically with SP method in 70 specimens of human colorectal carcinoma tissues and adjacent normal tissues.</p><p><b>RESULTS</b>VEGF protein overexpression was detected in 48.6% (34/70)of the colorectal carcinoma tissues but in none of the adjacent normal tissues (P<0.01), and for metastin, the overexpression rate was 28.6% (20/70) in the colorectal carcinoma tissues and 70.0% (49/70) in the normal tissues (P<0.01). The expression of both VEGF and metastin was related to the histological grades, infiltration depth, TNM stage and lymph node metastasis of the tumor (P<0.01 and P<0.05, respectively).</p><p><b>CONCLUSION</b>Immunohistochemical detection of VEGF and metastin can be of value in assessment of the malignancy and in prognostic evaluation of colorectal carcinoma.</p>
Assuntos
Adulto , Idoso , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Adulto Jovem , Neoplasias Colorretais , Genética , Metabolismo , Patologia , Regulação Neoplásica da Expressão Gênica , Kisspeptinas , Metástase Linfática , Estadiamento de Neoplasias , Proteínas Supressoras de Tumor , Genética , Metabolismo , Fator A de Crescimento do Endotélio Vascular , Genética , MetabolismoRESUMO
<p><b>OBJECTIVE</b>Molecular genetic analysis of FUT1 and FUT2 gene was performed for seven Chinese Han individuals serologically typed as para-Bombay.</p><p><b>METHODS</b>Seven DNA samples were studied by polymerase chain reaction and then by direct sequencing. Molecular cloning sequencing was done for an individual with a novel FUT1 allele. Family segregation analysis of the novel FUT1 allele was done to explore whether the allele was responsible for the fucosyltransferase defects of H.</p><p><b>RESULTS</b>The FUT1 genotypes of seven para-Bombay individuals were h1h1 (four individuals), h2h2 (two individuals), h328hnew (one individual), alleles h1 lost one of the three AG repeats located at the nucleotides 547-552 of the FUT1 gene, h2 lost two of the three T repeats located at the nucleotides 880-882, h328 (nt328G>A) was a missense mutation, all of them were known mutations, while allele hnew deleted GGTATTCCGCATCACCCTGCCCGTGCTGGCCCC at nt360-400, total 33 bases, and the frame-shift mutation was not previously reported. The segregation of the hnew allele in his family showed that his father genotype was Hh328, and his mother was Hhnew, while two brother were h328hnew. The FUT2 genotypes of seven para-Bombay individuals were Se357 Se357 (three individuals), Se357 Se357,385 (three individuals), Se357,716Se357,716(one individual), the functional Se357(nt357C>T), Se716(nt716G>A) and the weakly functional Se385(nt385A>T) were known. The seven para-Bombay individuals carried at least one copy of a functional FUT2 allele was consistent with their secretor status.</p><p><b>CONCLUSION</b>A novel FUT1 allele was identified in a para-Bombay Chinese individual, which was responsible for the inactivation of the FUT1-encoded enzyme activity.</p>
Assuntos
Humanos , Alelos , Povo Asiático , Genética , Sequência de Bases , Etnicidade , Genética , Fucosiltransferases , Genética , Genótipo , Linhagem , Fenótipo , Reação em Cadeia da Polimerase , Análise de Sequência de DNA , Testes SorológicosRESUMO
In order to study the genetic status of a rare chimeric family, some samples of A(3)B(3) family were identified by sequencing of ABO gene; flow-rSSO and PCR-SSP were used to detect loci of HLA-A, B, DRB1 genes, and multiplex amplifying with fluorescence-dye were performed for 16 short tandem repeat (STR) loci. The results indicated that two individuals from A(3)B(3) family contained more than two alleles at ABO gene, HLA-B, DRB1 and some STR loci. In conclusion, analysis of chimeric blood group by using genotyping techniques clearly demonstrating genetic status of this rare chimeric blood group promotes further elucidation of the existing state of specific genetic status.
Assuntos
Adulto , Feminino , Humanos , Masculino , Sistema ABO de Grupos Sanguíneos , Genética , Alergia e Imunologia , Quimerismo , Genótipo , Antígenos HLA-A , Genética , Antígenos HLA-B , Genética , Antígenos HLA-DR , Genética , Cadeias HLA-DRB1 , Linhagem , Polimorfismo Genético , Sequências de Repetição em Tandem , GenéticaRESUMO
<p><b>OBJECTIVE</b>To study the distribution of ABO gene polymorphism in Uighur population in Xinjiang area of China.</p><p><b>METHODS</b>DNA was extracted from 160 Uygur unrelated donorso blood and PCR-sequence specific primer analysis was performed. Some difficult samples were further directly sequenced.</p><p><b>RESULTS</b>Six alleles were detected in a population of 160 Uighur individuals, the gene frequencies of which were 0.2062(A101), 0.0563(A102), 0.0156(A201), 0.0031(A205),0.1875(B01),0.5312(O01), respectively.</p><p><b>CONCLUSION</b>The characteristics for AB gene structure of Xinjiang Uighur suggests that genetic polymorphism is distinguished between Xinjiang Uighur nationality and Chinese Han nationality, and both of them have discrepancy and confluent characters.</p>
Assuntos
Feminino , Humanos , Masculino , Sistema ABO de Grupos Sanguíneos , Genética , Povo Asiático , Genética , Sequência de Bases , China , Etnologia , Etnicidade , Frequência do Gene , Predisposição Genética para Doença , Genótipo , Polimorfismo GenéticoRESUMO
OBJECTIVE@#To study the molecular genetic background of Diego blood group in Chinese Han population.@*METHODS@#A total of 2990 blood samples from unrelated blood donors were phenotyped for Dia and Dib by serological method. Twenty randomly selected samples of Di(a-b+) type and all of the samples of rare Di(a+b-) phenotype by screening were genotyped by PCR-SSP and direct DNA Sequencing.@*RESULTS@#Of the 2990 samples identified by serological method, 2821 were Di(a-b+), 167 were Di(a+b+) and 2 were Di(a+b-). All of the 20 randomly-selected samples with Di(a-b+) phenotype were DI2DI2 homozygote by PCR-SSP genotyping, with nucleotide C at nt position 2561 in exon 19 by direct sequencing of the DI gene. The 2 samples of rare Di (a+b-) phenotype were both the DI1DI1 homozygote, with nucleotide T at nt position 2561 in exon 19.@*CONCLUSION@#Our results indicate that the expression of Dia and Dib antigens in Chinese Han population most likely result from a single nucleotide T to C substitution at nucleotide position 2561 in exon 19 of the DI gene, which subsequently leads to an amino acid 854 change from Pro to Leu.
Assuntos
Humanos , Povo Asiático/genética , Sequência de Bases , Doadores de Sangue , Antígenos de Grupos Sanguíneos/metabolismo , Tipagem e Reações Cruzadas Sanguíneas/métodos , China/etnologia , Éxons/genética , Genótipo , Dados de Sequência Molecular , Fenótipo , Reação em Cadeia da Polimerase/métodos , Análise de Sequência de DNARESUMO
<p><b>OBJECTIVE</b>To detect changes of serum soluble Apo-1/Fas (sApo-1/Fas) in pancreatic cancer patients and to investigate its clinical value in assessing the effect of chemotherapy.</p><p><b>METHODS</b>The serum level of sApo-1/Fas in 30 normal control subjects and 58 pancreatic cancer patients were detected using enzyme-linked immunosorbent assay (ELISA), and the sApo-1/Fas level of 48 pancreatic cancer patients, before and after chemotherapy was compared.</p><p><b>RESULTS</b>Compared with the level of the control group, the level of serum soluble Apo-1/Fas was significantly correlated with clinical stage but not with age, sex or pathologic type of pancreatic cancer. It was elevated gradually from stage II to IV (P < 0.01). However, it would obviously decrease in pancreatic cancer patients after chemotherapy (P < 0.01).</p><p><b>CONCLUSION</b>The serum soluble Apo-1/Fas may be involved in the development of pancreatic cancer, and it may be used as one parameter to assess the disease status and prognosis of pancreatic cancer patient.</p>
Assuntos
Adulto , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Adenocarcinoma Mucinoso , Sangue , Tratamento Farmacológico , Protocolos de Quimioterapia Combinada Antineoplásica , Usos Terapêuticos , Carcinoma Ductal Pancreático , Sangue , Tratamento Farmacológico , Cisplatino , Desoxicitidina , Progressão da Doença , Estadiamento de Neoplasias , Neoplasias Pancreáticas , Sangue , Tratamento Farmacológico , Prognóstico , Indução de Remissão , Receptor fas , SangueRESUMO
<p><b>OBJECTIVE</b>To study the ABO allele molecular characteristics of Ael blood subgroup.</p><p><b>METHODS</b>Five individuals of diagnosed as Ael blood subgroup were subjected to PCR amplify ABO alleles using four pairs of sequence-specific primers. Exon 6 and exon 7 at ABO locus of all samples were sequenced. An individual with AelB phenotype was chosen for further analysis of transcript structure of ABO gene.</p><p><b>RESULTS</b>Sequence analysis indicated one Ael phenotype sample with reported Ael01 allele, one Ael phenotype sample with an Ael05 allele, and two AelB and one Ael individuals did not contain referred A allele, but contain O01 or O02 allele with 261G deletion.</p><p><b>CONCLUSION</b>Molecular bases for the Ael have highly polymorphism. The mechanism responsible for the express weak A antigen of O allele with 261G deletion awaits to be elucidated.</p>
Assuntos
Feminino , Humanos , Masculino , Sistema ABO de Grupos Sanguíneos , Genética , Alelos , Sequência de Bases , Clonagem Molecular , DNA , Dados de Sequência Molecular , Reação em Cadeia da Polimerase , Polimorfismo GenéticoRESUMO
To study four A(3) subgroup samples identified by serologic tests, among which two belong to a family, three were A(3) subgroup, one was A(3)B subgroup. All four samples were genotyped by PCR-SSP method, and the nucleotide sequences of Exon 6, Exon 7 and part introns at the ABO locus for these samples were detected by ABI Prism 3100 DNA sequencer. Comparison with the consensus of A101 was performed. The results showed that haplotypes of two A(3) subgroups were common A102 allele and O1-2 allele, and haplotypes of one A(3) subgroup were common A102 allele and rare O(1v)-4 allele. Unexpectedly, a synonymous substitution 838C-->T had been found in A allele of the A(3)B subgroup sample, which predict a Leu280Phe alteration. The results suggested that molecular genetic background of the A(3) phenotypes is polymorphic. Possibly, the missense mutation 838C-->T is the molecular genetic basis of A(3)B subgroup that lead to low activity of the glycosyltransferases.