Dual-Responsive and Aggregation-Induced-Emission Probe for Selective Imaging of Infectious Urolithiasis.

Identifying infected stones is crucial due to their rapid growth and high recurrence rate. Here, the calcium-magnesium dual-responsive aggregation-induced emission (AIE)-active probe TCM-5COOH (Tricyano-methlene-pyridine-5COOH), distinctively engineered to distinguish high-threat infection calculi from metabolic stones, is presented. Upon incorporation of flexible alkyl carboxyl group, TCM-5COOH featuring five carboxyl moieties demonstrates excellent water solubility and enhanced penetration into porous infectious stones. The robust chelation of TCM-5COOH with stone surface-abundant Ca2+ and Mg2+ inhibits vibrational relaxation, thus triggering intense AIE signals. Remarkably, the resulting complex exhibits high insolubility, effectively anchoring within the porous structure of the infection calculi and offering prolonged illumination. Jobs' plot method reveals similar response characteristics for Ca2+ and Mg2+, with a 1:2 coordination number for both ions. Isothermal titration calorimetry (ITC) results demonstrate higher enthalpy change (ΔH) and lower entropy change (ΔS) for the reaction, indicating enhanced selectivity compared to TCM-4COOH lacking the alkyl carboxyl group. Synchrotron X-ray absorption fine spectroscopy (XAFS) validates TCM-5COOH's interaction with Ca2+ and Mg2+ at the microlevel. This dual-responsive probe excels in identifying infectious and metabolic calculi, compatible with endoscopic modalities and laser excitation, thereby prompting clinical visualization and diagnostic assessment.

First Report of Exserohilum rostratum Causing Brown Spot on Spartina alterniflora in China.

Spartina alterniflora Loisel, a perennial grass, has become an invasive species in China's coastal wetlands (Zhang et al. 2018). In July 2021, brown spot symptoms were observed on S. alterniflora in a coastal wetland (21°45'48″N, 108°44'00″E) in Beihai City, Guangxi Province, China. The disease affected approximately 50% of the plants in the surveyed area (0.2 ha) and was also observed in other regions of Beihai. It caused brown lesions with a gray or whitish center on the leaves and stems of S. alterniflora. As the disease developed, it ultimately led to leaf shedding and plant death. To isolate the causal agent, 18 fragments (~ 5 mm) from six symptomatic plants (3 leaf pieces per plant) were surface sterilized with 1% NaOCl solution for 2 min and rinsed three times with sterilized water. Subsequently, the tissues were placed on potato dextrose agar (PDA) medium supplemented with chloramphenicol (0.1 g/liter) and incubated at 28°C for three days. The hyphal tips were transferred onto fresh PDA to obtain pure cultures. A total of 25 isolates were obtained, 20 of which shared similar morphologies, while the remaining five exhibited distinct morphological characteristics and were non-pathogenic to S. alterniflora. Three isolates (MC16.1.3, MC16.6.2, and MC16.8.3) were randomly selected from the 20 for further investigation. The colonies on PDA were flat with dense aerial mycelia. The colony margins were entire, light brown in the centre, white to grey at the margin; reverse dark brown in the centre, gray at the margin. Conidia were straight to slightly curved, light olive-brown to dark olive-brown, septate, measured 33.5 to 79.1 µm × 10.4 to 18.7 µm (average 52.9 × 14.4 µm, n = 100), with a distinctly protruding hilum swelled from the basal cell. For molecular identification, the genomic DNA was extracted from mycelium on PDA using the CTAB method (Guo et al. 2000). The internal transcribed spacer (ITS), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and translation elongation factor 1 alpha (TEF1-α) genes were amplified and sequenced with the primer pairs ITS1/ITS4 (White et al. 1990), GPD1/GPD2 (Berbee et al. 1999), and EF1-983/EF1-2218 (Rehner et al. 2005), respectively. A BLAST analysis revealed that the ITS (OR516787-9), GAPDH (OR523686-8), and TEF-α (OR523683-5) had 99.1 to 99.7% identity with those of E. rostratum strains BRIP 11417 (LT837836, LT882553, and LT896656) and CBS 128061 (KT265240, LT715900, and LT896658) (Hernández-Restrepo et al. 2018). Based on the concatenated sequences, a phylogenetic tree generated by PhyloSuite software (Zhang et al., 2020) through Bayesian inference (BI) and Maximum Likelihood (ML) methods placed the isolates within E. rostratum. These morphological characteristics and molecular analyses confirmed the pathogen as E. rostratum (Hernández-Restrepo et al. 2018; Kaboré et al. 2022). To confirm pathogenicity, a conidial water suspension (~ 1 × 106 conidia/ml) of each of the three strains was inoculated on nine healthy S. alterniflora plants that had been grown for six months. Control plants were treated with sterile water. All plants were then enclosed in plastic bags and incubated in a greenhouse at 28°C. Six days after inoculation, the plants exhibited symptoms similar to those observed in nature. The control plants developed no symptoms. These experiments were replicated three times with similar results. To fulfill Koch's postulates, E. rostratum was consistently re-isolated from symptomatic tissue and confirmed by morphology and sequencing, whereas no fungus was isolated from the control plants. In recent years, S. alterniflora has posed a serious threat to the indigenous biodiversity of wetland ecosystems (Zhang et al. 2018). To our knowledge, this is the first report of E. rostratum causing brown spot on S. alterniflora worldwide.

A novel TNKS/USP25 inhibitor blocks the Wnt pathway to overcome multi-drug resistance in TNKS-overexpressing colorectal cancer.

Modulating Tankyrases (TNKS), interactions with USP25 to promote TNKS degradation, rather than inhibiting their enzymatic activities, is emerging as an alternative/specific approach to inhibit the Wnt/ß-catenin pathway. Here, we identified UAT-B, a novel neoantimycin analog isolated from Streptomyces conglobatus, as a small-molecule inhibitor of TNKS-USP25 protein-protein interaction (PPI) to overcome multi-drug resistance in colorectal cancer (CRC). The disruption of TNKS-USP25 complex formation by UAT-B led to a significant decrease in TNKS levels, triggering cell apoptosis through modulation of the Wnt/ß-catenin pathway. Importantly, UAT-B successfully inhibited the CRC cells growth that harbored high TNKS levels, as demonstrated in various in vitro and in vivo studies utilizing cell line-based and patient-derived xenografts, as well as APCmin/+ spontaneous CRC models. Collectively, these findings suggest that targeting the TNKS-USP25 PPI using a small-molecule inhibitor represents a compelling therapeutic strategy for CRC treatment, and UAT-B emerges as a promising candidate for further preclinical and clinical investigations.

Identification of Fusarium sacchari Causing Foliar Blight on Begonia semperflorens in China.

Begonia semperflorens Link et Otto (Begoniaceae) is a flowering, ornamental plant widely cultivated in China. In April of 2020, a foliar blight disease on B. semperflorens was observed in plant nurseries (∼0.2 ha), with ~ 20% disease incidence (n = 150) in Nanning, Guangxi Province, China. Initial symptoms included irregular to circular, grayish white spots surrounded by a dark brown halo, mainly scattered on the edges the leaves. In severe infections, the spots frequently coalesced to form large, blighted areas, followed by defoliation. To isolate the pathogen, three representative plants exhibiting symptoms were collected from the nurseries. Leaf tissues (5 × 5 mm) were cut from the margin of necrotic lesions (n = 18), surface disinfected in 1% NaOCl for 2 min, then rinsed three times in sterile H2O. Then the tissues were plated on potato dextrose agar (PDA), and incubated at 28°C (12 h photoperiod) for 3 days. Hyphal tips from recently germinated spores were transferred to PDA to purify fungal isolates. A total of 11 isolates (85% isolation frequency) with similar morphological characteristics were obtained. Colonies on PDA plates were villose, had a dense growth of white aerial mycelia and appeared pale but becoming violet with age. On Spezieller Nährstoffarmer Agar (SNA), the macroconidia were slender, slight falcate, two to three septate, and 23.5 to 48.8 × 2.8 to 4.8 µm (n = 60), and the microconidia were abundant and formed in false heads on monophialides or polyphialides, slim, oval, zero to one septate, and 7.8 to 22.4 × 2.4 to 4.0 µm (n = 60). For molecular identification, the internal transcribed spacer (ITS) region of rDNA, and partial translation elongation factor-1 alpha (TEF-1α), and RNA polymerase second largest subunit (RPB2) genes of the representative isolate HT-2B were amplified and sequenced using primer pairs ITS1/ITS4 (White et al. 1990), EF-1/EF-2 (O'Donnell et al. 1998), and 5f2/11ar (Liu et al. 1999, Reeb et al. 2004), respectively. The obtained sequences were deposited in NCBI GenBank under the accession numbers OQ048268 (TIS), OP994260 (TEF-1α), OP994262 (RPB2) and showed 99.4%, 99.8%, and 99.4% similarity with the corresponding sequences (X94168，AF160278，and JX171580, respectively) of Fusarium sacchari from type material. In addition, a phylogenetic analysis showed that HT-2B was grouped with F. sacchari. Therefore, based on morphological (Leslie et al. 2005) and molecular characteristics, the isolates were identified as F. sacchari. To test pathogenicity, three healthy leaves on each of three B. semperflorens plants were stab-wounded with a sterile syringe and inoculated with a 10-µl droplet of a conidial suspension (106 spores/ml) of the isolate HT-2B. As a control, another three leaves were wound inoculated with sterilized dH2O. All plants were enclosed in transparent plastic bags and incubated in a greenhouse at 28°C (12 h photoperiod, ~ 80% relative humidity). Six days post-inoculation, symptoms appeared on the inoculated leaves. No symptoms were detected on control plants. Experiments were replicated three times with similar results. To fulfill Koch's postulates, the F. sacchari isolates were consistently re-isolated from symptomatic tissue and confirmed by morphology and sequencing, whereas no fungus was isolated from the control plants. To our knowledge, this is the first report of F. sacchari causing foliar blight on B. semperflorens in China. This result will help develop management strategies for this disease.

First Report of Epicoccum latusicollum Causing Leaf Blight on Curcuma kwangsiensis in China.

Curcuma kwangsiensis S. G. Lee et C. F. Liang is a traditional Chinese medicinal plant distributed in Guangxi and Yunnan Province, China. In May 2021, a leaf blight disease on C. kwangsiensi was observed in a plantation (~ 2 ha) in Lingshan county (21°51'00″N, 108°44'00″E), Guangxi Province. Disease incidence was up to 30% (n = 200). Initially, yellow to brown, irregular, water-soaked spots appeared at the tips or margins of leaves. As the disease progressed, the lesions gradually enlarged, merged. Finally, the entire leaf wilted, leading to defoliation. To isolate the pathogen, eighteen small pieces ( ~ 5 mm2) were cut from the margin of the necrotic lesions, surface disinfected with 1% NaOCl solution for 2 min, and rinsed three times in sterile water. Then the tissues were plated onto potato dextrose agar (PDA) and incubated for 3 days at 28°C. Hyphal tips from recently germinated spores were transferred to PDA to obtain pure cultures. Twelve isolates were obtained, of which ten isolates with similar morphological characterization. Two single-spore isolates (CK45.1 and CK45.2) were subjected to further morphological and molecular characterization. Colonies on PDA were villose, had a dense growth of aerial mycelia, and appeared white to grayish eventually. Pycnidia were brown, predominantly spheroidal, and 45.0 to 205.4 µm in diameter (n = 60). Conidia were ellipsoidal, aseptate, and 3.8 to 6.1 × 1.8 to 3.6 µm (n = 90). Morphological characteristics are similar to those of Epicoccum latusicollum (Chen et al. 2017).For molecular identification, primers ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Vilgalys and Hester 1990, Rehner and Samuels 1994), RPB2-Ep-F (GGTCTTGTGTGCCCCGCTGAGAC)/RPB2-Ep-R TCGGGTGACATGACAATCATGGC), and TUB2-Ep-F (GTTCACCTTCAAACCGGTCAATG)/TUB2-Ep-R (AAGTTGTCGGGACGGAAGAGCTG) were used to amplify the internal transcribed spacer (ITS), partial nuclear large subunit rDNA (LSU), RNA polymerase II second largest subunit (rpb2), and ß-tubulin (tub2) genes, respectively. The obtained ITS (OP788080-81), LSU (OP811325-26), rpb2 (OP811267-68) and tub2 (OP811269-70) sequences showed 99.8% (478/479, and 478/479 bp), 99.9% (881/882, and 870/871 bp), 99.8 to 100% (429/431, and 429/430 bp), and 99.7% (332/333, and 332/333 bp) identity with those of ex-type strain E. latusicollum CGMCC 3.18346 (KY742101, KY742255, KY742174, KY742343). In addition, a phylogenetic analysis confirmed the isolates as E. latusicollum. Therefore, based on morphological and molecular characteristics, the isolates were identified as E. latusicollum. To verify pathogenicity, healthy leaves on nine plants (1 leaf per plant) were inoculated with mycelial discs from 5-day-old water-agar medium (WA) cultures of the strain CK45.1. Each leaf had four inoculation sites, two were inoculated with a representative strain, and two treated with pollution-free WA discs served as control. Plants were covered with transparent plastic bags and maintained in a greenhouse at 25°C with a 12 h photoperiod. Six days post-inoculation, the inoculated sites of leaves showed brown lesions, while the control remained healthy. The experiments repeated three times showed similar results. Koch's postulates were fulfilled by re-isolation of E. latusicollum from the lesions. To our knowledge, this is the first report of E. latusicollum causing leaf blight of C. kwangsiensi in China. This report might provide important information for growers to manage this disease.

Genome-Wide Identification and Expression Analysis of the NAC Gene Family in Kandelia obovata, a Typical Mangrove Plant.

The NAC (NAM, ATAF1/2, and CUC2) gene family, one of the largest transcription factor families in plants, acts as positive or negative regulators in plant response and adaption to various environmental stresses, including cold stress. Multiple reports on the functional characterization of NAC genes in Arabidopsis thaliana and other plants are available. However, the function of the NAC genes in the typical woody mangrove (Kandelia obovata) remains poorly understood. Here, a comprehensive analysis of NAC genes in K. obovata was performed with a pluri-disciplinary approach including bioinformatic and molecular analyses. We retrieved a contracted NAC family with 68 genes from the K. obovata genome, which were unevenly distributed in the chromosomes and classified into ten classes. These KoNAC genes were differentially and preferentially expressed in different organs, among which, twelve up-regulated and one down-regulated KoNAC genes were identified. Several stress-related cis-regulatory elements, such as LTR (low-temperature response), STRE (stress response element), ABRE (abscisic acid response element), and WUN (wound-responsive element), were identified in the promoter regions of these 13 KoNAC genes. The expression patterns of five selected KoNAC genes (KoNAC6, KoNAC15, KoNAC20, KoNAC38, and KoNAC51) were confirmed by qRT-PCR under cold treatment. These results strongly implied the putative important roles of KoNAC genes in response to chilling and other stresses. Collectively, our findings provide valuable information for further investigations on the function of KoNAC genes.

Characterization of the complete chloroplast genome of Handroanthus chrysanthus (Bignoniaceae).

Handroanthus chrysanthus is a deciduous broadleaved species with ecological and medicinal value. Here, the complete chloroplast genome of H. chrysanthus is characterized to investigate its phylogenetic position in Bignoniaceae. The chloroplast genome is 159,437 bp in size with GC content of 38.1%, including a large single copy region of 85,659 bp, a small single copy region of 12,824 bp and a pair of inverted repeats of 30,477 bp. It encodes 132 genes, including 87 protein-coding genes, 37 tRNA genes, and 8 rRNA genes. Based on current available chloroplast genome sequences, the phylogenetic analysis indicated that H. chrysanthus is closely related to Tabebuia nodosa.

BSR and Full-Length Transcriptome Approaches Identified Candidate Genes for High Seed Ratio in Camellia vietnamensis.

(1) Background: C. vietnamensis is very suitable for growth in the low hilly areas of southern subtropical regions. Under appropriate conditions, the oil yield of C. vietnamensis can reach 1125 kg/ha (the existing varieties can reach 750 kg/ha). Moreover, the fruit of C. vietnamensis is large and the pericarp is thick (>5 cm). Therefore, a high seed ratio has become the main target economic trait for the breeding of C. vietnamensis. (2) Methods: A half-sibling population of C. vietnamensis plants with a combination of high and low seed ratios was constructed by crossing a C. vietnamensis female parent. Bulked segregant RNA analysis and full-length transcriptome sequencing were performed to determine the molecular mechanisms underlying a high seed ratio. (3) Results: Seed ratio is a complex quantitative trait with a normal distribution, which is significantly associated with four other traits of fruit (seed weight, seed number, fruit diameter, and pericarp thickness). Two candidate regions related to high seed ratio (HSR) were predicted. One spanned 140.8−148.4 Mb of chromosome 2 and was associated with 97 seed-yield-related candidate genes ranging in length from 278 to 16,628 bp. The other spanned 35.3−37.3 Mb on chromosome 15 and was associated with 38 genes ranging in length from 221 to 16,928 bp. Using the full-length transcript as a template, a total of 115 candidate transcripts were obtained, and 78 transcripts were predicted to be functionally annotated. The DEGs from two set pairs of cDNA sequencing bulks were enriched to cytochrome p450 CYP76F14 (KOG0156; GO:0055114, HSR4, HSR7), the gibberellin phytohormone pathway (GO:0016787, HSR5), the calcium signaling pathway (GO:0005509, HSR6), the polyubiquitin-PPAR signaling pathway (GO:0005515, HSR2, HSR3), and several main transcription factors (bZIP transcription factor, HSR1) in C. vietnamensis.

Trapping endoplasmic reticulum with amphiphilic AIE-active sensor via specific interaction of ATP-sensitive potassium (KATP).

The current aggregation-induced emission luminogens (AIEgens) sometimes suffer from poor targeting selectivity due to undesirable aggregation in the hydrophilic biosystem with 'always-on' fluorescence or unspecific aggregation in the lipophilic organelle with prematurely activated fluorescence. Herein, we report an unprecedented 'amphiphilic AIEgen' sensor QM-SO3-ER based on the AIE building block of quinoline-malononitrile (QM). The introduced hydrophilic sulfonate group can well control the specific solubility in a hydrophilic system with desirable initial 'fluorescence-off' state. Moreover, the incorporated p-toluenesulfonamide group plays two roles: enhancing the lipophilic dispersity, and behaving as binding receptor to the adenosine triphosphate (ATP)-sensitive potassium (KATP) on the endoplasmic reticulum (ER) membrane to generate the docking assay confinement effect with targetable AIE signal. The amphiphilic AIEgen has for the first time settled down the predicament of unexpected 'always-on' fluorescence in the aqueous system and the untargetable aggregation signal in the lipophilic organelle before binding to ER, thus successfully overcoming the bottleneck of AIEgens' targetability.

Identification and expression analysis of PUB genes in tea plant exposed to anthracnose pathogen and drought stresses.

The plant U-box (PUB) gene family, one of the major ubiquitin ligase families in plants, plays important roles in multiple cellular processes including environmental stress responses and resistance. The function of U-box genes has been well characterized in Arabidopsis and other plants. However, little is known about the tea plant (Camellia sinensis) PUB genes. Here, 89 U-box proteins were identified from the chromosome-scale referenced genome of tea plant. According to the domain organization and phylogenetic analysis, the tea plant PUB family were classified into ten classes, named Class I to X, respectively. Using previously released stress-related RNA-seq data in tea plant, we identified 34 stress-inducible CsPUB genes. Specifically, eight CsPUB genes were expressed differentially under both anthracnose pathogen and drought stresses. Moreover, six of the eight CsPUBs were upregulated in response to these two stresses. Expression profiling performed by qRT-PCR was consistent with the RNA-seq analysis, and stress-related cis-acting elements were identified in the promoter regions of the six upregulated CsPUB genes. These results strongly implied the putative functions of U-box ligase genes in response to biotic and abiotic stresses in tea plant.

Multi-Arm PEG/Peptidomimetic Conjugate Inhibitors of DR6/APP Interaction Block Hematogenous Tumor Cell Extravasation.

The binding of amyloid precursor protein (APP) expressed on tumor cells to death receptor 6 (DR6) could initiate the necroptosis pathway, which leads to necroptotic cell death of vascular endothelial cells (ECs) and results in tumor cells (TCs) extravasation and metastasis. This study reports the first inhibitor of DR6/APP interaction as a novel class of anti-hematogenous metastatic agent. By rationally utilizing three combined strategies including selection based on phage display library, d-retro-inverso modification, and multiple conjugation of screened peptidomimetic with 4-arm PEG, the polymer-peptidomimetic conjugate PEG-tAHP-DRI (tetra-(D-retro-inverso isomer of AHP-12) substitued 4-arm PEG5k ) is obtained as the most promising agent with the strongest binding potency (KD  = 51.12 × 10-9  m) and excellent pharmacokinetic properties. Importantly, PEG-tAHP-DRI provides efficient protection against TC-induced ECs necroptosis both in vitro and in vivo. Moreover, this ligand exhibits prominent anti-hematogenous metastatic activity in serval different metastatic mouse models (B16F10, 4T1, CT26, and spontaneous lung metastasis of 4T1 orthotopic tumor model) and displays no apparent detrimental effects in preliminary safety evaluation. Collectively, this study demonstrates the feasibility of exploiting DR6/APP interaction to regulate hematogenous tumor cells transendothelial migration and provides PEG-tAHP-DRI as a novel and promising inhibitor of DR6/APP interaction for developments of anti-hematogenous metastatic therapies.

A paclitaxel and microRNA-124 coloaded stepped cleavable nanosystem against triple negative breast cancer.

BACKGROUND: Triple negative breast cancer (TNBC) is one of the most biologically aggressive breast cancers and lacks effective treatment options, resulting in a poor prognosis. Therefore, studies aiming to explore new therapeutic strategies for advanced TNBC are urgently needed. According to recent studies, microRNA-124 (miR124) not only inhibits tumour growth but also increases the sensitivity of TNBC to paclitaxel (PTX), suggesting that a platform combining PTX and miR124 may be an advanced solution for TNBC. RESULTS: Herein, we constructed a stepped cleavable calcium phosphate composite lipid nanosystem (CaP/LNS) to codeliver PTX and miR124 (PTX/miR124-NP). PTX/miR124-NP exhibited superior tumor microenvironment responsive ability, in which the surface PEG layer was shed in the mildly acidic environment of tumor tissues and exposed oligomeric hyaluronic acid (o-HA) facilitated the cellular uptake of CaP/LNS by targeting the CD44 receptor on the surface of tumor cells. Inside tumour cells, o-HA detached from CaP/LNS due to the reduction of disulfide bonds by glutathione (GSH) and inhibited tumour metastasis. Then, PTX and miR124 were sequentially released from CaP/LNS and exerted synergistic antitumour effects by reversing the Epithelial-Mesenchymal Transition (EMT) process in MDA-MB-231 cells. Moreover, PTX/miR124-NP showed significant antitumour efficiency and excellent safety in mice bearing MDA-MB-231 tumours. CONCLUSION: Based on these results, the codelivery of PTX and miR124 by the CaP/LNS nanosystem might be a promising therapeutic strategy for TNBC.

The Arabidopsis AGC kinases NDR2/4/5 interact with MOB1A/1B and play important roles in pollen development and germination.

Pollen formation and pollen tube growth are essential for the delivery of male gametes into the female embryo sac for double fertilization. Little is known about the mechanisms that regulate the late developmental process of pollen formation and pollen germination. In this study, we characterized a group of Arabidopsis AGC kinase proteins, NDR2/4/5, involved in pollen development and pollen germination. The NDR2/4/5 genes are mainly expressed in pollen grains at the late developmental stages and in pollen tubes. They function redundantly in pollen formation and pollen germination. At the tricellular stages, the ndr2 ndr4 ndr5 mutant pollen grains exhibit an abnormal accumulation of callose, precocious germination and burst in anthers, leading to a drastic reduction in fertilization and a reduced seed set. NDR2/4/5 proteins can interact with another group of proteins (MOB1A/1B) homologous to the MOB proteins from the Hippo signaling pathway in yeast and animals. The Arabidopsis mob1a mob1b mutant pollen grains also have a phenotype similar to that of ndr2 ndr4 ndr5 pollen grains. These results provide new evidence demonstrating that the Hippo signaling components are conserved in plants and play important roles in sexual plant reproduction.

Aromatic Ring Substituted Aaptamine Analogues as Potential Cytotoxic Agents against Extranodal Natural Killer/T-Cell Lymphoma.

A chemical modification study was conducted on the marine natural product aaptamine (1), isolated from the marine sponge Aaptos aaptos. Thirty new derivatives substituted by various aromatic rings at the 3- and 7-positions of aaptamine were prepared by bromination, followed by the Suzuki coupling reaction. Sixteen compounds displayed cytotoxicities to four cancer cell lines (IC50 < 10 µM). In particular, compound 5i demonstrated a significant antiproliferative effect on the extranodal natural killer/T-cell lymphoma (ENKT) cell line SNK-6 with an IC50 value of 0.6 µM. Additionally, compound 5i showed cytotoxicities to multiple lymphoma cell lines, including Ramos, Raji, WSU-DLCL2, and SU-DHL-4 cells.

Phakefustatins A-C: Kynurenine-Bearing Cycloheptapeptides as RXRα Modulators from the Marine Sponge Phakellia fusca.

A neutral-loss scanning mass method was used to explore new kynurenine-containing cycloheptapeptides, phakefustatins A-C (1-3), from the marine sponge Phakellia fusca. Their structures were elucidated by spectroscopic analysis and the advanced Marfey's method. 1 was total synthesized via a final-stage ozonolysis strategy by the combination of solid/solution-phase synthesis. Phakefustatin A (1) was identified as a RXRα modulator to inhibit cancer cell growth, and its pharmacophores could be Kyn and guanidine groups.

Incorporation of drug efflux inhibitor and chemotherapeutic agent into an inorganic/organic platform for the effective treatment of multidrug resistant breast cancer.

BACKGROUND: Multidrug resistance (MDR) is a pressing obstacle in clinical chemotherapy for breast cancer. Based on the fact that the drug efflux is an important factor in MDR, we designed a codelivery system to guide the drug efflux inhibitor verapamil (VRP) and the chemotherapeutic agent novantrone (NVT) synergistically into breast cancer cells to reverse MDR. RESULTS: This co-delivery system consists of following components: the active targeting peptide RGD, an inorganic calcium phosphate (CaP) shell and an organic inner core. VRP and NVT were loaded into CaP shell and phosphatidylserine polyethylene glycol (PS-PEG) core of nanoparticles (NPs) separately to obtain NVT- and VRP-loaded NPs (NV@CaP-RGD). These codelivered NPs allowed VRP to prevent the efflux of NVT from breast cancer cells by competitively combining with drug efflux pumps. Additionally, NV@CaP-RGD was effectively internalized into breast cancer cells by precise delivery through the effects of the active targeting peptides RGD and EPR. The pH-triggered profile of CaP was also able to assist the NPs to successfully escape from lysosomes, leading to a greatly increased effective intracellular drug concentration. CONCLUSION: The concurrent administration of VRP and NVT by organic/inorganic NPs is a promising therapeutic approach to reverse MDR in breast cancer.

pH-Sensitive Shell-Core Platform Block DNA Repair Pathway To Amplify Irreversible DNA Damage of Triple Negative Breast Cancer.

Triple negative breast cancer (TNBC) is insensitive to either chemotherapy or endocrine therapy because of the powerful DNA reparation and the negative expression of surface antigens, which urgently claims for an effective approach to improve the prognosis. Herein, DNA repair blocker BRCA1 small interfering RNA (siRNA) was introduced with cisplatin (Pt) into the elaborately designed pH-sensitive shell-core platform to enhance the chemotherapeutic treatment effect by silencing the DNA repair related gene. In this platform, BRCA1 siRNA and Pt prodrug (Pro-Pt) were separately encapsulated in the porous outer shell and hydrophobic inner core with extremely high encapsulation efficiency and stability effectively preventing them from degradation during circulation. Suitable size and urokinase plasminogen activator analogues (uPA) with high affinity for the uPA receptor (uPAR) realized an excellent dual passive and active tumor targeting ability. Moreover, the exposed PEG hydrophilic chain prevented the nanoparticles (NPs) from precipitating by serum protein or inactivating by nuclease in the blood cycle. Most importantly, the degradable CaP (calcium ions and phosphate ions) shell with smart pH sensitivity would dissipate from NPs in the lysosomes to burst the lysosome membranes so as to guarantee the lysosomal escape and the sequential release of the siRNA and Pro-Pt where the BRCA1 siRNA blocked the DNA repairing pathway followed by reducing Pro-Pt to Pt for irreversible DNA damage. Hence, the uPA-SP@CaP NPs provided a promising strategy for high-efficiency treatment of TNBC along with bringing new hope for more patients.

Butyrolactone-I, an efficient α-glucosidase inhibitor, improves type 2 diabetes with potent TNF-α-lowering properties through modulating gut microbiota in db/db mice.

The aim of this study was to evaluate the effects of butyrolactone-I (A6) on type 2 diabetes (T2D) in db/db mice because A6 was found to inhibit α-glucosidase activities and TNF-α release, which were associated with improving T2D. Male db/db mice were divided into 6 groups and given an equivalent volume of olive oil, acarbose, or different doses of A6 for 4 wk (n = 8/group). In this study, 11 butenolide derivatives were screened for their α-glucosidase and TNF-α suppressive activity in vitro. A6, an efficient α-glucosidase inhibitor, exerts hypoglycemic and multiple activities in reducing weight, improving glucose tolerance and insulin resistance, increasing short-chain fatty acid (SCFA) levels, activating SCFA-induced increases in glucagon-like peptide 1 and peroxisome proliferator-activated receptor-γ expression, enhancing intestinal mucosal barrier function and mitigating endoxemia in db/db mice. These effects may result from mediation of gut microbiota by A6. Meanwhile, A6, with potent TNF-α-lowering properties, was demonstrated to have multiple salutary effects with excellent structural stability and long-term safety in vivo. A6, an effective α-glucosidase inhibitor with high security and stability, exerted potent antidiabetic effects in vivo. Furthermore, the modulation of gut microbiota of A6 was demonstrated to be one of the mechanisms contributing to anti-inflammation properties and improving endoxemia. Our work confirms that the compound A6 is a prospective drug candidate for T2D.-Wu, W., Liu, L., Zhu, H., Sun, Y., Wu, Y., Liao, H., Gui, Y., Li, L., Liu, L., Sun, F., Lin, H. Butyrolactone-I, an efficient α-glucosidase inhibitor, improves type 2 diabetes with potent TNF-α-lowering properties through modulating gut microbiota in db/db mice.

Investigation of Penicillin Binding Protein (PBP)-like Peptide Cyclase and Hydrolase in Surugamide Non-ribosomal Peptide Biosynthesis.

Non-ribosomal peptides (NRPs) are biosynthesized on non-ribosomal peptides synthetase (NRPS) complexes, of which a C-terminal releasing domain commonly offloads the products. Interestingly, a dedicated releasing domain is absent in surugamides (SGM) NRPS, which directs the biosynthesis of cyclic octapeptides, SGM-A to -E, and the linear decapeptide, SGM-F. Here, we confirmed that surE is essential for the production of SGMs via genetic experiments. Biochemical characterization demonstrated that the recombinant enzyme, SurE, can generate the main products SGM-A and -F from the corresponding SNAC substrates, indicating that SurE is a standalone thioesterase-like enzyme. SurE also displays considerable substrate plasticity with expanded ring or different amino acid compositions to produce different cyclopeptides, highlighting the potential of chemoenzymatic applications. Site-directed mutagenesis allowed identification of the key residues of SurE. Finally, bioinformatics analysis suggested that SurE homologs are widely distributed in bacteria, suggesting a general mechanism of NRP release in Nature.

Total Synthesis of Aaptamine, Demethyloxyaaptamine, and Their 3-Alkylamino Derivatives.

A simple and efficient synthetic route for preparing the benzonaphthyridine framework is reported. Only seven steps are needed for the assembly of 3-alkylamino aaptamine from inexpensive isoquinoline 6 by this route with about 20% overall yield. The two key steps are a novel palladium-catalyzed reductive cyclization with Mo(CO)6 as reductant to form aaptamine and demethyloxyaaptamine and a hydrogen-bond-mediated oxidative alkylamination to account for the complete regioselectivity.