Human antibodies neutralizing the alpha-latrotoxin of the European black widow.

Poisoning by widow-spider (genus Latrodectus) bites occurs worldwide. The illness, termed latrodectism, can cause severe and persistent pain and can lead to muscle rigidity, respiratory complications, and cardiac problems. It is a global health challenge especially in developing countries. Equine serum-derived polyclonal anti-sera are commercially available as a medication for patients with latrodectism, but the use of sera imposes potential inherent risks related to its animal origin. The treatment may cause allergic reactions in humans (serum sickness), including anaphylactic shock. Furthermore, equine-derived antivenom is observed to have batch-to-batch variability and poor specificity, as it is always an undefined mix of antibodies. Because latrodectism can be extremely painful but is rarely fatal, the use of antivenom is controversial and only a small fraction of patients is treated. In this work, recombinant human antibodies were selected against alpha-latrotoxin of the European black widow (Latrodectus tredecimguttatus) by phage display from a naïve antibody gene library. Alpha-Latrotoxin (α-LTX) binding scFv were recloned and produced as fully human IgG. A novel alamarBlue assay for venom neutralization was developed and used to select neutralizing IgGs. The human antibodies showed in vitro neutralization efficacy both as single antibodies and antibody combinations. This was also confirmed by electrophysiological measurements of neuronal activity in cell culture. The best neutralizing antibodies showed nanomolar affinities. Antibody MRU44-4-A1 showed outstanding neutralization efficacy and affinity to L. tredecimguttatus α-LTX. Interestingly, only two of the neutralizing antibodies showed cross-neutralization of the venom of the Southern black widow (Latrodectus mactans). This was unexpected, because in the current literature the alpha-latrotoxins are described as highly conserved. The here-engineered antibodies are candidates for future development as potential therapeutics and diagnostic tools, as they for the first time would provide unlimited supply of a chemically completely defined drug of constant quality and efficacy, which is also made without the use of animals.

Complete Genome Sequence of Halopseudomonas aestusnigri Strain GOM5, Isolated from Asphalt Marine Sediments of the Gulf of Mexico.

We report here the complete genome sequence of a marine Halopseudomonas aestusnigri strain isolated from asphalt sediments of the Gulf of Mexico. Studying the genomes of atypical environmental bacteria increases knowledge about the biology of microorganisms metabolizing pollutants and is also a biotechnological resource to develop bioremediation methods.

Characterization of Enterobacter cloacae BAGM01 Producing a Thermostable and Alkaline-Tolerant Rhamnolipid Biosurfactant from the Gulf of Mexico.

The search for novel biosurfactants (Bs) requires the isolation of microorganisms from different environments. The Gulf of Mexico (GoM) is a geographical area active in the exploration and exploitation of hydrocarbons. Recent metagenomic and microbiologic studies in this area suggested a potential richness for novel Bs microbial producers. In this work, nineteen bacterial consortia from the GoM were isolated at different depths of the water column and marine sediments. Bs production from four bacterial consortia was detected by the CTAB test and their capacity to reduce surface tension (ST), emulsion index (EI24), and hemolytic activity. These bacterial consortia produced Bs in media supplemented with kerosene, diesel, or sucrose. Cultivable bacteria from these consortia were isolated and identified by bacterial polyphasic characterization. In some consortia, Enterobacter cloacae was the predominant specie. E. cloacae BAGM01 presented Bs activity in minimal medium and was selected to improve its Bs production using a Taguchi and Box-Behnken experimental design; this strain was able to grow and presented Bs activity at 35 g L-1 of NaCl. This Bs decreased ST to around 34.5 ± 0.56 mNm-1 and presented an EI24 of 71 ± 1.27%. Other properties of this Bs were thermal stability, stability in alkaline conditions, and stability at high salinity, conferring important and desirable characteristics in multiple industries. The analysis of the genome of E. cloacae BAGM01 showed the presence of rhlAB genes that have been reported in the synthesis of rhamnolipids, and alkAB genes that are related to the degradation of alkanes. The bioactive molecule was identified as a rhamnolipid after HPLC derivatization, 1H NMR, and UPLC-QTOF-MS analysis.

Microbial prospection of communities that produce biosurfactants from the water column and sediments of the Gulf of Mexico.

Microbial communities capable of hydrocarbon degradation linked to biosurfactant (BS) and bioemulsifier (BE) production are basically unexplored in the Gulf of México (GOM). In this work, the BS and BE production of culturable marine bacterial hydrocarbonoclasts consortia isolated from two sites (the Perdido Fold Belt and Coatzacoalcos area) was investigated. The prospection at different locations and depths led to the screening and isolation of a wide variety of bacterial consortia with BS and BE activities, after culture enrichment with crude oil and glycerol as the carbon sources. At least 55 isolated consortia presented reduction in surface tension (ST) and emulsifying activity (EI24 ). After colony purification, bacteria were submitted to polyphasic analysis assays that resulted in the identification of different strains of cultivable Gammaproteobacteria Gram (-) Citrobacter, Enterobacter, Erwinia, Pseudomonas, Vibrio, Shewanella, Thalassospira, Idiomarina, Pseudoalteromonas, Photobacterium, and Gram (+) Staphylococcus, Bacillus, and Microbacterium. Overall, the best results for ST reduction and EI24 were obtained with consortia. Individually, Pseudomonas, Bacillus, and Enterobacter strains showed the best results for the reduction of ST after 6 days, while Thalassospira and Idiomarina strains showed the best results for EI24 (above 68% after 9 days). Consortia isolates from the GOM had the ability to degrade crude oil by up to 40-80% after 24 and 36 months, respectively. In all cases, biodegradation of crude oil was related to the reduction in ST and bioemulsifying activity and was independent from the depth in the water column.

Whole-genome comparison between reference sequences and oyster Vibrio vulnificus C-genotype strains.

Whole-genome sequences of Vibrio vulnificus clinical genotype (C-genotype) from the CICESE Culture Collection, isolated from oysters, were compared with reference sequences of CMCP6 and YJ016 V. vulnificus C-genotype strains of clinical origin. The RAST web server estimated the whole genome to be ~4.8 Mb in CICESE strain 316 and ~4.7 Mb in CICESE strain 325. No plasmids were detected in the CICESE strains. Based on a phylogenetic tree that was constructed with the whole-genome results, we observed high similarity between the reference sequences and oyster C-genotype isolates and a sharp contrast with environmental genotype (E-genotype) reference sequences, indicating that the differences between the C- and E-genotypes do not necessarily correspond to their isolation origin. The CICESE strains share 3488 genes (63.2%) with the YJ016 strain and 3500 genes (63.9%) with the CMCP6 strain. A total of 237 pathogenicity associated genes were selected from reference clinical strains, where-92 genes were from CMCP6, 126 genes from YJ016, and 19 from MO6-24/O; the presence or absence of these genes was recorded for the CICESE strains. Of the 92 genes that were selected for CMCP6, 67 were present in both CICESE strains, as were as 86 of the 126 YJ016 genes and 13 of the 19 MO6-24/O genes. The detection of elements that are related to virulence in CICESE strains-such as the RTX gene cluster, vvhA and vvpE, the type IV pili cluster, the XII genomic island, and the viuB genes, suggests that environmental isolates with the C-genotype, have significant potential for infection.

Bacterial Diversity and the Geochemical Landscape in the Southwestern Gulf of Mexico.

Marine sediments are an example of one of the most complex microbial habitats. These bacterial communities play an important role in several biogeochemical cycles in the marine ecosystem. In particular, the Gulf of Mexico has a ubiquitous concentration of hydrocarbons in its sediments, representing a very interesting niche to explore. Additionally, the Mexican government has opened its oil industry, offering several exploration and production blocks in shallow and deep water in the southwestern Gulf of Mexico (swGoM), from which there are no public results of conducted studies. Given the higher risk of large-scale oil spills, the design of contingency plans and mitigation activities before oil exploitation is of growing concern. Therefore, a bacterial taxonomic baseline profile is crucial to understanding the impact of any eventual oil spill. Here, we show a genus level taxonomic profile to elucidate the bacterial baseline, pointing out richness and relative abundance, as well as relationships with 79 abiotic parameters, in an area encompassing ∼150,000 km2, including a region where the exploitation of new oil wells has already been authorized. Our results describe for the first time the bacterial landscape of the swGoM, establishing a bacterial baseline "core" of 450 genera for marine sediments in this region. We can also differentiate bacterial populations from shallow and deep zones of the swGoM based on their community structure. Shallow sediments have been chronically exposed to aromatic hydrocarbons, unlike deep zones. Our results reveal that the bacterial community structure is particularly enriched with hydrocarbon-degrading bacteria in the shallow zone, where a greater aromatic hydrocarbon concentration was determined. Differences in the bacterial communities in the swGoM were also observed through a comprehensive comparative analysis relative to various marine sediment sequencing projects, including sampled sites from the Deep Water Horizon oil spill. This study in the swGoM provides clues to the bacterial population adaptation to the ubiquitous presence of hydrocarbons and reveals organisms such as Thioprofundum bacteria with potential applications in ecological surveillance. This resource will allow us to differentiate between natural conditions and alterations generated by oil extraction activities, which, in turn, enables us to assess the environmental impact of such activities.

Genetic Analysis of Vibrio parahaemolyticus O3:K6 Strains That Have Been Isolated in Mexico Since 1998.

Vibrio parahaemolyticus is an important human pathogen that has been isolated worldwide from clinical cases, most of which have been associated with seafood consumption. Environmental and clinical toxigenic strains of V. parahaemolyticus that were isolated in Mexico from 1998 to 2012, including those from the only outbreak that has been reported in this country, were characterized genetically to assess the presence of the O3:K6 pandemic clone, and their genetic relationship to strains that are related to the pandemic clonal complex (CC3). Pathogenic tdh+ and tdh+/trh+ strains were analyzed by pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). Also, the entire genome of a Mexican O3:K6 strain was sequenced. Most of the strains were tdh/ORF8-positive and corresponded to the O3:K6 serotype. By PFGE and MLST, there was very close genetic relationship between ORF8/O3:K6 strains, and very high genetic diversities from non-pandemic strains. The genetic relationship is very close among O3:K6 strains that were isolated in Mexico and sequences that were available for strains in the CC3, based on the PubMLST database. The whole-genome sequence of CICESE-170 strain had high similarity with that of the reference RIMD 2210633 strain, and harbored 7 pathogenicity islands, including the 4 that denote O3:K6 pandemic strains. These results indicate that pandemic strains that have been isolated in Mexico show very close genetic relationship among them and with those isolated worldwide.

Technological Evolution in the Development of Therapeutic Antibodies.

Immunotherapy is defined as the use of the immune system or components of it, such as key immune molecules, to fight diseases or invading infectious agents. Modern biotechnology provides industrial versions of immune molecules (components of the immune system) naturally produced by the human body. Immune molecules such as monoclonal antibodies are used as therapeutics in several disease conditions. In recent years a new group of antibody based molecules has been developed to replace monoclonal antibodies, given their ability to overcome some of the limitations of the latter. The first clinical trials with these new molecules have been very encouraging and the promise is that they will be released to the market very soon. This in turn has stimulated more research on new versions of antibody based therapeutics by biotechnological companies supported by the pharmaceutical industry and in many cases in collaboration with academic institutions.

Anti-tumor necrosis factor VNAR single domains reduce lethality and regulate underlying inflammatory response in a murine model of endotoxic shock.

BACKGROUND: In sepsis, tumor necrosis factor (TNF) is the key factor triggering respiratory burst, tissue injury and disseminated coagulation. Anti-TNF strategies based on monoclonal antibodies or F(ab')2 fragments have been used in sepsis with contradictory results. Immunoglobulin new antigen receptors (IgNAR) are a unique subset of antibodies consisting of five constant (CNAR) and one variable domains (VNAR). VNAR domains are the smallest, naturally occurring, antibody-based immune recognition units, having potential use as therapy. Our aim was to explore the impact of an anti-TNF VNAR on survival in an experimental model of endotoxic shock. Also, mRNA expression and serum protein of several inflammatory molecules were measured. RESULTS: Endotoxic shock was induced by lipopolysaccharide (LPS) in male Balb/c mice. Animals were treated with anti-TNF VNAR domains, F(ab')2 antibody fragments, or saline solution 15 minutes before, 2 h and 24 h after lethal dose100 (LD100) LPS administration. TNF blockade with either VNAR domains or F(ab')2 fragments were associated with lower mortality (60% and 75%, respectively) compared to LD100. Challenge with LPS induced significant production of serum TNF and interleukins -10 and -6 at 3 h. After that, significant reduction of IL-6 at 24 h (vs 3 h) was shown only in the VNAR group. Nitrites level also increased in response to LPS. In liver, TNF and IL-10 mRNA expression showed a pro-inflammatory imbalance in response to LPS. Blocking TNF was associated with a shift towards an anti-inflammatory status; however, polarization was more pronounced in animals receiving F(ab')2 fragments than in those with VNAR therapy. With regard to IL-6, gene expression was increased at 3 h in all groups. TNF blockade was associated with rapid and sustained suppression of IL-6 expression, even more evident in the VNAR group. Finally, expression of inducible-nitric oxide synthase (iNOS) increased in response to LPS at 3 h, but this was decreased at 24 h only in the anti-TNF VNAR group. CONCLUSIONS: Anti-TNF VNAR single domains improved survival in a murine model of endotoxic shock. Protection was associated with regulation in the TNF/IL-10 balance, attenuation of IL-6 and iNOS gene expression in the liver as well as decreased serum IL-6 concentration.

Diagnóstico de tuberculosis mediante detección de Mycobacterium tuberculosis empleando un sistema no comercial de reacción en cadena de la polimerasa / Diagnosis of tuberculosis by detection of mycobacterium tuberculosis with a non-commercial polymerase chain reaction

Objetivo: Evaluar la capacidad de un sistema no comercial de amplificación directa por reacción en cadena de la polimerasa para identificar a Mycobacterium tuberculosis en pacientes con sospecha de tuberculosis pulmonar y baciloscopia positiva. Material y métodos: Se analizaron muestras de expectoración y líquido pleural por medio de amplificación directa por reacción en cadena de la polimerasa, utilizando las secuencias 5'CAGCCCGCTGGAGTCCCGCGGA3' y 5'GCGCGTTCACCATGGACACCG3'. Se utilizó como estándar de oro el cultivo en Lowenstein-Jensen.Resultados: Se incluyeron 79 pacientes consecutivos y un total de 212 especímenes. Utilizando el cultivo como estándar de oro, la sensibilidad de la reacción en cadena de la polimerasa en las muestras de expectoración fue de 97 por ciento, y su valor predictivo positivo de 57 por ciento. La reacción en cadena de la polimerasa fue positiva en 54 (98.18 por ciento) de los 55 casos con baciloscopia positiva en expectoración. Conclusión: La sensibilidad y el valor predictivo positivo de la secuencia utilizada para identificar a Mycobacterium tuberculosis en muestras de expectoración con baciloscopia positiva, son similares a la reportada en los estudios clínicos. Su aplicación permitirá identificar rápidamente a los pacientes infectados con micobacterias tuberculosas y distinguirlos de aquellos infectados por micobacterias no tuberculosas.