Evaluation of a Series of Turnip Mosaic Virus Chimeric Clones Reveals Two Amino Acid Sites Critical for Systemic Infection in Chinese Cabbage.

Two infectious clones of turnip mosaic virus (TuMV), pKBC-1 and pKBC-8, with differential infectivity in Chinese cabbage (Brassica rapa subsp. pekinensis), were obtained. Both infected Nicotiana benthamiana systemically, inducing similar symptoms, whereas only virus KBC-8 infected Chinese cabbage systemically. To identify the determinants affecting infectivity on Chinese cabbage, chimeric clones were constructed by restriction fragment exchange between the parental clones and tested on several Chinese cabbage cultivars. Chimeric clones p1N8C and p8N1C demonstrated that the C-terminal portion of the polyprotein determines systemic infection of Chinese cabbage despite only three amino acid differences in this region, in the cylindrical inclusion (CI), viral protein genome-linked (VPg), and coat protein (CP). A second pair of hybrid constructs, pHindIII-1N8C and pHindIII-8N1C, failed to infect cultivars CR Victory and Jinseonnorang systemically, yet pHindIII-1N8C caused hypersensitive response-like lesions on inoculated leaves of these cultivars, and could systemically infect cultivars CR Chusarang and Jeongsang; this suggests that R genes effective against TuMV may exist in the first two cultivars but not the latter two. Constructs with single amino acid changes in both VPg (K2045E) and CP (Y3095H) failed to infect Chinese cabbage, implying that at least one of these two amino acid substitutions is essential for successful infection on Chinese cabbage. Successful infection by mutant KBC-8-CP-H and delayed infection with mutant HJY1-VPg-E following mutation or reversion suggested that VPg (2045K) is the residue required for infection of Chinese cabbage and involved in the interaction between VPg and eukaryotic initiation factor eIF(iso)4E, confirmed by yeast two-hybrid assay.

First report of dasheen mosaic virus infecting calla lilies in South Korea.

In April 2022, leaves showing virus-like symptoms including mosaic, feathery chlorotic mottle and distortions were observed on calla lilies (Zantedeschia sp.) growing in a greenhouse in Jeolla province, South Korea. Leaf samples from nine symptomatic plants from the same greenhouse were collected and tested for Zantedeschia mosaic virus (ZaMV), Zantedeschia mild mosaic virus (ZaMMV) and Dasheen mosaic virus (DaMV) by reverse transcription-polymerase chain reaction (RT-PCR) with specific primers, ZaMV-F/R (Wei et al. 2008), ZaMMV-F/R (5'-GACGATCAGCAACAGCAGCAACAGCAGAAG-3'/5'-CTGCAAGGCTGAGATCCCGAGTAGCGAGTG-3') and DsMV-CPF/CPR, respectively. In previous surveys, ZaMV and ZaMMV were detected in calla lily fields in South Korea. Of 9 symptomatic samples, 8 were positive for ZaMV and ZaMMV but no PCR product was obtained from the ninth sample, which showed a yellow feather-like pattern. To identify the causal virus, total RNA from a leaf sample of the symptomatic calla lily was extracted using an RNeasy Plant Mini Kit (Qiagen, Germany) and analyzed by high-throughput sequencing. Ribosomal RNA was removed and a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA LT Sample Prep Kit (Plants) and sequenced on an Illumina NovaSeq 6000 system (Macrogen, Korea), yielding 150 nt paired end reads. De novo assembly of the 88,171,036 reads was performed using Trinity software (r20140717) while the 113,140 initially assembled contigs were screened against the NCBI viral genome database using BLASTN. One contig of 10,007 bp (GenBank LC723667) shared 79.89-87.08% nucleotide (nt) identities to the available genomes of other DsMV isolates including Colocasia esculenta isolates Et5 (MG602227, 87.08%; Ethiopia) and CTCRI-II-14 (KT026108, 85.32%; India), and a calla lily isolate (AJ298033, 84.95%; China). No contigs representing other plant viruses were identified. To confirm the presence of DsMV, and because the virus was not detected using DsMV-CPF/CPR, RT-PCR was performed using new virus-specific primers DsMV-F/R (5'-GATGTCAACGCTGGCACCAGT-3'/5'-CAACCTAGTAGTAACGTTGGAGA-3'), designed based on the contig sequence. PCR products of the expected 600 bp were obtained from the symptomatic plant, cloned into the pGEM-T Easy Vector (Promega, USA), and two independent clones were bidirectionally sequenced (BIONEER, Korea), and shown to be identical. The sequence was deposited in GenBank as acc. no. LC723766, and shared 100% nt identity to the full-length contig LC723667, and 91.83% identity to the Chinese calla lily DsMV isolate (AJ298033). DsMV, a member of the genus Potyvitus in the family Potyviridae, is one of the major viruses infecting taro in South Korea, showing mosaic and chlorotic feathering symptoms (Kim et al. 2004); however, there is no record in the literature of the identification of this virus in South Korea in ornamental species including calla lily. To survey the sanitary status of other calla lilies, 95 samples with or without symptoms were collected from other regions and subjected to RT-PCR detection for DsMV. Ten of these samples were positive with primers DsMV-F/R, including seven mixed infections (DsMV+ZaMV or DsMV+ZaMV+ZaMMV). To our knowledge, this is the first report of DsMV infecting calla lilies in South Korea. The virus is easily spread by vegetative propagation (Babu et al. 2011) and by aphids (Reyes et al. 2006). This study will help the management of viral diseases on calla lilies in South Korea.

First report of pepino mosaic virus infecting tomato in South Korea.

Pepino mosaic virus (PepMV), a member of the genus Potexvirus in the family Alphaflexiviridae, has been responsible for economic losses in tomato across Africa, Asia, Europe, and the Americas over the last two decades, but has not previously been reported in South Korea. In December 2020, virus-like symptoms (foliar interveinal chlorosis and unevenly discolored fruits) were observed on ~5% of tomato (Solanum lycopersicum) plants growing in a greenhouse in Jeolla province, South Korea. To identify the causal virus, total RNA from a leaf sample of the symptomatic tomato was extracted using an RNeasy Plant Mini Kit (Qiagen, Germany) and analyzed by high-throughput sequencing. Ribosomal RNA was removed and a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA LT Sample Prep Kit (Plants) and sequenced on an Illumina NovaSeq 6000 system (Macrogen, Korea), yielding 151 nt paired end reads. De novo assembly of the 74,417,192 reads was performed using Trinity software (r20140717) while the 308,940 initially assembled contigs were screened against the NCBI viral genome database using BLASTN. Two contigs of 6,419 and 6,391 bp (GenBank LC656469, JKT1; and LC656470, JKT2) shared 94.81% and 98.34% nucleotide (nt) identities with isolates of the CH2 group (MK133092 and MF422613) and US1 group (FJ940225), respectively. No contigs representing other plant viruses were identified. A phylogenetic tree of the genomes of 44 isolates encompassing different PepMV strains (Abrahamian et al., 2020) also placed JKT1 in the CH2 clade, and JKT2 in the US1 clade. Leaf samples from 24 randomly selected plants from the same greenhouse were tested by reverse transcription-polymerase chain reaction (RT-PCR) with PepMV-specific primers, Pep3/Pep4 and PepCP-D/PepCP-R (Souiri et al., 2019), yielding products of the expected sizes (625 bp for Pep3/Pep4 and 848 bp for PepCP-D/PepCP-R) from all samples. Amplicons were cloned into the pGEM-T Easy Vector (Promega, USA); two clones for each amplicon were bidirectionally sequenced (BIONEER, Korea) and deposited in GenBank. The 848 bp amplicon (accession no. LC637517) showed 99.65% nt identity to the JKT1 genome (LC656469) and 94.69% identity to a CH2 isolate (JN835466); the 625 bp amplicon (LC637518) had 99.36% nt identity to the JKT2 genome (LC656470) and 97.28% identity to a US1 isolate (FJ940225). Primers specific to the coat protein gene of each isolate (JKT1-F/JKT1-R, CGCTTGCTGGTGCTGTTCAAG/ACGTCTAGACAAAGCAGGGTT, 934 bp; JKT2-F/JKT2-R, CACTAAATGCAGCAGTTTCTG/AGTTTCATTAGCAGCCAGTC, 830 bp) also yielded the expected amplicons from all 24 samples, indicating mixed infections of PepMV strains CH2 and US1. The PCR products from three randomly-selected samples shared 79.93-80.17% nt identity between (JKT1/JKT2) two JKT1-derived sequences (LC683791 and LC683792) and two JKT2-derived sequences (LC683793 and LC683794), further supporting the presence of mixed infections in the samples. To our knowledge, this is the first report of PepMV infecting tomato in South Korea. The virus is carried on tomato seeds (Córdoba-Sellés et al., 2007; Hanssen et al., 2010), and efficiently transmitted by mechanical means leading to rapid spread in tomato crops, and the severe strain CH2 may be a serious threat to tomato production in South Korea. It is important to concentrate on the phytosanitary control for both importation and exportation to manage and prevent further spread of contaminated seeds or infected transplants.

Gene Expression and Metabolic Analyses of Nontransgenic and AtPAP1 Transgenic Tobacco Infected with Potato Virus X (PVX).

Potato virus X (PVX), a species of the genus Potexvirus, is a plant pathogenic virus that causes severe symptoms such as mild mosaic, crinkling, necrosis, and mottling on leaves. The objectives of the present study were to investigate the effect of PVX virus infection on the metabolic system in nontransgenic and Arabidopsis thaliana production of anthocyanin pigment 1 (AtPAP1) transgenic tobacco using transcript expression analysis and metabolic profiling. Potato virus X inoculation increased the gene expression of phenylpropanoid and flavonoid biosynthesis and the production of chlorogenic acid, p-coumaric acid, benzoic acid, rutin, quercetin, and kaempferol in nontransgenic tobacco leaves. However, in the AtPAP1 transgenic tobacco leaves, PVX inoculation decreased the expression of AtPAP1 and phenylpropanoid and flavonoid biosynthesis genes, and the production of phenolics and anthocyanin also declined. In contrast, the levels of amino acids and tricarboxylic acid (TCA) cycle intermediates increased after infection in the AtPAP1 transgenic plant leaves. To date, these results have not been reported previously. We suggest that PVX infection decreases AtPAP1 expression, leading to the downregulation of phenylpropanoid and flavonoid biosynthesis in transgenic plants.

Transient expression of a luciferase mRNA in plant-parasitic and free-living nematodes by electroporation.

Despite their economic significance in agricultural cropping systems, a lack of suitable molecular tools for manipulating gene expression has hindered progress in the functional genomics of plant parasitic nematodes (PPN). Obligate sexual reproduction and the obligate nature of PPN-host interactions further complicate the development of in vivo gene delivery and expression systems in these pests. Methods such as microinjection and microprojectile bombardment have been developed for introducing gene constructs into the free-living nematode, Caenorhabditis elegans. However, these procedures can be laborious and inefficient. Electroporation has been used extensively to introduce macromolecules, including single-stranded RNAs, into eukaryotic and prokaryotic cells. The technique has also been used for the delivery of DNA and double-stranded RNA constructs into nematodes by whole-animal electroporation. Here, we describe methods for the expression of a nematode-optimized NanoLuc luciferase mRNA in the form of in vitro transcripts following whole-animal electroporation of Heterodera glycines, Meloidogyne incognita, and C. elegans. The ability to transiently express single-stranded RNA constructs in economically important PPN provides a rapid means to evaluate nematode and/or foreign genes for their biological significance and potential role in nematode management.

Construction of full-length infectious cDNA clones of two Korean isolates of turnip mosaic virus breaking resistance in Brassica napus.

In this work, two new turnip mosaic virus (TuMV) strains (Canola-12 and Canola-14) overcoming resistance in canola (Brassica napus) were isolated from a B. napus sample that showed typical TuMV-like symptoms and was collected in the city of Gimcheon, South Korea, in 2020. The complete genome sequence was determined and an infectious clone was made for each isolate. Phylogenetic analysis indicated that the strains isolated from canola belonged to the World-B group. Both infectious clones, which used 35S and T7 promoters to drive expression, induced systemic symptoms in Nicotiana benthamiana and B. napus. To our knowledge, this is the first report of TuMV infecting B. napus in South Korea.

Construction of full-length infectious clones of turnip mosaic virus isolates infecting Perilla frutescens and genetic analysis of recently emerged strains in Korea.

Perilla is an annual herb with a unique aroma and taste that has been cultivated in Korea for hundreds of years. It has been widely cultivated in many Asian and European countries as a food and medicinal crop. Recently, several viruses have been reported to cause diseases in perilla in Korea, including turnip mosaic virus (TuMV), which is known as a brassica pathogen due to its significant damage to brassica crops. In this study, we determined the complete genome sequences of two new TuMV isolates originating from perilla in Korea. Full-length infectious cDNA clones of these two isolates were constructed, and their infectivity was tested by agroinfiltration of Nicotiana benthamiana and sap inoculation of Chinese cabbage and radish plants. In addition, we analyzed the phylogenetic relationship of six new Korean TuMV isolates to members of the four major groups. We also used RDP4 software to conduct recombination analysis of recent isolates from Korea, which provided new insight into the evolutionary relationships of Korean isolates of TuMV.

Reassortment of Infectious Clones of Radish Mosaic Virus Shows that Systemic Necrosis in Nicotiana benthamiana Is Determined by RNA1.

Three infectious clones of radish mosaic virus (RaMV) were generated from isolates collected in mainland Korea (RaMV-Gg) and Jeju Island (RaMV-Aa and RaMV-Bb). These isolates differed in sequences and pathogenicity. Examination of the wild-type isolates and reassortants between the genomic RNA1 and RNA2 of these three isolates revealed that severe symptoms were associated with RNA1 of isolates Aa or Gg causing systemic necrosis in Nicotiana benthamiana, or with RNA1 of isolate Bb for induction of veinal necrosis and severe mosaic symptoms in radish. Reverse transcription, followed by quantitative real-time PCR (Q-RT-PCR), results from infected N. benthamiana confirmed that viral RNA2 accumulation level was correlated to RaMV necrosis-inducing ability, and that the RNA2 accumulation level was mostly dependent on the origin of RNA1. However, in radish, Q-RT-PCR results showed more similar viral RNA2 accumulation levels regardless of the ability of the isolate to induce necrosis. Phylogenetic analysis of genomic RNAs sequence including previously characterized isolates from North America, Europe, and Asia suggest possible recombination within RNA1, while analysis of concatenated RNA1+RNA2 sequences indicates that reassortment of RNA1 and RNA2 has been more important in the evolution of RaMV isolates than recombination. Korean isolate Aa is a potential reassortant between isolates RaMV-J and RaMV-TW, while isolate Bb might have evolved from reassortment between isolates RaMV-CA and RaMV-J. The Korean isolates were shown to also be able to infect Chinese cabbage, raising concerns that RaMV may spread from radish fields to the Chinese cabbage crop in Korea, causing further economic losses.

Discovery of a Novel Member of the Carlavirus Genus from Soybean (Glycine max L. Merr.).

A novel member of the Carlavirus genus, provisionally named soybean carlavirus 1 (SCV1), was discovered by RNA-seq analysis of randomly collected soybean leaves in Illinois, USA. The SCV1 genome contains six open reading frames that encode a viral replicase, triple gene block proteins, a coat protein (CP) and a nucleic acid binding protein. The proteins showed highest amino acid sequence identities with the corresponding proteins of red clover carlavirus A (RCCVA). The predicted amino acid sequence of the SCV1 replicase was only 60.6% identical with the replicase of RCCVA, which is below the demarcation criteria for a new species in the family Betaflexiviridae. The predicted replicase and CP amino acid sequences of four SCV1 isolates grouped phylogenetically with those of members of the Carlavirus genus in the family Betaflexiviridae. The features of the encoded proteins, low nucleotide and amino acid sequence identities of the replicase with the closest member, and the phylogenetic grouping suggest SCV1 is a new member of the Carlavirus genus.

First report of Cucurbit chlorotic yellows virus infecting Cucumis melo (muskmelon and oriental melon) in Korea.

In December 2018, virus-like symptoms (yellowing, vein clearing) were observed on 2% of muskmelon (Cucumis melo L.) plants in plastic houses on a farm in Gyeongsang province, Korea Total RNA from two symptomatic and two asymptomatic plants was extracted using RNeasy Plant Mini Kit (Qiagen, Germany) for high throughput sequencing (HTS). After pre-processing and Ribo-Zero rRNA removal, a cDNA library was prepared (Illumina TruSeq Stranded Total RNA kit) and sequenced (Illumina NovaSeq 6000 system: Macrogen Inc. Korea). De novo assembly of 88,222,684 HTS reads with Trinity software (r20140717) yielded 146,269 contigs of 201-28,442 bp, which were screened against the NCBI viral genome database by BLASTn. Contigs from cucumber mosaic virus (CMV), melon necrotic spot virus (MNSV), tobacco mosaic virus (TMV) and watermelon mosaic virus (WMV) were identified, all previously reported in Korea. Two contigs (8,539 and 8,040 bp) with 99.9% sequence identity to distinct cucurbit chlorotic yellows virus (CCYV) isolates (JN641883, RNA1, Taiwan; MH819191, RNA2, China) were also identified. The ten sequences most closely related to each RNA of the Korean isolate (≥99% coverage, ≥99.6% nt identity) were from Japan, China, Taiwan, or Israel. CCYV presence was confirmed by reverse transcription-PCR (RT-PCR) using newly designed specific primers, RdRp-F/RdRp-R (5'-ACCGAACACTTGGCTATCCAA-3'/5'-CTTAATGCCGCGTATGAACTCA-3') span style="font-family:'Times New Roman'; letter-spacing:-0.5pt">and HSP-F/HSP-R (5'-TGAACGACACTGAGTTCATTCCTA-3'/5'-CGCCAAGATCGTACATGAGGAA-3'), against RNA dependent RNA polymerase (RdRp; RNA1) and the heat shock protein 70 homolog (HSP70h; RNA2). Symptomatic samples yielded products of expected sizes (RdRp,450 bp; HSP70h, 510 bp) while asymptomatic samples did not. The amplicons were cloned, and two clones of each were sequenced (BIONEER, Korea; GenBank acc. nos. LC592226 and LC592227) showing 100% and 99.2% nt identity with RdRp and HSP70h genes of Chinese CCYV isolate SD (MH819190 and MH819191, respectively) and other Asian isolates. Primers specific for CMV, WMV, beet pseudo-yellows virus (BPYV) (Okuda et al., 2007), TMV (Kim et al., 2018), MNSV (F/R, 5'-ATCTCGCATTTGGCATTACTC-3'/5'-ATTTGTAGAGATGCCAACGTA-3'), cucurbit yellow stunting disorder virus (CYSDV; Zeng et al., 2011) and cucurbit aphid-borne yellows virus (CABYV; F/R, 5'-CGGTCTATTGTCTGCAGTACCA-3'/5'- GTAGAGGATCTTGAATTGGTCCTCA-3') were also used. None of these viruses were detected in the symptomatic samples, but both asymptomatic plants were positive for CMV and WMV, and one also for MNSV. In June and September 2020, muskmelon and oriental melon (Cucumis melo L. var. makuwa) plants with yellowing disease (incidence 80-90%) and whiteflies were observed in all investigated plastic houses of one muskmelon and one oriental melon farm in Gyeonggi and Jeolla provinces. Symptomatic samples (14 muskmelon; 6 oriental melon) were collected and RT-PCR tested as above; 19/20 samples were positive for CCYV, but none for the other viruses. The oriental melon sequence (LC592895, LC592230) showed 99.7% and 100% nt identity with the RdRp and HSP70h genes of Chinese isolate SD, respectively. CCYV was first reported in Japan (Okuda et al., 2010), Taiwan, and China (Huang et al., 2010; Gu et al., 2011); to our knowledge, this is the first report of CCYV infecting muskmelon and oriental melon in Korea. Whitefly-transmitted CCYV could present a serious threat of yield losses to cucurbit crops in Korea, requiring control of vector populations to prevent spread of CCYV.

Soybean Thrips (Thysanoptera: Thripidae) Harbor Highly Diverse Populations of Arthropod, Fungal and Plant Viruses.

Soybean thrips (Neohydatothrips variabilis) are one of the most efficient vectors of soybean vein necrosis virus, which can cause severe necrotic symptoms in sensitive soybean plants. To determine which other viruses are associated with soybean thrips, the metatranscriptome of soybean thrips, collected by the Midwest Suction Trap Network during 2018, was analyzed. Contigs assembled from the data revealed a remarkable diversity of virus-like sequences. Of the 181 virus-like sequences identified, 155 were novel and associated primarily with taxa of arthropod-infecting viruses, but sequences similar to plant and fungus-infecting viruses were also identified. The novel viruses were predicted to have positive-sense RNA, negative-stranded RNA, double-stranded RNA, and single-stranded DNA genomes. The assembled sequences included 100 contigs that represented at least 95% coverage of a virus genome or genome segment. Sequences represented 12 previously described arthropod viruses including eight viruses reported from Hubei Province in China, and 12 plant virus sequences of which six have been previously described. The presence of diverse populations of plant viruses within soybean thrips suggests they feed on and acquire viruses from multiple host plant species that could be transmitted to soybean. Assessment of the virome of soybean thrips provides, for the first time, information on the diversity of viruses present in thrips.

First report of Passiflora latent virus(Passiflora latent virus;PLV) infecting persimmon in Korea.

Passiflora latent virus (PLV), a member of the genus Carlavirus in the family Betaflexiviridae has been reported in Passiflora species in Australia, Germany, Israel, the United States, and New Zealand (Tang et al., 2008). In September 2019, leaves showing a virus-like disease with mosaic, curling and necrosis were collected from ten persimmon (Diospyros kaki Thunb.) orchards in Gyeongsang province, Korea. Total RNA from a pooled sample of leaves from 21 trees was extracted using RNeasy Plant Mini Kit (Qiagen, Germany) and subjected to high throughput sequencing. After pre-processing and Ribo-Zero rRNA Removal, a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA Kit and sequenced on an Illumina NovaSeq 6000 system (Macrogen Inc. Korea). De novo assembly of the 74,862,810 reads was performed using Trinity software (r20140717); the initially assembled 213,476 contigs were screened against the NCBI viral genome database using BLASTN. By these means, 12 contigs derived from PLV were identified. Contigs with lengths of 209 to 802 nt shared nt identities of 90.70 to 94.82% with PLV isolates, covering a total of 5,169 nt (~61.6% of the full PLV genome). Two additional viruses were also detected from the pooled sample: persimmon cryptic virus (PeCV) and persimmon virus A (PeVA). To confirm PLV infection, reverse transcription-polymerase chain reaction (RT-PCR) was performed using virus-specific primers, PLV-F (5'-ACACAAAACTGCGTGTTGGA-3') and PLV-R (5'-CAAGACCCACCTACCTCAGTGTG-3'), designed based on a 633 nt contig sequence in the polymerase gene. RT-PCR products of the expected 571 bp were obtained from two of 21 individual original samples; no asymptomatic plants were tested. Amplicons were cloned into the pGEM-T Easy Vector, and two clones per sample Sanger sequenced bidirectionally (BIONEER, Korea). The identical Sequence (GenBank LC556232) showed 99.65% nt identity to the contig, and 93.87% identity with the corresponding polymerase sequence of PLV-Rehovot isolate from passion fruit in Israel (MH379331). The two PLV positive samples showing leaf necrosis were also co-infected with PeVA, identified by RT-PCR using previously reported primers PeVAfor/ PeVArev (Morell et al., 2014), but not with PeCV (mixed with PeVA in only 1/21 plants; PeVA was found in 19/21 plants). None of the tested viruses were detected in two trees, displaying mosaic, and leaf curling, respectively. The foliar symptoms of PLV infection on passionfruit have been reported to vary throughout the year (Spiegel et al., 2007). No such observations in persimmon was possible, as the infected persimmon trees were removed and destroyed because they might pose a threat to the cultivation of passion fruits in Korea. To our knowledge, this is the first report of persimmon as a host of PLV anywhere in the world, and the first report of PLV in Korea in any host. A further survey is needed to determine possible presence of PLV on persimmon and Passiflora species.

Full-Length Infectious Clones of Two New Isolates of Tomato Mosaic Virus Induce Distinct Symptoms Associated with Two Differential Amino Acid Residues in 128-kDa Protein.

In 2017, two new tomato mosaic virus (ToMV) isolates were collected from greenhouses in Buyeo, Chungcheongnam-do, South Korea. Full-length cDNAs of the new ToMV isolates were cloned into dual cauliflower mosaic virus 35S and T7 promoter-driven vectors, sequenced and their pathogenicities investigated. The nucleotide sequences of isolates GW1 (MH507165) and GW2 (MH507166) were 99% identical, resulting in only two amino acid differences in nonconserved region II and the helicase domain, Ile668Thr and Val834Ile. The two isolates were most closely related to a ToMV isolate from Taiwan (KJ207374). Isolate GW1 (Ile668, Val834) induced a systemic hypersensitive response in Nicotiana benthamiana compared with the isolate GW2, which a single residue substitution showed was due to Val834.

Five Newly Collected Turnip Mosaic Virus (TuMV) Isolates from Jeju Island, Korea are Closely Related to Previously Reported Korean TuMV Isolates but Show Distinctive Symptom Development.

For several years, temperatures in the Korean peninsula have gradually increased due to climate change, resulting in a changing environment for growth of crops and vegetables. An associated consequence is that emerging species of insect vector have caused increased viral transmission. In Jeju Island, Korea, occurrences of viral disease have increased. Here, we report characterization of five newly collected turnip mosaic virus (TuMV) isolates named KBJ1, KBJ2, KBJ3, KBJ4 and KBJ5 from a survey on Jeju Island in 2017. Full-length cDNAs of each isolate were cloned into the pJY vector downstream of cauliflower mosaic virus 35S and bacteriophage T7 RNA polymerase promoters. Their fulllength sequences share 98.9-99.9% nucleotide sequence identity and were most closely related to previously reported Korean TuMV isolates. All isolates belonged to the BR group and infected both Chinese cabbage and radish. Four isolates induced very mild symptoms in Nicotiana benthamiana but KBJ5 induced a hypersensitive response. Symptom differences may result from three amino acid differences uniquely present in KBJ5; Gly(382)Asp, Ile(891)Val, and Lys(2522)Glu in P1, P3, and NIb, respectively.

A Turnip Mosaic Virus Determinant of Systemic Necrosis in Nicotiana benthamiana and a Novel Resistance-Breaking Determinant in Chinese Cabbage Identified from Chimeric Infectious Clones.

Infectious clones of Korean turnip mosaic virus (TuMV) isolates KIH1 and HJY1 share 88.1% genomic nucleotides and 96.4% polyprotein amino acid identity, and they induce systemic necrosis or mild mosaic, respectively, in Nicotiana benthamiana. Chimeric constructs between these isolates exchanged the 5', central, and 3' domains of KIH1 (K) and HJY1 (H), where the order of the letters indicates the origin of these domains. KIH1 and chimeras KHH and KKH induced systemic necrosis, whereas HJY1 and chimeras HHK, HKK, and HKH induced mild symptoms, indicating the determinant of necrosis to be within the 5' 3.9 kb of KIH1; amino acid identities of the included P1, Helper component protease, P3, 6K1, and cylindrical inclusion N-terminal domain were 90.06, 98.91, 93.80, 100, and 100%, respectively. Expression of P1 or P3 from a potato virus X vector yielded symptom differences only between P3 of KIH1 and HJY1, implicating a role for P3 in necrosis in N. benthamiana. Chimera KKH infected Brassica rapa var. pekinensis 'Norang', which was resistant to both KIH1 and HJY1, indicating that two separate TuMV determinants are required to overcome the resistance. Ability of diverse TuMV isolates, chimeras, and recombinants to overcome resistance in breeding lines may allow identification of novel resistance genes.

A single nucleotide change in the overlapping MP and CP reading frames results in differences in symptoms caused by two isolates of Youcai mosaic virus.

Two isolates of Youcai mosaic virus (YoMV) were obtained, and their full-length genomic sequences were determined. Full-length infectious cDNA clones of each isolate were generated in which the viral sequence was under the control of dual T7 and 35S promoters for both in vitro transcript production and agro-infiltration. Comparison of the predicted amino acid sequences of the encoded proteins revealed only four differences between the isolates: three in the RNA-dependent RNA polymerase (RdRp) (V383I and M492I in the 125-kDa protein and T1245M in the 182-kDa protein); and one in the overlapping region of the movement protein (MP) and coat protein (CP) genes, affecting only the N-terminal domain of CP (CP M17T). One of the isolates caused severe symptoms in Nicotiana benthamiana plants, while the other caused only mild symptoms. In order to identify the amino acid residues associated with symptom severity, chimeric constructs were generated by combining parts of the two infectious YoMV clones, and the symptoms in infected plants were compared to those induced by the parental isolates. This allowed us to conclude that the M17T substitution in the N-terminal domain of CP was responsible for the difference in symptom severity. The M17T variation was found to be unique among characterized YoMV isolates. A difference in potential post-translational modification resulting from the presence of a predicted casein kinase II phosphorylation site only in the CP of isolate HK2 may be responsible for the symptom differences.

Sequence Variations Among 17 New Radish Isolates of Turnip mosaic virus Showing Differential Pathogenicity and Infectivity in Nicotiana benthamiana, Brassica rapa, and Raphanus sativus.

Infectious clones were generated from 17 new Korean radish isolates of Turnip mosaic virus (TuMV). Phylogenetic analysis indicated that all new isolates, and three previously characterized Korean radish isolates, belong to the basal-BR group (indicating that the pathotype can infect both Brassica and Raphanus spp.). Pairwise analysis revealed genomic nucleotide and polyprotein amino acid identities of >87.9 and >95.7%, respectively. Five clones (HJY1, HJY2, KIH2, BE, and prior isolate R007) had lower sequence identities than other isolates and produced mild symptoms in Nicotiana benthamiana. These isolates formed three distinct sequence classes (HJY1/HJY2/R007, KIH2, and BE), and several differential amino acid residues (in P1, P3, 6K2, and VPg) were present only in mild isolates HJY1, HJY2, and R007. The remaining isolates all induced systemic necrosis in N. benthamiana. Four mild isolates formed a phylogenetic subclade separate from another subclade including all of the necrosis-inducing isolates plus mild isolate KIH2. Symptom severity in radish and Chinese cabbage genotypes was not correlated with pathogenicity in N. benthamiana; indeed, Chinese cabbage cultivar Norang was not infected by any isolate, whereas Chinese cabbage cultivar Chusarang was uniformly susceptible. Four isolates were unable to infect radish cultivar Iljin, but no specific amino acid residues were correlated with avirulence. These results may lead to the identification of new resistance genes against TuMV.

Generation of an Infectious Clone of a New Korean Isolate of Apple chlorotic leaf spot virus Driven by Dual 35S and T7 Promoters in a Versatile Binary Vector.

The full-length sequence of a new isolate of Apple chlorotic leaf spot virus (ACLSV) from Korea was divergent, but most closely related to the Japanese isolate A4, at 84% nucleotide identity. The full-length cDNA of the Korean isolate of ACLSV was cloned into a binary vector downstream of the bacteriophage T7 RNA promoter and the Cauliflower mosaic virus 35S promoter. Chenopodium quinoa was successfully infected using in vitro transcripts synthesized using the T7 promoter, detected at 20 days post inoculation (dpi), but did not produce obvious symptoms. Nicotiana occidentalis and C. quinoa were inoculated through agroinfiltration. At 32 dpi the infection rate was evaluated; no C. quinoa plants were infected by agroinfiltration, but infection of N. occidentalis was obtained.

Pseudomonas oleovorans Strain KBPF-004 Culture Supernatants Reduced Seed Transmission of Cucumber green mottle mosaic virus and Pepper mild mottle virus, and Remodeled Aggregation of 126 kDa and Subcellular Localization of Movement Protein of Pepper mild mottle virus.

Efforts to control viral diseases in crop production include several types of physical or chemical treatments; antiviral extracts of a number of plants have also been examined to inhibit plant viral infection. However, treatments utilizing naturally selected microorganisms with activity against plant viruses are poorly documented. Here we report isolation of a soil inhabiting bacterium, Pseudomonas oleovorans strain KBPF-004 (developmental code KNF2016) which showed antiviral activity against mechanical transmission of tobamoviruses. Antiviral activity was also evaluated in seed transmission of two tobamoviruses, Pepper mild mottle virus (PMMoV) and Cucumber green mottle mosaic virus (CGMMV), by treatment of seed collected from infected pepper and watermelon, respectively. Pepper and watermelon seeds were treated with culture supernatant of P. oleovorans strain KBPF-004 or control strain ATCC 8062 before planting. Seeds germinated after treatment with water or ATCC 8062 yielded about 60% CGMMV or PMMoV positive plants, whereas < 20% of KBPF-004-treated seeds were virus-infected, a significantly reduced seed transmission rate. Furthermore, supernatant of P. oleovorans strain KBPF-004 remodeled aggregation of PMMoV 126 kDa protein and subcellular localization of movement protein in Nicotiana benthamiana, diminishing aggregation of the 126 kDa protein and essentially abolishing association of the movement protein with the microtubule network. In leaves agroinfiltrated with constructs expressing the coat protein (CP) of either PMMoV or CGMMV, less full-size CP was detected in the presence of supernatant of P. oleovorans strain KBPF-004. These changes may contribute to the antiviral effects of P. oleovorans strain KBPF-004.