RESUMO
BACKGROUND: Biallelic pathogenic variants in USH2A lead to Usher syndrome or non-syndromic retinitis pigmentosa, and shown to have geographical and ethnical distribution in previous studies. This study provided a deeper understanding of the detailed clinical features using multimodal imaging, genetic spectrum, and genotype-phenotype correlations of USH2A-related retinal dystrophies in Taiwan. RESULTS: In our cohort, the mean age at first visit was 47.66 ± 13.54 years, and the mean age at symptom onset, which was referred to the onset of nyctalopia and/or visual field constriction, was 31.21 ± 15.24 years. Among the variants identified, 23 (50%) were missense, 10 (22%) were splicing variants, 8 (17%) were nonsense, and 5 (11%) were frameshift mutations. The most predominant variant was c.2802T>G, which accounted for 21% of patients, and was located in exon 13. Patients with truncated alleles had significantly earlier symptom onset and seemly poorer disease progression regarding visual acuity, ellipsoid zone line length, and hypofluorescent lesions in the macula than those who had the complete gene. However, the clinical presentation revealed similar progression between patients with and without the c.2802T>G variant. During long-term follow-up, the patients had different ellipsoid zone line progression rates and were almost evenly distributed in the fast, moderate, and slow progression subgroups. Although a younger onset age and a smaller baseline intact macular area was observed in the fast progression subgroup, the results showed no significant difference. CONCLUSIONS: This is the first cohort study to provide detailed genetic and longitudinal clinical analyses of patients with USH2A-related retinal dystrophies in Taiwan. The mutated allele frequency in exon 13 was high in Taiwan due to the predominant c.2802T>G variant. Moreover, truncated variants greatly impacted disease progression and determined the length of therapeutic windows. These findings provide insight into the characteristics of candidates for future gene therapies.
Assuntos
Éxons , Proteínas da Matriz Extracelular , Distrofias Retinianas , Adulto , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Adulto Jovem , Éxons/genética , Proteínas da Matriz Extracelular/genética , Prevalência , Distrofias Retinianas/genética , Distrofias Retinianas/patologia , Taiwan , Síndromes de Usher/genéticaRESUMO
BACKGROUND: ABO-nonidentical platelets transfusion has been frequently employed to address clinical platelets insufficiencies. The significance of ABO compatibility for platelets transfusion is not clearly defined. This study is aimed to explore the transfusion outcomes and clinical safety of ABO-nonidentical platelets transfusion. STUDY DESIGN AND METHODS: A systematic articles search was performed for eligible studies published up to November 30, 2023 through the PubMed, Embase, Cochrane library, Chinese National Knowledge Infrastructure database, Wanfang database and SinMed. Meta-analysis Of Observational Studies in Epidemiology study guidelines for observational studies and Newcastle Ottawa bias scale were implemented to assess studies. Meta-analysis was performed using Manager 5.3. This study is registered with PROSPERO, number CRD42023417824. RESULTS: A total of 11 retrospective cohort studies and 7 prospective cohort studies with a sample size of 104,359 platelets transfusions were included. There was significant difference in transfusion effectiveness between the ABO-identical and ABO-nonidentical platelets transfusions (RR 1.20, 95 % CI 1.11-1.38, P < 0.00001, I2 = 21 %), also the ABO-identical platelets transfusions showed more platelets increment than ABO-nonidentical ones, but it was not statistically significant (MD 0.34, 95 % CI - 0.01 to 0.70, P = 0.06, I2 = 0 %). Allergy and fever occurred more in ABO-nonidentical platelets transfusions in terms of adverse reactions (RR 0.63, 95 % CI 0.41-0.96, P = 0.03, I2 = 0 %; RR 0.59, 95 % CI 0.37-0.94, P = 0.03, I2 = 31 %). When it comes to the mortality, the ABO-identical platelets transfusions did not statistically improve survival in patients who received multiple platelets transfusions (RR 0.77, 95 % CI 0.72-0.83, P = 0.17, I2 = 38 %) and who only received less than 3 transfusions (RR 0.74, 95 % CI 0.52-1.06, P = 0.10, I2 = 47 %) compared with the ABO-nonidentical platelets transfusions. CONCLUSION: In comparison to ABO-identical platelets transfusions, nonidentical platelets transfusions exhibited lower transfusion efficacy. However, the clinical safety between these two groups was similar, which indicated that ABO-nonidentical transfusions are acceptable, albeit inferior to ABO-identical ones.
RESUMO
CD36 may defect on platelets and/or monocytes in healthy individuals, which was defined as CD36 deficiency. However, we did not know the correlation between the molecular and protein levels completely. Here, we aim to determine the polymorphisms of the CD36 gene, RNA level, and CD36 on platelets and in plasma. The individuals were sequenced by Sanger sequencing. Bioinformational analysis was used by the HotMuSiC, CUPSAT, SAAFEC-SEQ, and FoldX. RNA analysis and CD36 protein detection were performed by qPCR, flow cytometry, and ELISA. In this study, we found c.1228_1239delATTGTGCCTATT (allele frequency = 0.0072) with the highest frequency among our cohort, and one mutation (c.1329_1354dupGATAGAAATGATCTTACTCAGTGTTG) was not present in the dbSNP database. 5 mutations located in the extracellular domain sequencing region with confirmation in deficient individuals, of which c.284T>C, c.512A>G, c.572C>T, and c.869T>C were found to have a deleterious impact on CD36 protein stability. Furthermore, the MFI of CD36 expression on platelets in the mutation-carry, deleterious-effect, and deficiency group was significantly lower than the no-mutation group (P < 0.0500). In addition, sCD36 levels in type II individuals were significantly lower compared with positive controls (P = 0.0060). Nevertheless, we found the presence of sCD36 in a type I individual. RNA analysis showed CD36 RNA levels in platelets of type II individuals were significantly lower than the positive individuals (P = 0.0065). However, no significant difference was observed in monocytes (P = 0.7500). We identified the most prevalent mutation (c.1228_1239delATTGTGCCTATT) among Kunming donors. Besides, our results suggested RNA level alterations could potentially underlie type II deficiency. Furthermore, sCD36 may hold promise for assessing immune reaction risk in CD36-deficient individuals, but more studies should be conducted to validate this hypothesis.
Assuntos
Transtornos Plaquetários , Antígenos CD36 , Humanos , Antígenos CD36/genética , Plaquetas , Bases de Dados Factuais , RNARESUMO
Taiwan, frequently affected by extreme weather causing phenomena such as earthquakes and typhoons, faces a high incidence of rockfall disasters due to its largely mountainous terrain. These disasters have led to numerous casualties, government compensation cases, and significant transportation safety impacts. According to the National Science and Technology Center for Disaster Reduction records from 2010 to 2022, 421 out of 866 soil and rock disasters occurred in eastern Taiwan, causing traffic disruptions due to rockfalls. Since traditional sensors of disaster detectors only record changes after a rockfall, there is no system in place to detect rockfalls as they occur. To combat this, a rockfall detection and tracking system using deep learning and image processing technology was developed. This system includes a real-time image tracking and recognition system that integrates YOLO and image processing technology. It was trained on a self-collected dataset of 2490 high-resolution RGB images. The system's performance was evaluated on 30 videos featuring various rockfall scenarios. It achieved a mean Average Precision (mAP50) of 0.845 and mAP50-95 of 0.41, with a processing time of 125 ms. Tested on advanced hardware, the system proves effective in quickly tracking and identifying hazardous rockfalls, offering a significant advancement in disaster management and prevention.
RESUMO
Sodium-based dual ion batteries (SDIBs) have garnered significant attention as novel energy storage devices offering the advantages of high-voltage and low-cost. Nonetheless, conventional electrolytes exhibit low resistance to oxidation and poor compatibility with electrode materials, resulting in rapid battery failure. In this study, for the first time, a chlorination design of electrolytes for SDIB, is proposed. Using ethyl methyl carbonate (EMC) as a representative, chlorine (Cl)-substituted EMC not only demonstrates increased oxidative stability ascribed to the electron-withdrawing characteristics of chlorine atom, electrolyte compatibility with both the cathode and anode is also greatly improved by forming Cl-containing interface layers. Consequently, a discharge capacity of 104.6 mAh g-1 within a voltage range of 3.0-5.0 V is achieved for Na||graphite SDIB that employs a high graphite cathode mass loading of 5.0 mg cm-2, along with almost no capacity decay after 900 cycles. Notably, the Na||graphite SDIB can be revived for an additional 900 cycles through the replacement of a fresh Na anode. As the mass loading of graphite cathode increased to 10 mg cm-2, Na||graphite SDIB is still capable of sustaining over 700 times with ≈100% capacity retention. These results mark the best outcome among reported SDIBs. This study corroborates the effectiveness of chlorination design in developing high-voltage electrolytes and attaining enduring cycle stability of Na-based energy storage devices.
RESUMO
BACKGROUND: Rheumatoid arthritis (RA) is an autoimmune disease characterized by inflammatory reactions and tissue damage in the joints. Long-term drug use in clinical practice is often accompanied by adverse reactions. Extracorporeal photopheresis (ECP) is an immunomodulatory therapy with few side effects, offering a potential and safe therapeutic alternative for RA through the induction of immune tolerance. This study aimed to investigate the therapeutic effects of ECP on RA using a collagen-induced arthritis (CIA) murine model, as well as to explore its immunomodulatory effects in vivo. Additionally, particular attention was given to the significant role of monocytes during the ECP process. METHODS: A murine model of rheumatoid arthritis was established by administering two injections of bovine type II collagen to DBA/1J mice. ECP, ECP-MD (mononuclear cells were depleted during the ECP), MTX, and PBS treatment were applied to the CIA mice. During the treatment process, clinical scores and body weight changes of CIA mice were closely monitored. After six treatment sessions, micro-CT images of the hind paws from live mice were captured. Ankle joints and paws of the mice were collected and processed for histological evaluation. Spleen samples were collected to measure the Th17/Treg cells ratio, and serum samples were collected to assess cytokine and anti-type II collagen IgG levels. Monocytes and dendritic cells populations before and after ECP in vitro were detected by flow cytometry. RESULT: ECP therapy significantly attenuated the progression of CIA, alleviated the severity of clinical symptoms in CIA mice and effectively suppressed synovial hyperplasia, inflammation, and cartilage damage. There was an expansion in the percentage of CD3 + CD4 + CD25 + FoxP3 + Tregs and a decrease in CD3 + CD4 + IL17A + Th17 cells in vivo. Furthermore, ECP reduced the serum levels of pro-inflammatory cytokines IL-6 (53.47 ± 7.074 pg/mL vs 5.142 ± 1.779 pg/mL, P < 0.05) and IL-17A (3.077 ± 0.401 pg/mL vs 0.238 ± 0.082 pg/mlL, P < 0.0001) compared with PBS. Interestingly, the depletion of monocytes during the ECP process did not lead to any improvement in clinical symptoms or histological scores in CIA mice. Moreover, the imbalance in the Th17/Treg cells ratio became even more pronounced, accompanied by an augmented secretion of pro-inflammatory cytokines IL-6 and IL-17A. In vitro, compared with cells without ECP treatment, the proportion of CD11b + cells were significantly reduced (P < 0.01), the proportion of CD11c + cells were significantly elevated (P < 0.001) 24 h after ECP treatment. Additionally, the expression of MHC II (P < 0.0001), CD80 (P < 0.01), and CD86 (P < 0.001) was downregulated in CD11c + cells 24 h after ECP treatment. CONCLUSION: Our study demonstrates that ECP exhibits a therapeutic effect comparable to conventional therapy in CIA mice, and the protective mechanisms of ECP against RA involve Th17/Treg cells ratio, which result in decreased IL-6 and IL-17A. Notably, monocytes derived from CIA mice are an indispensable part to the efficacy of ECP treatment, and the proportion of monocytes decreased and the proportion of tolerogenic dendritic cells increased after ECP treatment in vitro.
Assuntos
Artrite Experimental , Artrite Reumatoide , Fotoferese , Camundongos , Animais , Bovinos , Interleucina-17/metabolismo , Modelos Animais de Doenças , Interleucina-6 , Camundongos Endogâmicos DBA , Artrite Reumatoide/tratamento farmacológico , Inflamação , Citocinas/metabolismo , Artrite Experimental/terapia , Colágeno Tipo II , Linfócitos T Reguladores , Células Th17RESUMO
Background: Zuranolone is recognised as a promising antidepressant agent. Our study aimed to investigate the efficacy and safety of zuranolone in treating major depressive disorder (MDD). Methods: A systematic review was conducted by searching major databases from inception to August 20, 2023 (INPLASY: 202360087). A meta-analysis was performed by using a random-effects model to calculate effect sizes, expressed as standardised mean differences (SMDs) and odds ratios (ORs) with 95% confidence intervals (CIs). The primary outcome was improvement in depressive symptoms, while secondary outcomes included response and remission rates of depression, improvement in anxiety symptoms, incidence of dropouts, and any side effects. We conducted subgroup analyses for general MDD and postpartum-onset MDD and a dose-response meta-analysis to estimate the relationship between zuranolone dose and outcomes. Findings: The study included seven randomised control trials involving 1789 patients. Zuranolone reduced depressive symptoms (SMD = -0.37, 95% CIs = -0.51 to -0.23), increased response rate (OR = 2.06, 95% CIs = 1.48-2.85) and remission rate (OR = 2.04, 95% CIs = 1.38-3.02), and reduced anxiety symptoms (SMD = -0.26, 95% CIs = -0.39 to -0.14). Furthermore, zuranolone-treated patients experienced more side effects than those in the control group (OR = 1.40, 95% CIs = 1.10-1.78), although dropout rate did not significantly differ between the two groups (OR = 1.13, 95% CIs = 0.85-1.49). According to the dose-response meta-analysis, zuranolone could effectively improve depression and anxiety at increasing doses up to a maximum daily dose of 30 mg; however, side effects increased with doses exceeding 30 mg. Based on subgroup analyses, zuranolone showed greater efficacy in treatment of postpartum-onset MDD than general MDD, but the difference did not reach statistical significance. Interpretation: Our findings suggested that zuranolone is effective in alleviating depression and anxiety. Nevertheless, there is a potential risk of adverse effects. Given its therapeutic efficacy and risk of side effects, a daily dose of 30 mg appears to be the optimal choice. Funding: Chang Gung Medical Foundation.
RESUMO
Hepatoma-derived growth factor (HDGF) overexpression and uncontrolled reactive oxygen species (ROS) accumulation are involved in malignant transformation and poor prognosis in various types of cancer. However, the interplay between HDGF and ROS generation has not been elucidated in hepatocellular carcinoma. Here, we first analyzed the profile of HDGF expression and ROS production in newly generated orthotopic hepatomas by ultrasound-guided implantation. In situ superoxide detection showed that HDGF-overexpressing hepatomas had significantly elevated ROS levels compared with adjacent nontumor tissues. Consistently, liver tissues from HDGF-deficient mice exhibited lower ROS fluorescence than those from age- and sex-matched WT mice. ROS-detecting fluorescent dyes and flow cytometry revealed that recombinant HDGF (rHDGF) stimulated the production of superoxide anion, hydrogen peroxide, and mitochondrial ROS generation in cultured hepatoma cells in a dose-dependent manner. In contrast, the inactive Ser103Ala rHDGF mutant failed to promote ROS generation or oncogenic behaviors. Seahorse metabolic flux assays revealed that rHDGF dose dependently upregulated bioenergetics through enhanced basal and total oxygen consumption rate, extracellular acidification rate, and oxidative phosphorylation in hepatoma cells. Moreover, antioxidants of N-acetyl cysteine and MitoQ treatment significantly inhibited HDGF-mediated cell proliferation and invasive capacity. Genetic silencing of superoxide dismutase 2 augmented the HDGF-induced ROS generation and oncogenic behaviors of hepatoma cells. Finally, genetic knockdown nucleolin (NCL) and antibody neutralization of surface NCL, the HDGF receptor, abolished the HDGF-induced increase in ROS and mitochondrial energetics. In conclusion, this study has demonstrated for the first time that the HDGF/NCL signaling axis induces ROS generation by elevating ROS generation in mitochondria, thereby stimulating liver carcinogenesis.
Assuntos
Carcinoma Hepatocelular , Animais , Camundongos , Carcinoma Hepatocelular/genética , Carcinoma Hepatocelular/patologia , Espécies Reativas de Oxigênio , Carcinogênese/genéticaRESUMO
Selective autophagy is a defense mechanism by which foreign pathogens and abnormal substances are processed to maintain cellular homeostasis. Sequestosome 1 (SQSTM1)/p62, a vital selective autophagy receptor, recruits ubiquitinated cargo to form autophagosomes for lysosomal degradation. Nab-PTX is an albumin-bound paclitaxel nanoparticle used in clinical cancer therapy. However, the role of SQSTM1 in regulating the delivery and efficacy of nanodrugs remains unclear. Here we showed that SQSTM1 plays a crucial role in Nab-PTX drug delivery and efficacy in human lung and colorectal cancers. Nab-PTX induces SQSTM1 phosphorylation at Ser403, which facilitates its incorporation into the selective autophagy of nanoparticles, known as nanoparticulophagy. Nab-PTX increased LC3-II protein expression, which triggered autophagosome formation. SQSTM1 enhanced Nab-PTX recognition to form autophagosomes, which were delivered to lysosomes for albumin degradation, thereby releasing PTX to induce mitotic catastrophe and apoptosis. Knockout of SQSTM1 downregulated Nab-PTX-induced mitotic catastrophe, apoptosis, and tumor inhibition in vitro and in vivo and inhibited Nab-PTX-induced caspase 3 activation via a p53-independent pathway. Ectopic expression of SQSTM1 by transfection of an SQSTM1-GFP vector restored the drug efficacy of Nab-PTX. Importantly, SQSTM1 is highly expressed in advanced lung and colorectal tumors and is associated with poor overall survival in clinical patients. Targeting SQSTM1 may provide an important strategy to improve nanodrug efficacy in clinical cancer therapy. This study demonstrates the enhanced efficacy of Nab-PTX for human lung and colorectal cancers via SQSTM1-mediated nanodrug delivery.
RESUMO
Steatosis is the hepatic manifestation of metabolic syndrome (MetS) and its developing is closely associated with insulin resistance. Shortened sleep has adverse effects on hepatic steatosis and the underlying mechanism remains unknown. We conceived to evaluate whether sleep duration was a lifestyle factor modifying the association between insulin resistance and hepatic steatosis and whether it was varied in different status of metabolic disturbances. We performed a cross-sectional analysis on 2264 adults of United States representing a population of 138,319,512 with MetS or pre-MetS from National Health and Nutrition Examination Survey (NHANES) 2017-March 2020. Participants underwent hepatic transient elastography and laboratory tests. The sleep duration was obtained from interviews. Results showed that insulin resistance was significantly associated with hepatic steatosis among participants with metabolic disturbances (OR = 1.85, 95% CI: 1.30-2.65). Significant moderation of sleep duration on the association between insulin resistance and hepatic steatosis was observed when sleep duration was dichotomized by 6.5- (P = 0.042) or 9.5-hour (P = 0.031). The risk of hepatic steatosis associated with insulin resistance was increased when sleep duration was ≤ 6.5 h and > 9.5 h. Furthermore, the moderation effect of 6.5-hour sleeping was only significant among participants with pre-MetS while that of 9.5-hour sleeping was only significant among participants with MetS. In conclusion, insufficient or excessive sleep increased the risk of hepatic steatosis associated with insulin resistance. Appropriate sleep duration was advocated and varied in different status of metabolic disturbances. Ensuring adequate sleep should be highlighted before MetS occurs and excessive sleep should be prevented for participants with MetS.
RESUMO
Esophageal squamous cell carcinoma (ESCC), one of the most lethal cancers, has become a global health issue. Stearoyl-coA desaturase 1 (SCD1) has been demonstrated to play a crucial role in human cancers. However, pan-cancer analysis has revealed little evidence to date. In the current study, we systematically inspected the expression patterns and potential clinical outcomes of SCD1 in multiple human cancers. SCD1 was dysregulated in several types of cancers, and its aberrant expression acted as a diagnostic biomarker, indicating that SCD1 may play a role in tumorigenesis. We used ESCC as an example to demonstrate that SCD1 was dramatically upregulated in tumor tissues of ESCC and was associated with clinicopathological characteristics in ESCC patients. Furthermore, Kaplan-Meier analysis showed that high SCD1 expression was correlated with poor progression-free survival (PFS) and disease-free survival (DFS) in ESCC patients. The protein-protein interaction (PPI) network and module analysis by PINA database and Gephi were performed to identify the hub targets. Meanwhile, the functional annotation analysis of these hubs was constructed by Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses. Functionally, the gain-of-function of SCD1 in ESCC cells promoted cell proliferation, migration, and invasion; in contrast, loss-of-function of SCD1 in ESCC cells had opposite effects. Bioinformatic, QPCR, Western blotting and luciferase assays indicated that SCD1 was a direct target of miR-181a-5p in ESCC cells. In addition, gain-of-function of miR-181a-5p in ESCC cells reduced the cell growth, migratory, and invasive abilities. Conversely, inhibition of miR-181a-5p expression by its inhibitor in ESCC cells had opposite biological effects. Importantly, reinforced SCD1 in miR-181a-5p mimic ESCC transfectants reversed miR-181a-5p mimic-prevented malignant phenotypes of ESCC cells. Taken together, these results indicate that SCD1 expression influences tumor progression in a variety of cancers, and the miR-181a-5p/SCD1 axis may be a potential therapeutic target for ESCC treatment.
RESUMO
Obesity, a global pandemic posing a growing threat to human health, necessitates the development of effective and safe anti-obesity agents. Our previous studies highlighted the lipid-lowering effects of indolylquinazoline Bouchardatine and its derivatives. In this study, we employed scaffold hopping and simplification strategies to design and synthesize two new series derivatives by modifying the D ring. Extensive discussions have been conducted regarding the structure-activity relationship between lipid-lowering activity and the new compounds. These discussions have resulted in the discovery of 2-pyrimidinylindole derivatives as a promising scaffold for anti-obesity treatment. The new 2-pyrimidinylindole derivatives exhibited comparable lipid-lowering activity to the previously reported indolylquinazoline derivatives, including SYSU-3d and R17, with reduced toxicity. The most potent compound, 5a, demonstrated a larger therapeutic index, improved aqueous solubility and oral bioavailability compared to the previous lead compounds. In vivo evaluation indicated that 5a effectively reduced lipid accumulation in adipose tissue, improved glucose tolerance, and mitigated insulin resistance and liver function damage caused by a high-fat and high-cholesterol diet. Mechanism studies indicated that 5a may regulate lipid metabolism through the modulation of the PPARγ signaling pathway. Overall, our study has identified a highly active compound 5a, and provided the basis for further development of 2-pyrimidinylindole as a promising scaffold for obesity treatment.
Assuntos
Fármacos Antiobesidade , Hipercolesterolemia , Humanos , Metabolismo dos Lipídeos , Fármacos Antiobesidade/farmacologia , Disponibilidade Biológica , Obesidade/tratamento farmacológico , LipídeosRESUMO
Importance: There are limited prognostic statistics and data available on survival outcomes for patients with mycosis fungoides (MF) in Asia. Objective: To determine the prognostic factors and survival outcomes of patients with MF among a cohort in China. Design, Setting, and Participants: This was a retrospective cohort study of patients with MF who received treatment at a tertiary referral center for skin lymphoma (Peking University First Hospital, Beijing, China) from August 1, 2009, to August 31, 2021. Data were analyzed from September 1, 2021, to December 31, 2022. Main Outcomes and Measures: Overall survival (OS), disease-specific survival (DSS), and progression-free survival (PFS); for prognostic factors, hazard ratios (HRs), and adjusted HRs (aHRs; adjusted for sex, age, and overall TNMB [tumor, node, metastasis, blood] stage) determined using the Cox proportional hazards model. Results: The study cohort comprised 461 patients with MF (median [range] age at diagnosis, 46 [5-87] years; 275 [59.7%] men and 186 [40.3%] women; 461 [100%] Chinese). The overall 5-year rate was 82.2% for OS, 83.5% for DSS, and 79.6% for PFS. Stage-specific 5-year OS rates were 95.7% for stage IA, 93.2% for IB, 95.7% for IIA, 70.1% for IIB, 55.3% for III, and 23.6% for IV. Compared with a UK cohort, our Chinese cohort had a younger median age at diagnosis (46 years vs 54 years) and a more favorable 5-year OS (82.2% vs 75.0%); however, after adjusting for age, the discrepancy in the 5-year OS rate was diminished (77.3% vs 76.4%). Cox models revealed that unfavorable predictors of OS, PFS, and DSS, respectively, were: age older than 60 years (aHR [95% CI], 2.25 [1.28-3.96]; 2.09 [1.16-3.76]; 2.27 [1.39-3.72]); advanced TNMB stage; advanced overall stage; large-cell transformation (aHR [95% CI], 2.16 [1.17-3.99]; 2.29 [1.21-4.33]; 2.21 [1.26-3.86]); and elevated lactate dehydrogenase levels (aHR [95% CI], 3.92 [1.64-9.36]; 4.77 [1.86-12.22]; 5.05 [2.23-11.42]). Biological sex and plaque lesion type were not associated with prognosis among this study cohort. Conclusion and Relevance: The findings of this retrospective cohort study of patients with MF in China suggest that Asian patients are diagnosed at a younger age and have a higher 5-year OS compared with patients of other races in studies in other countries (predominantly White). Prognostic factors were similar to those of previous studies, except for patient sex and plaque lesion type.
Assuntos
Micose Fungoide , Síndrome de Sézary , Neoplasias Cutâneas , Masculino , Humanos , Feminino , Pré-Escolar , Criança , Adolescente , Adulto Jovem , Adulto , Pessoa de Meia-Idade , Idoso , Idoso de 80 Anos ou mais , Prognóstico , Síndrome de Sézary/patologia , Estudos Retrospectivos , Estadiamento de Neoplasias , Progressão da Doença , Micose Fungoide/diagnóstico , Neoplasias Cutâneas/patologia , China/epidemiologiaRESUMO
OBJECTIVES: Antimicrobial resistance is a major global threat. Because of the stagnant antibiotic pipeline, synergistic antibiotic combination therapy has been proposed to treat rapidly emerging multidrug-resistant (MDR) pathogens. We investigated antimicrobial synergy of polymyxin/rifampicin combination against MDR Acinetobacter baumannii. METHODS: In vitro static time-kill studies were performed over 48 h at an initial inoculum of â¼107 CFU/mL against three polymyxin-susceptible but MDR A. baumannii isolates. Membrane integrity was examined at 1 and 4 h post-treatment to elucidate the mechanism of synergy. Finally, a semi-mechanistic PK/PD model was developed to simultaneously describe the time course of bacterial killing and prevention of regrowth by mono- and combination therapies. RESULTS: Polymyxin B and rifampicin alone produced initial killing against MDR A. baumannii but were associated with extensive regrowth. Notably, the combination showed synergistic killing across all three A. baumannii isolates with bacterial loads below the limit of quantification for up to 48 h. Membrane integrity assays confirmed the role of polymyxin-driven outer membrane remodelling in the observed synergy. Subsequently, the mechanism of synergy was incorporated into a PK/PD model to describe the enhanced uptake of rifampicin due to polymyxin-induced membrane permeabilisation. Simulations with clinically utilised dosing regimens confirmed the therapeutic potential of this combination, particularly in the prevention of bacterial regrowth. Finally, results from a neutropenic mouse thigh infection model confirmed the in vivo synergistic killing of the combination against A. baumannii AB5075. CONCLUSION: Our results showed that polymyxin B combined with rifampicin is a promising option to treat bloodstream and tissue infection caused by MDR A. baumannii and warrants clinical evaluations.
Assuntos
Acinetobacter baumannii , Polimixina B , Animais , Camundongos , Polimixina B/farmacologia , Rifampina/farmacologia , Polimixinas/farmacologia , Sinergismo Farmacológico , Farmacorresistência Bacteriana Múltipla , Testes de Sensibilidade Microbiana , Antibacterianos/farmacologiaRESUMO
Camptothecin (CPT) has been shown to exhibit anticancer activity against several cancers. Nevertheless, CPT is very hydrophobic with poor stability, and thus its medical application is limited. Therefore, various drug carriers have been exploited for effectively delivering CPT to the targeted cancer site. In this study, a dual pH/thermo-responsive block copolymer of poly(acrylic acid-b-N-isopropylacrylamide) (PAA-b-PNP) was synthesized and applied to encapsulate CPT. At temperatures above its cloud point, the block copolymer self-assembled to form nanoparticles (NPs) and in situ encapsulate CPT, owing to their hydrophobic interaction as evidenced by fluorescence spectrometry. Chitosan (CS) was further applied on the surface through the formation of a polyelectrolyte complex with PAA for improving biocompatibility. The average particle size and zeta potential of the developed PAA-b-PNP/CPT/CS NPs in a buffer solution were 168 nm and -30.6 mV, respectively. These NPs were still stable at least for 1 month. The PAA-b-PNP/CS NPs exhibited good biocompatibility toward NIH 3T3 cells. Moreover, they could protect the CPT at pH 2.0 with a very slow-release rate. At pH 6.0, these NPs could be internalized by Caco-2 cells, followed by intracellular release of the CPT. They became highly swollen at pH 7.4, and the released CPT was able to diffuse into the cells at higher intensity. Among several cancer cell lines, the highest cytotoxicity was observed for H460 cells. As a result, these environmentally-responsive NPs have the potential to be applied in oral administration.
RESUMO
Background We aimed to assess the predictive performance of C-reactive protein (hsCRP), procalcitonin (PCT), and interleukin-6 (IL-6) at different times points of bloodstream infections (BSI) management. Methods The cases were collected from January 2020 to June 2021 in the First Affiliated Hospital of Xinjiang Medical University (n=185). We collected patients records of hsCRP, PCT, and IL-6 serum levels and calculated the clearance of these biomarkers on day 1, day 3, and day 5 (hsCRP-1, hsCRP-3, hsCRP-5, so do PCT, and IL-6). We analyzed these predictive performances for 30-day mortality with ROC and Logistic regression. The correlation between biomarkers and their clearance rates was performed by a rank correlation method. Results The 30-day mortality was 11.35% (21/185). Serial serum hsCRP-3, IL-6-3, PCT-1, PCT-3, and PCT-5 were statistically higher in BSI mortality than survivors. Significant predictive ability was found for 30-day mortality with blood culture (BC) reported fungi (OR, 0.033; 95% CI: 0.0020.535) and PCT-5 (OR, 1.045; 95% CI: 1.0131.078) levels, respectively. The AUC of PCT-5 levels for 30-day mortality was 0.784 (95% CI 0.6780.949), and the cut-off value was 5.455ng/mL. Conclusions PCT-5 is more valuable for the prognosis of 30-day mortality in patients with BSI compared to the other inflammatory biomarkers (AU)
Antecedentes Nuestro objetivo fue evaluar el rendimiento predictivo de la proteína C reactiva (hsCRP), procalcitonina (PCT) e interleucina-6 (IL-6) en distintos momentos del tratamiento de pacientes con infecciones del torrente sanguíneo. Métodos Los casos se recogieron entre enero de 2020 y junio de 2021 en el Primer Hospital Afiliado de la Universidad Médica de Xinjiang (n = 185). Los valores de los niveles séricos de hsCRP, PCT e IL-6 se obtuvieron de los registros de los pacientes y calculamos la depuración de estos biomarcadores en el día 1, el día 3 y el día 5 (hsCRP-1, hsCRP-3, hsCRP-5, PCT e IL-6). Analizamos estos rendimientos predictivos para la mortalidad a 30 días con ROC y regresión logística. La correlación entre los biomarcadores y sus tasas de eliminación se realizó mediante un método de correlación de rangos. Resultados La mortalidad a 30 días fue de 11,35% (21/185). Los valores séricos seriados de hsCRP-3, IL-6-3, PCT-1, PCT-3 y PCT-5 fueron estadísticamente más elevados en los pacientes fallecidos de infecciones del torrente sanguíneo que en los supervivientes. Se halló una capacidad predictiva significativa para la mortalidad por hongos (OR, 0,033; IC 95%: 0,002-0,535) y el valor de PCT-5 (OR, 1.045; IC 95%: 1.013-1.078), respectivamente. El AUC de los niveles de PCT-5 para la mortalidad a 30 días fue de 0,784 (IC 95%: 0,678-0,949), y el valor de corte fue de 5.455 ng/mL. Conclusiones La PCT-5 fue un parámetro de más valor para el pronóstico de mortalidad a 30 días en pacientes con infecciones del torrente sanguíneo en comparación con los demás biomarcadores inflamatorios (AU)
Assuntos
Humanos , Masculino , Feminino , Idoso , Bacteriemia/sangue , Bacteriemia/mortalidade , Proteína C-Reativa/análise , Pró-Calcitonina/sangue , Interleucina-6/sangue , Valor Preditivo dos Testes , Biomarcadores/sangue , PrognósticoRESUMO
Mitochondria have a crucial role in regulating energy metabolism and their dysfunction has been linked to tumorigenesis. Cancer diagnosis and intervention have a great interest in the development of new agents that target biomolecules within mitochondria. However, monitoring and modulating mitochondria RNA (mtRNA), an essential component in mitochondria, in cells is challenging due to limited functional research and the absence of targeting agents. In this study, we designed and synthesized a fluorescent quinolinium derivative, QUCO-1, which actively lit up with mtRNA in both normal and cancer cells in vitro. Additionally, we evaluated the function of QUCO-1 as an mtRNA ligand and found that it effectively induced severe mitochondrial dysfunction and OXPHOS inhibition in RKO colorectal cancer cells. Treatment with QUCO-1 resulted in apoptosis, cell cycle blockage at the G2/M phase, and the effective inhibition of cell proliferation. Our findings suggest that QUCO-1 has great potential as a promising probe and therapeutic agent for mtRNA, with the potential for treating colorectal cancer.
Assuntos
Neoplasias Colorretais , Mitocôndrias , Humanos , RNA Mitocondrial/metabolismo , Mitocôndrias/metabolismo , Proliferação de Células , Apoptose , Corantes Fluorescentes/farmacologia , Neoplasias Colorretais/tratamento farmacológico , Neoplasias Colorretais/genética , Neoplasias Colorretais/metabolismo , Linhagem Celular TumoralRESUMO
BACKGROUND: We aimed to assess the predictive performance of C-reactive protein (hsCRP), procalcitonin (PCT), and interleukin-6 (IL-6) at different times points of bloodstream infections (BSI) management. METHODS: The cases were collected from January 2020 to June 2021 in the First Affiliated Hospital of Xinjiang Medical University (n=185). We collected patients' records of hsCRP, PCT, and IL-6 serum levels and calculated the clearance of these biomarkers on day 1, day 3, and day 5 (hsCRP-1, hsCRP-3, hsCRP-5, so do PCT, and IL-6). We analyzed these predictive performances for 30-day mortality with ROC and Logistic regression. The correlation between biomarkers and their clearance rates was performed by a rank correlation method. RESULTS: The 30-day mortality was 11.35% (21/185). Serial serum hsCRP-3, IL-6-3, PCT-1, PCT-3, and PCT-5 were statistically higher in BSI mortality than survivors. Significant predictive ability was found for 30-day mortality with blood culture (BC) reported fungi (OR, 0.033; 95% CI: 0.002-0.535) and PCT-5 (OR, 1.045; 95% CI: 1.013-1.078) levels, respectively. The AUC of PCT-5 levels for 30-day mortality was 0.784 (95% CI 0.678-0.949), and the cut-off value was 5.455ng/mL. CONCLUSIONS: PCT-5 is more valuable for the prognosis of 30-day mortality in patients with BSI compared to the other inflammatory biomarkers.
Assuntos
Proteína C-Reativa , Sepse , Humanos , Proteína C-Reativa/análise , Pró-Calcitonina , Interleucina-6 , Biomarcadores , Curva ROC , Estudos RetrospectivosRESUMO
BACKGROUND: The increasing emergence of antimicrobial resistance worldwide has led to renewed interest in phage therapy. Unlike antibiotics, the lack of pharmacokinetics/pharmacodynamics (PK/PD) information represents a major challenge for phage therapy. As therapeutic phages are biological entities with the ability to self-replicate in the presence of susceptible bacteria, their PK/PD is far more complicated than that of antibiotics. OBJECTIVES: This narrative review examines the current literature on phage pharmacology and highlights major pharmacological challenges for phage therapy. SOURCES: Included articles were identified by searching PubMed and Google Scholar till June 2022. The search terms were 'bacteriophage', 'antimicrobial', 'pharmacokinetics' and 'pharmacodynamics'. Additional relevant references were obtained from articles retrieved from the primary search. CONTENT: In this review, phage PK is first discussed, focusing on absorption, distribution, metabolism, and elimination. Key factors affecting phage antimicrobial activities are reviewed, including multiplicity of infection, passive and active phage therapy, and the involvement of the human immune system. Importantly, we emphasize the impact of phage self-replication on the PK/PD and the fundamental phage characteristics that are required for PK/PD modelling and clinical translation. IMPLICATIONS: Recent progress in phage pharmacology has shown that we are in a far better position now to treat infections with phage therapy than a century ago. However, phage therapy is still in its infancy when compared to antibiotics due to the scarce pharmacological knowledge (e.g. PK/PD). Optimization of phage PK/PD is key for translation of phage therapy in patients.