First Report of Tomato chlorotic spot virus Infecting Tomatoes in Ohio.

Virus-like symptoms including deformation, discoloration, and necrotic ringspots on green and red fruits of tomato (Solanum lycopersicum L. cv. Big Dena) were observed in a 400 m2 commercial high tunnel in Wayne Co., Ohio, in July and August 2013. No symptoms were observed on leaves. Incidence of symptomatic fruits was approximately 15%. Tomato seedlings transplanted into the high tunnel were produced in a greenhouse containing ornamental plants. The grower observed high levels of thrips infestation in the tomato seedlings prior to transplanting. A tospovirus was suspected as a possible causal agent. Four symptomatic fruits were tested using immunostrip tests for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) (Agdia, Inc., Elkhart, IN), a double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) for Groundnut ringspot virus (GRSV)/Tomato chlorotic spot virus (TCSV) (Agdia, Inc., Elkhart, IN), and DAS-ELISA for TCSV (AC Diagnostics Inc., Fayetteville, AR). All of the symptomatic fruits tested negative with Agdia immunostrips and positive with the Agdia and AC Diagnostics DAS-ELISAs. Total RNA was extracted from one ELISA-positive sample using TRIZOL Reagent (Life Technologies, Carlsbad, CA) and tested in RT-PCR using GRSV- or TCSV-specific primers (2). An expected RT-PCR product was generated using primers derived from TCSV S-RNA (JAP885, 5'-CTCGGTTTTCTGCTTTTC-3' and JAP886, 5'CGGACAGGCTGGAGAAATCG3') (~290 bp) but not when using primers specific to GRSV S-RNA (JAP887, 5'-CGTATCTGAGGATGTTGAGT-3' and JAP888, 5'-GCTAACTCCTTGTTCTTTTG-3'). The 290-bp RT-PCR product was cloned using a TOPO TA cloning kit (Life Technologies, Grand Island, NY), and six clones were sequenced. Sequences from three clones were identical to a consensus sequence of a 292-bp fragment covering part of the TCSV nucleocapsid gene (GenBank Accession No. KJ744213). Sequences of the remaining three clones contained one, two, or three nucleotide mutations. To confirm the presence of TCSV in this sample, two newly designed primers flanking the entire nucleocapsid protein gene (TCSV-F1, 5'-AGTATTATGCATCTATAGATTAGCACA-3' and TCSV-R1, 5'-ACAAATCATCACATTGCCAGGA-') were used in RT-PCR to generate an expected 948-bp product. Upon cloning and sequencing, this fragment was shown to contain a full nucleocapsid protein gene of TCSV (GenBank Accession No. KM610235). The fragment contained a sequence identical to the first 292-bp RT-PCR product. BLASTn analysis (National Center for Biotechnology Information database) showed that the large fragment sequence had 98% nucleotide sequence identity to the TCSV Florida isolate (GenBank Accession No. JX244196) and 94% to the TCSV Physalis isolate (GenBank Accession No. JQ034525). Tobacco plants were inoculated mechanically with sap from symptomatic tomato fruits. Necrotic local lesions developed, and the presence of TCSV was confirmed using AC Diagnostics' DAS-ELISA. TCSV has been reported in Brazil (1), Puerto Rico (3), and Florida (2). To our knowledge, this is the first report of TCSV infecting tomatoes in Ohio. Because TCSV is transmitted by thrips and has a broad host range, this emerging virus could pose a significant threat to the U.S. vegetable industry. References: (1) A. Colariccio et al. Fitopatol. Bras. 20:347, 1995. (2) A. Londoño et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Plant Health Progress doi:10.1094/PHP-2013-0812-01-BR, 2013.

First Report of Potato spindle tuber viroid Naturally Infecting Field Tomatoes in the Dominican Republic.

In recent years, viroid disease outbreaks have resulted in serious economic losses to a number of tomato growers in North America (1,2,3). At least three pospiviroids have been identified as the causal agents of tomato disease, including Potato spindle tuber viroid (PSTVd), Tomato chlorotic dwarf viroid (TCDVd), and Mexican papita viroid (MPVd). In the spring of 2013, a severe disease outbreak with virus-like symptoms (chlorosis and plant stunting) was observed in a tomato field located in the Dominican Republic, whose tomato production is generally exported to the United States in the winter months. The transplants were produced in house. The disease has reached an epidemic level with many diseased plants pulled and disposed of accordingly. Three samples collected in May of 2013 were screened by ELISA against 16 common tomato viruses (Alfalfa mosaic virus, Cucumber mosaic virus, Impatiens necrotic spot virus, Pepino mosaic virus, Potato virus X, Potato virus Y, Tobacco etch virus, Tobacco mosaic virus, Tobacco ringspot virus, Tomato aspermy virus, Tomato bushy stunt virus, Tomato mosaic virus, Tomato ringspot virus, Tomato spotted wilt virus, Groundnut ringspot virus, and Tomato chlorotic spot virus), a virus group (Potyvirus group), three bacteria (Clavibacter michiganensis subsp. michiganensis, Pectobacterium atrosepticum, and Xanthomonas spp.), and Phytophthora spp. No positive result was observed, despite the presence of symptoms typical of a viral-like disease. Further analysis by RT-PCR using Agdia's proprietary pospiviroid group-specific primer resulted in positive reactions in all three samples. To determine which species of pospiviroid was present in these tomato samples, full-genomic products of the expected size (~360 bp) were amplified by RT-PCR using specific primers for PSTVd (4) and cloned using TOPO-TA cloning kit (Invitrogen, CA). A total of 8 to 10 clones from each isolate were selected for sequencing. Sequences from each clone were nearly identical and the predominant sequence DR13-01 was deposited in GenBank (Accession No. KF683200). BLASTn searches into the NCBI database demonstrated that isolate DR13-01 shared 97% sequence identity to PSTVd isolates identified in wild Solanum (U51895), cape gooseberry (EU862231), or pepper (AY532803), and 96% identity to the tomato-infecting PSTVd isolate from the United States (JX280944). The relatively lower genome sequence identity (96%) to the tomato-infecting PSTVd isolate in the United States (JX280944) suggests that PSTVd from the Dominican Republic was likely introduced from a different source, although the exact source that resulted in the current disease outbreak remains unknown. It may be the result of an inadvertent introduction of contaminated tomato seed lots or simply from local wild plants. Further investigation is necessary to determine the likely source and route of introduction of PSTVd identified in the current epidemic. Thus, proper control measures could be recommended for disease management. The detection of this viroid disease outbreak in the Dominican Republic represents further geographic expansion of the viroid disease in tomatoes beyond North America. References: (1). K.-S. Ling and M. Bledsoe. Plant Dis. 93:839, 2009. (2) K.-S. Ling and W. Zhang. Plant Dis. 93:1216, 2009. (3) K.-S. Ling et al. Plant Dis. 93:1075, 2009. (4) A. M. Shamloul et al. Can. J. Plant Pathol. 19:89, 1997.

First Report of Cucumber green mottle mosaic virus Infecting Greenhouse Cucumber in Canada.

In early 2013, greenhouse cucumber growers in Alberta, Canada, observed virus-like disease symptoms on mini-cucumber (Cucumis sativus) crops (e.g., 'Picowell'). Two types of symptoms were commonly observed, green mottle mosaic and necrotic spots. In the early infection, young leaves of infected cucumber plants displayed light green mottle and blisters. The infected plants were stunted in growth, with darker green blisters and green mottle mosaic symptoms on mature leaves. Disease incidence varied from one greenhouse to another. In some severe cases, diseased plants were widely distributed inside the greenhouse, resulting in 10 to 15% yield losses based on grower's estimation. Nine symptomatic samples were collected and subjected to total RNA isolation using the TRIzol reagent (Invitrogen, Carlsbad, CA). Laboratory analyses were conducted using real-time RT-PCR systems for Cucumber green mottle mosaic virus (CGMMV) (1), Melon necrotic spot virus (MNSV, Ling, unpublished), and Squash mosaic virus (SqMV) (3). All nine samples were positive for CGMMV and seven of them were in mixed infections with MNSV. Two samples were selected for validation for the presence of CGMMV using conventional RT-PCR (2) with a new primer set (CGMMVMP F1: 5'-ATGTCTCTAAGTAAGGTGTC-3' and CGMMV3'UTR R1: 5'-TGGGCCCCTACCCGGGG-3') and two previous online published primer sets, one for CGMMV MP (5' TAAGTTTGCTAGGTGTGATC-3', GenBank Accession No. AJ250104 and 5' ACATAGATGTCTCTAAGTAAG-3', AJ250105), and another for CGMMV CP (5' ACCCTCGAAACTAAGCTTTC-3', AJ243351 and 5' GAAGAGTCCAGTTCTGTTTC-3', AJ243352). The expected sizes of RT-PCR products were obtained and sequenced directly. Sequences from these three products overlapped and generated a 1,282-bp contig (KF683202). BLASTn analysis to the NCBI database showed 99% sequence identity to CGMMV isolates identified in Asia, including China (GQ277655, KC852074), India (DQ767631), Korea (AF417243), Myanmar (AB510355), and Taiwan (HQ692886), but only 92% sequence identity to other CGMMV isolates identified in Europe, including Spain (GQ411361) and Russia (GQ495274), and 95% to CGMMV isolate from Israel (KF155231). The strong sequence identity to the CGMMV Asian isolates suggests that the Canadian CGMMV isolate identified in Alberta was likely of Asian origin. In two bioassay experiments using one sample prepared in 0.01 M phosphate buffer, the similar green mottle mosaic symptoms were observed on systemic leaves in the mechanically inoculated plants and the presence of CGMMV, but not MNSV, was confirmed through real-time RT-PCR on four different cucurbits, including three Cucumis sativus cultivars (six plants in 'Marketer,' five plants in 'Poinsett 76,' six plants in 'Straight 8'), seven plants of C. melo 'Athena,' six plants of C. metulifer (PI201681), and two plants of Citrullus lanatus 'Charleston Gray.' To our knowledge, CGMMV has only been reported in Asia, Europe, and the Middle East, and this is the first report of CGMMV in the American continents. CGMMV is highly contagious and is seed borne on cucurbits. With the increasing trend in growing grafted watermelon and other cucurbits in the United States and elsewhere, it is even more important now that a vigilant seed health test program for CGMMV should be implemented. References: (1) H. Chen et al. J. Virol. Methods 149:326, 2008. (2) K.-S. Ling et al. Plant Dis. 92:1683, 2008. (3) K.-S. Ling et al. J. Phytopathol. 159:649, 2011.

Development and Field Evaluation of Multiple Virus-Resistant Bottle Gourd (Lagenaria siceraria).

In an effort to develop bottle gourd (Lagenaria siceraria) as a widely adapted rootstock for watermelon grafting, we sought to identify lines with broad resistance to several cucurbit viruses that are economically important in the United States. Preliminary analysis under greenhouse conditions indicated that the currently available commercial watermelon rootstocks were either highly susceptible or somewhat tolerant to one or more viruses. However, in greenhouse screening, several breeding lines of bottle gourd displayed broad-spectrum resistance to four viruses tested, including Zucchini yellow mosaic virus, Watermelon mosaic virus (WMV), Papaya ringspot virus watermelon strain (PRSV-W), and Squash vein yellowing virus. Resistance to PRSV-W and WMV was confirmed through field trials in two consecutive years at two different locations in South Carolina. Two breeding lines (USVL#1-8 and USVL#5-5) with broad-spectrum virus resistance could be useful materials for watermelon rootstock development.

First Report of Potato spindle tuber viroid Naturally Infecting Greenhouse Tomatoes in North Carolina.

In spring 2012, a severe disease was observed on a limited number of tomato plants (Solanum lycopersicum L.) in a research greenhouse facility in western North Carolina. The first symptoms noted were downward curling of the terminal leaves accompanied by a rough puckered darker green texture. This was followed in time by greater distortion of the leaves with pale green on leaf margins. Older leaves with symptoms developed necrosis, with necrotic spots and streaks appearing on a few fruits. On some of these affected fruits, stems, peduncles, pedicels, and sepals also showed symptoms. Infected plants were badly stunted, and fruits in the upper parts of plants displaying severe symptoms remained very small. In just a few months, the disease spread to other tomato plants inside the greenhouse. A survey in May 2012 showed a disease incidence of 18% (156 symptomatic plants out of a total of 864) in this greenhouse. Initial screenings for possible viruses using ELISA (Agdia, Elkhart, IN), as well as a reverse transcription (RT)-PCR panel of 15 common tomato viruses in our laboratory were negative. Because of the symptoms and negative results for viruses, a viroid infection was suspected. Total plant RNA was prepared using TRIzol reagent (Invitrogen, Carlsbad, CA) from leaf tissues of eight diseased plants and one seed sample. Using real-time RT-PCR developed against Potato spindle tuber viroid (PSTVd) and some related pospiviroids (1), positive signals were observed with a mean Ct = 13.24 for leaf tissues and Ct = 19.91 for the seed sample. To obtain a full viroid genome, RT-PCR using two different sets of primers, one specific for PSTVd (PSTVd-F and PSTVd-R) (2), and a universal primer set for pospiviroids (MTTVd-F and MTTVd-R) (3) was performed. RT-PCR generated amplicons with expected size of ~360 bp from all eight leaf and one seed samples, but not from a healthy control. PCR products were cloned using the TOPO TA cloning kit (Invitrogen, Carlsbad, CA). A total of 22 full genomic sequences were obtained. A multi-sequence alignment generated a consensus sequence of 360 nt, designated as NC12-01 (GenBank Accession No. JX280944). BLASTn search in the NCBI database revealed the highest sequence identity of 96.9% to Australian (AY962324) and UK (AJ583449) isolates of PSTVd and 95.9% identity to the tomato isolate of PSTVd-CA1 (HM753555). Similar disease symptoms were observed on two 'Rutgers' tomato plants 2 weeks post mechanical inoculation and the presence of PSTVd was confirmed by real-time RT-PCR (1). A mock-inoculated plant did not show any symptoms. In the U.S., natural infection of PSTVd on tomato was first identified in California in 2010 (3). To our knowledge, this is the first report of a natural occurrence of PSTVd on tomato in the eastern U.S. The diseased plants were contained, properly disposed of, and eradicated in this location. The broader geographic distribution of PSTVd on tomato in the U.S., and the potential latent infection in potato and a number of ornamentals (4), emphasizes the need for better plant and seed health tests for viroids on these plants. References: (1) N. Boonham et al. J. Virol. Methods 116:139, 2004. (2) H. Bostan et al. J. Virol. Methods 116:189, 2004. (3) K.-S. Ling and D. Sfetcu. Plant Dis. 94:1376, 2010. (4) R. A. Owens and J. Th. J. Verhoeven. The Plant Health Instructor. DOI: 10.1094/PHI-I-2009-0804-01, 2009.

Detection and Classification of SPLCV Isolates in the U.S. Sweetpotato Germplasm Collection via a Real-Time PCR Assay and Phylogenetic Analysis.

The United States Department of Agriculture-Agricultural Research Service sweetpotato (Ipomoea batatas) germplasm collection contains accessions that were initially collected from various countries worldwide. These materials have been maintained and distributed as in vitro plantlets since the mid-1980s. The status of viral infection by the emerging Sweet potato leaf curl virus (SPLCV) and other Begomovirus spp. in this germplasm has yet to be determined. In order to minimize the potential distribution of virus-infected clones, all accessions in the collection were tested for SPLCV using a real-time polymerase chain reaction assay. In total, 47 of 701 accessions of in vitro plantlets tested positive for SPLCV. The presence of SPLCV detected in these materials was confirmed via biological indexing using the indicator plants I. nil and I. muricata. Symptoms appeared more rapidly on I. muricata than on I. nil. Nucleotide polymorphisms among the isolates were evaluated by sequencing the AV1 coat protein gene from 24 SPLCV-infected accessions. The results revealed that the SPLCV isolates shared high sequence identity. Ten nucleotide substitutions were identified, most of which were synonymous changes. Phylogenetic analysis was conducted on those 24 SPLCV isolates in combination with six described SPLCV species and various SPLCV strains from GenBank to evaluate the relationships among viral species or strains. The results from this analysis indicated that most of the AV1 genes derived from previously classified SPLCV species clustered together, some of which formed well-supported monophyletic clades, further supporting the current taxonomy. Overall, identification of SPLCV-infected germplasm will allow approaches to be employed to eliminate the virus from the collection and limit the distribution of infected materials.

First Report of 'Candidatus Liberibacter solanacearum' Naturally Infecting Tomatoes in the State of Mexico, Mexico.

In January 2011, tomato (Solanum lycopersicum) plants exhibiting stunting, yellow mosaic, short, chlorotic leaves, aborted flowers, and reduced-size fruits, symptoms similar to those exhibited by plants infected by 'Candidatus Liberibacter solanacearum' (2), were observed in approximately 5% of tomato plants in greenhouses in Jocotitlan in the State of Mexico, Mexico. Occasional plant recovery was also observed. Tomato plants in this facility were previously shown to be infected by Mexican papita viroid (MPVd), Pepino mosaic virus (PepMV), and aster yellows phytoplasma. Eight symptomatic leaf samples (designated MX11-01 to MX11-08) were collected and screened against selected tomato viruses and pospiviroids by reverse transcription (RT)-PCR using purified plant RNA or for 'Ca. L. solanacearum' by PCR using purified plant DNA. As expected, both PepMV and MPVd were detected in these samples. However, two 'Ca. L. solanacearum'-specific PCR products (1,168 and 669 bp) were also amplified in two samples (MX11-02 and MX11-05) using primers OA2 (2) and OI2c (1) or CL514F/CL514R (3), respectively. Each 'Ca. L. solanacearum'-specific PCR product was gel purified with Geneclean (Q-Biogene, Carlsbad, CA) and cloned into pCR2.1 using TOPO TA cloning kit (Invitrogen, Carlsbad, CA) and sequenced (Functional Biosciences, Madison, WI). Sequences of 16S rRNA (1,168 bp) in both isolates (GenBank Accession Nos. JF811596 and JF811597) were identical. However, the 669-bp 50S rRNA sequences in these two isolates (GenBank Accession Nos. JF811598 and JF811599) contained two single nucleotide polymorphism (SNP) mutations. BLASTn searches showed that both 16S rRNA and 50S gene sequences in MX11-05 were identical to the 'Ca. L. solanacearum' previously identified on potato in Chihuahua (GenBank Accession Nos. FJ829811 and FJ829812) and Saltillo (GenBank Accession Nos. FJ498806 or FJ498807) in eastern Mexico. These 'Ca. L. solanacearum' isolates were recently classified as the "b" haplotype (4). Alignment analysis of the 'Ca. L. solanacearum' 16S rRNA sequences also revealed the conserved SNP mutations (g.212T > G and g.581T > C) in MX11-02 and MX11-05 as previously identified for other "b" haplotype isolates (4). 'Ca. L. solanacearum' was first identified in greenhouse tomatoes in 2008 in New Zealand (2). It has also been identified in greenhouse and field tomatoes in the United States. 'Ca. L. solanacearum' was previously reported to infect field tomatoes in Sinaloa, Mexico (3), which was recently considered as the "a" haplotype (4). To our knowledge, this is the first report of 'Ca. L. solanacearum' naturally infecting tomatoes in Jocotitlan in the State of Mexico, Mexico. The greenhouse tomato 'Ca. L. solanacearum' may be transmitted from infected solanaceous plants by potato psyllids (Bactericera cockerelli), which were observed in this facility. References: (1) S. Jagoueix et al. Int. J. Syst. Bacteriol. 44:379, 1994. (2) L. W. Liefting et al. Plant Dis. 93:208, 2009. (3) J. E. Munyaneza et al. Plant Dis. 93:1076, 2009 (4) W. R. Nelson et al. Eur. J. Plant Pathol. 130:5, 2011.

First Report of Pepino mosaic virus Infecting Tomato in Mexico.

Pepino mosaic virus (PepMV) (genus Potexvirus) was first reported in Europe to be infecting greenhouse tomatoes (Solanum lycopersicum) in 2000 (3). Subsequently, it has also been identified in Canada and the United States (1) and has become widespread on greenhouse tomatoes in many countries. In early spring of 2010, symptoms including chlorotic mosaic or chlorotic patches on leaves, necrotic stems, and fruit deformation or marbling were noted. Approximately 50% of plants in a greenhouse in Jocotitlan, Mexico exhibited symptoms. Twenty-three symptomatic samples in four separate collections between April 2010 and January 2011 all tested positive for the presence of PepMV by ELISA and/or Agristrips (BioReba, Switzerland). Two symptomless samples were negative for PepMV. Biological inoculation with the isolate MX10-05 to three Nicotiana benthamiana and three tomato cv. Horizon plants all resulted in chlorotic mosaic symptoms on the systemic leaves and PepMV on the inoculated plants was confirmed by ELISA. To determine the genotype of PepMV in MX10-05, two primer sets targeting different part of the virus genome (separated by 2,744 nt) were selected for reverse transcription (RT)-PCR using total plant RNA extracted with the RNeasy Plant Mini Kit (Qiagen, Valencia, CA). A RT-PCR product (840 bp) was obtained using the first primer set (PepMV-Ch2.F541: 5'CATGGAACCAGCTGATGTGA and PepMV-Ch2.R1380: 5'TCTTTGTATATGGTCGCAGC) targeting the 5' portion of the RNA-dependent RNA polymerase (RdRp) gene. The PCR product was cloned in pCR2.1 using the TOPO TA cloning system (Invitrogen, Carlsbad, CA) and a single clone was sequenced in both directions (Functional Biosciences, Madison, WI). After primer trimming, the 800-bp sequence (GenBank Accession No. JF811600) was shown in BLASTn to have its highest nucleotide sequence identity (99.4%) to the type PepMV-CH2 (DQ000985), 98% to other CH2/US2 isolates, 85% to US1, and 84% to EU. Another RT-PCR product (also 840 bp) was generated using the second primer set (PepMV-Ch2.F4081: 5'AAAAACGCTGTACCCAAAAC and PepMV-Ch2.R4920: 5'CAGAAATGTGTTCAGAGGGG) targeting the 3' portion of RdRp and TGB1 genes. This second genome segment enables the differentiation of the CH2 and US2 genotypes. The resulting 800 bp (JF811600) had the highest nucleotide sequence identity (99.5%) to the type PepMV CH2, 97% to other CH2 isolates, 83% to US2, and only 81% to the EU genotype. Taken together, these sequence analyses support the identification of MX10-05 as a PepMV-CH2 isolate (2). However, the presence of other PepMV genotypes cannot be excluded once sequences from other isolates are obtained and analyzed. To our knowledge, this is the first report of PepMV on greenhouse tomatoes in Mexico. References: (1). C. J. French et al. Plant Dis. 85:1121, 2001. (2). K.-S. Ling. Virus Genes 34:1, 2007. (3). R. A. A. van der Vlugt et al. Plant Dis. 84:103, 2000.

First Report of Natural Infection of Greenhouse Tomatoes by Potato spindle tuber viroid in the United States.

In April 2009, a large number of tomato plants (Solanum lycopersicum L.) grown in a commercial greenhouse facility near Los Angles, CA exhibited general plant stunting (short internodes) and foliar symptoms that included distortion, chlorosis, and scattered necrotic spotting. Over time, the leaves began to exhibit a purple color and curling. Diseased plants were often elongated and frail with spindly shoots. The disease resulted in a significant yield loss due to reduced fruit size. Disease symptoms described above are generally different from those of Pepino mosaic virus (PepMV) infection, which causes yellow mosaic or patches on leaves and marbling of fruits. The disease was initially localized in certain areas in a greenhouse despite using a number of cultural management efforts including vigorous scouting, roguing of diseased plants, and strict hygiene and cleaning practices. The disease was also observed in neighboring greenhouses by the spring of 2010. A standard panel of tests for common tomato viruses and viroids were conducted using the appropriate serological or PCR assays. Reverse transcription (RT) PCR analysis of nine symptomatic plants with pospiviroid-specific primers, Pospil-RE and Pospil-FW (3), produced an amplicon of the expected size (~196 bp) while three healthy looking tomato plants did not. Subsequently, full viroid genomic sequences were obtained through RT-PCR with primer sets specific for Potato spindle tuber viroid (PSTVd), 3H1/2H1 (2), as well as for the pospiviroid genus, MTTVd-F and MTTVd-R (1). Sequences obtained from direct sequencing of amplicons or cloned PCR products from one isolate were identical and consisted of a full viroid genome of 358 nt, which was named PSTVd-CA1 (GenBank Accession No. HM753555). BLASTn queries of the NCBI database showed that this isolate had a high sequence identity (98%) to other PSTVd isolates (i.e., EF044304, X52037, and Y09577). The disease was reproducible upon mechanical transmission (1) on three tomato 'Moneymaker' plants, which expressed symptoms that were similar to those on the source plants. Recovery of PSTVd on the inoculated tomato plants was confirmed by RT-PCR and sequencing. Because of its susceptibility to viroid infection, tomato 'Moneymaker' plants are commonly used as indicators for the study of pospiviroids, including PSTVd. Natural PSTVd infection on greenhouse tomatoes has been reported in Europe (3) and New Zealand. Although a number of reports in the United States have been published on naturally occurring PSTVd infections of potatoes, to our knowledge, this is the first report of a natural PSTVd infection on tomatoes in the United States. The exact source of the PSTVd inoculum in the current disease outbreak is unknown, but it could have been introduced from infected potato or ornamental plants (4) or through infected tomato seeds. The disease epidemic might have been enhanced by frequent hands-on activities in greenhouse tomato production and the environmental conditions (high temperature and intense lighting) in the greenhouse that favor symptom expression. References: (1) K.-S. Ling and W. Zhang, Plant Dis. 93:1216, 2009. (2). A. M. Shamloul et al. Can. J. Plant Pathol. 19:89, 1997. (3) J. Th. J. Verhoeven et al. Eur. J. Plant Pathol. 110:823, 2004. (4) J. Th. J. Verhoeven et al. Plant Pathol. 59:3, 2010.

Simultaneous detection of Acidovorax avenae subsp. citrulli and Didymella bryoniae in cucurbit seedlots using magnetic capture hybridization and real-time polymerase chain reaction.

To improve the simultaneous detection of two pathogens in cucurbit seed, a combination of magnetic capture hybridization (MCH) and multiplex real-time polymerase chain reaction (PCR) was developed. Single-stranded DNA hybridization capture probes targeting DNA of Acidovorax avenae subsp. citrulli, causal agent of bacterial fruit blotch, and Didymella bryoniae, causal agent of gummy stem blight, were covalently attached to magnetic particles and used to selectively concentrate template DNA from cucurbit seed samples. Sequestered template DNAs were subsequently amplified by multiplex real-time PCR using pathogen-specific TaqMan PCR assays. The MCH multiplex real-time PCR assay displayed a detection threshold of A. avenae subsp. citrulli at 10 CFU/ml and D. bryoniae at 10(5) conidia/ml in mixtures of pure cultures of the two pathogens, which was 10-fold more sensitive than the direct real-time PCR assays for the two pathogens separately. Although the direct real-time PCR assay displayed a detection threshold for A. avenae subsp. citrulli DNA of 100 fg/microl in 25% (1/4 samples) of the samples assayed, MCH real-time PCR demonstrated 100% detection frequency (4/4 samples) at the same DNA concentration. MCH did not improve detection sensitivity for D. bryoniae relative to direct real-time PCR using conidial suspensions or seed washes from D. bryoniae-infested cucurbit seed. However, MCH real-time PCR facilitated detection of both target pathogens in watermelon and melon seed samples (n = 5,000 seeds/sample) in which 0.02% of the seed were infested with A. avenae subsp. citrulli and 0.02% were infested with D. bryoniae.

First Report of Tomato chlorotic dwarf viroid in Greenhouse Tomatoes in Arizona.

Tomato chlorotic dwarf viroid (TCDVd), a member of the genus Pospivroid, family Pospiviroidae, was first identified on greenhouse tomato (Solanum lycopersicum) in Canada (2). Since then, it has also been reported elsewhere, e.g., on tomato in Colorado (4). During 2006 in Arizona, tomato plants in a large greenhouse facility with continuous tomato production exhibited viroid-like symptoms of plant stunting and chlorosis of the young leaves. Symptomatic plants were often located along the edge of the row, indicating the presence of a mechanical transmissible agent. Approximately 4% of the plants in this greenhouse were symptomatic in 2008. Symptoms were distinctly different from those caused by Pepino mosaic virus (PepMV), a virus that was generally present in this greenhouse and also in our test samples. Other commonly occurring tomato viruses were ruled out by serological, PCR, or reverse transcription (RT)-PCR tests in multiple laboratories. RT-PCR with two sets of universal pospiviroid primers, PospiI-FW/RE and Vid-FW/RE (4), yielded amplicons of the expected sizes of 196 and 360 bp in three samples collected from symptomatic plants. Direct sequencing of the amplicons revealed that the genome was 360 nt and 100% identical to the type TCDVd from Canada (GenBank Accession No. AF162131) (2). Mechanical inoculation with leaf tissue extract from four samples to plants of the tomato 'Money-Maker' resulted in the same viroid-like symptoms and TCDVd was confirmed in these plants by RT-PCR and sequencing. In both 2007 and 2008, 18 samples were tested using primers PSTVd-F and PSTVd-R (1), which are capable of amplifying the full TCDVd genome. Analysis of the sequences from the amplicons revealed two genotypes of TCDVd. The first genotype (GenBank Accession No. FJ822877) was identical to the type TCDVd and found in 11 samples from 2007 and one from 2008. The second genotype (GenBank Accession No. FJ822878) was 361 nt, differing from the first by nine nucleotide substitutions, 2 insertions, and 1 deletion. This second genotype was found in 7 and 17 samples from 2007 and 2008, respectively, and showed the highest sequence identity (97%) to a Japanese tomato isolate (AB329668) and a much lower sequence identity (92%) to a U.S. isolate previously identified in Colorado (AY372399) (4). The origin of TCDVd in this outbreak is not clear. The genotype identified first could have been introduced from a neighboring greenhouse where the disease was observed before 2006 and where this genotype also was identified in 2007. The second genotype may have been introduced from infected seed since TCDVd has recently been shown to be seed transmitted in tomato (3). To our knowledge, this is the first report of natural occurrence of TCDVd in Arizona. References: (1) A. M. Shamloul et al. Can. J. Plant Pathol. 19:89, 1997. (2) R. P. Singh et al. J. Gen. Virol. 80:2823, 1999. (3) R. P. Singh and A. D. Dilworth. Eur. J. Plant Pathol. 123:111, 2009. (4) J. Th. J. Verhoeven et al. Eur. J. Plant Pathol. 110:823, 2004.

First Report of a Natural Infection by Mexican Papita Viroid and Tomato Chlorotic Dwarf Viroid on Greenhouse Tomatoes in Mexico.

In early 2008, tomato plants (Solanum lycopersicum) grown in a large greenhouse facility located near Mexico City exhibited general stunting, leaf chlorosis at the top of the diseased plant that later turned bronze or purple, and reduced-sized fruits. Initially, diseased plants were confined to a 5-ha greenhouse, but the disease quickly spread to two additional 5-ha greenhouses in the summer of 2008. By the end of 2008, approximately 5% of tomato plants in 35-ha of greenhouse were infected. Sixteen diseased samples were collected, twelve in 2008 and four in 2009. Bioassays through mechanical inoculation with leaf extracts of diseased samples demonstrated the transmissibility of the causal agent to plants of tomato cvs. Horizon or Rutgers, which expressed symptoms that were similar to those on the source plants. Serological or PCR assays were negative for several commonly occurring greenhouse tomato viruses. However, an expected size product (~196 bp) was consistently detected by reverse transcription (RT)-PCR using pospiviroid-specific primers Pospil-RE and Pospil-FW (4) in all symptomatic samples or from the mechanically inoculated tomato plants. Preliminary analysis with sequences obtained from direct sequencing of amplicons revealed one dominant sequence with 94% identity to Mexican papita viroid (MPVd) (GenBank Accessions Nos. L78454 and L78456-L78463). However, further analysis of the cloned cDNAs indicated a mixed infection of two pospiviroids in two samples. Of 10 cDNA clones analyzed, 9 were MPVd-like sequences and one was sequence of Tomato chlorotic dwarf viroid (TCDVd). Further analysis using full genomic sequences obtained by RT-PCR with previously designed primers (2) or a new set of primers (MTTVd-F: 5' GGG GAA ACC TGG AGC GAA CTG G, and MTTVd-R: 5' GGG GAT CCC TGA AGC GCT CCT) revealed genetic diversity in this population. Eight of thirteen cloned cDNAs represented by the 359-nt sequence of isolate Mex8 (GenBank Accession No. GQ131572) had 93 to 94% nucleotide sequence identity to other MPVd isolates (L78454 and L78456-L78463). Five other cDNA clones represented by the 361-nt sequence of isolate HM2 (GenBank Accession No. GQ131573) were 99% identical to a TCDVd isolate recently identified in Arizona (GenBank Accession No. FJ822878) and 96 to 97% identical to TCDVd isolates from other areas (GenBank Accession Nos. AF162131 and AB329668). These results are the first evidence of a mixed infection of two viroids infecting tomatoes in Mexico. MPVd was first identified in Mexico on papita (S. cardiophyllum) in 1996 (1). The origin of TCDVd in this greenhouse was not determined, but TCDVd potentially can be seed transmitted in tomato (3). The close relationship between the Mexican and the U.S. isolates suggests that TCDVd in these two countries may share a common origin, likely from seed. To our knowledge, this is the first report of a natural infection of MPVd and TCDVd on tomatoes in Mexico. References: (1) J. P. Martinez-Soriano et al. Proc. Natl. Acad. Sci. U.S.A. 93:9397, 1996. (2) A. M. Shamloul et al. Can. J. Plant Pathol. 19:89, 1997. (3) R. P. Singh and A. D. Dilworth. Eur. J. Plant Pathol. 123:111, 2009. (4) J. Th. J. Verhoeven et al. Eur. J. Plant Pathol. 110:823, 2004.

First Report of Mexican papita viroid Infecting Greenhouse Tomato in Canada.

In the summer of 2008, tomato (Solanum lycopersicum) plants in a large greenhouse tomato facility located in Delta, British Columbia, Canada exhibited general stunting, chlorosis, and purple-leaf symptoms that were distinct from those of Pepino mosaic virus (PepMV) (1). Diseased plants were localized mainly in two rows in a section of the greenhouse and produced no fruits or only fruits with reduced size. Leaf samples were collected from four individuals among numerous diseased plants in this greenhouse. Screening samples by ELISA, PCR, or reverse transcription (RT)-PCR for PepMV, Tomato spotted wilt virus, Tomato yellow leaf curl virus, Tomato torrado virus, Tomato apex necrosis virus, and Begomovirus, Tobamovirus, and Pospiviroid species showed that all four plants had a mixed infection of both PepMV and a pospiviroid. RT-PCR with the pospiviroid-specific primers Pospil-RE and Pospil-FW (3) amplified the expected 196-bp products from these four samples. Each amplicon was cloned into the pCR4-TOPO vector (Invitrogen, Carlsbad, CA) and one individual cDNA clone from each isolate was sequenced. BLASTN analyses of nucleotide sequences of these clones showed 97 to 99% identity to Mexican papita viroid (MPVd) isolates currently in the NCBI Genbank. These four newly identified MPVd isolates were not identical; seven nucleotide substitutions or indels were identified in this region. The full viroid genome was obtained by RT-PCR in isolate VF2 with a new reverse primer MPVd-RE (5' GATCCCTGAAGCGCTCCT 3') in combination with the forward primer Pospil-FW (3). Using the same approach as stated above, this amplicon was cloned and sequenced. The nucleotide sequence of the 196-nt amplicon previously amplified and cloned from the isolate VF2 genome was identical to this region in the genomic clone. BLASTN analysis showed that the VF2 genome (GenBank Accession No. FJ824844) had >98% sequence identity to each of nine MPVd isolates (GenBank Accession Nos. L78454 and L78456-L78463), 94% identity to Tomato planta macho viroid (TPMVd) (GenBank Accession No. K00817) and ~80% identity to Tomato chlorotic dwarf viroid (GenBank Accession Nos. EF582392-EF582393). Prior to this find, MPVd had been identified only in papita (Solanum cardiophyllum) in Mexico and is considered a possible ancestor of TPMVd, Potato spindle tuber viroid (PSTVd), and possibly of other PSTVd-group viroids now infecting crop plants (2). The origin of MPVd in this greenhouse facility in Delta, British Columbia is unknown. The infected plants were destroyed by the grower. The pathogenicity of MPVd isolates characterized in this study was not evaluated on tomato because of quarantine regulations governing this viroid in the United States. The identification of MPVd infecting an important agricultural crop (tomato) outside its center of origin in Mexico indicates a potentially important major shift in the epidemiology of MPVd. To our knowledge this is the first report of MPVd from tomato in Canada. References: (1). K.-S. Ling et al. Plant Dis. 92:1683, 2008. (2) J. P. Martinez-Soriano et al. Proc. Natl. Acad. Sci. U.S.A. 93:9397, 1996. (3) J. Th. J. Verhoeven et al. Eur. J. Plant Pathol. 110:823, 2004.

First Report of Southern Blight on Bottle Gourd (Lagenaria siceraria) Caused by Sclerotium rolfsii in South Carolina.

Bottle gourd (Lagenaria siceraria (Mol.) Standl.) is an important rootstock in watermelon production in several countries such as Japan, China, and Israel where 60 to 70% of watermelons are grafted (2). We are evaluating bottle gourds for their ability to improve disease resistance when used as rootstock for watermelon (3). In the summer of 2007, symptoms of wilting and crown necrosis appeared on bottle gourd seedlings 1 month after transplanting in a field in Charleston, SC. Infection was observed on commercial cv. Emphasis and four advanced breeding lines. In October of 2007, 35 of 85 plants examined (41%) had stem rot at the crown area just above the soil line where coarse, white mycelia and abundant sclerotia were observed. The fungus tentatively identified as Sclerotium rolfsii produced sclerotia that were white or light to dark brown and measured 0.6 to 2.5 mm in diameter (mean = 1.1 mm). Diseased tissues with sclerotia from four plants were disinfested for 1 min in 0.5% sodium hypochlorite and plated on acidified potato dextrose agar (APDA). Fungal colonies that produced white mycelia and tan-to-brown sclerotia were isolated from four wilted plants. A single PCR product of approximately 680 bp was amplified from DNA extracted from two isolates using the primers ITS1 and ITS4 (4). One PCR product was cloned into the TOPO TA cloning vector (Invitrogen, Carlsbad, CA) and sequenced (GenBank Accession No. EU338381). BLASTN analysis of the sequence in the NCBI databases revealed 99% similarity to the internal transcribed spacer (ITS) sequences of S. rolfsii and Athelia rolfsii (perfect stage of S. rolfsii), confirming that the pathogen was indeed S. rolfsii. Two S. rolfsii isolates were used to test pathogenicity. Each isolate was used to inoculate five young seedlings and five adult (10-week-old) bottle gourd plants. For inoculation, 10 sclerotia obtained from the APDA plates were placed on the surface of the potting soil 0.5 to 1 cm from the collar region of each bottle gourd plant growing in 10-cm pots. Inoculations were done carefully to ensure that the plants were not injured. After inoculation, the plants were maintained at high humidity and 25°C for 3 days and then transferred to laboratory benches. Four young seedlings and three adult noninoculated plants kept under the same conditions served as controls. The pathogenicity test was repeated once with similar results. All inoculated plants developed symptoms of southern blight. The inoculated plants developed symptoms of wilting 4 to 5 days after inoculation and completely wilted within 7 to 10 days. Symptoms of wilting were soon followed by the appearance of white-to-light brown sclerotia on the collar region. No symptoms were observed on the noninoculated plants. S. rolfsii was reisolated from the inoculated plants on APDA. Although southern blight caused by S. rolfsii has been reported on many crop plants in the southern United States, to our knowledge, this disease has not been reported previously on bottle gourd in North America. However, the disease has been reported on bottle gourd in India (1). Identifying sources of resistance to southern blight in bottle gourds may be necessary to make them suitable as rootstocks in areas where S. rolfsii is present. References: (1) K. S. Amin. Indian Phytopathol. 34:253, 1981. (2) R. Cohen et al. Plant Dis. 91:916, 2007. (3) K. S. Ling and A. Levi. HortScience 42:1124, 2007. (4) T. J. White et al. PCR Protocols: A Guide to Methods and Amplifications. Academic Press, San Diego, 1990.

First Report of Tomato yellow leaf curl virus in South Carolina.

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5'GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5'GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of "across-state" distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Nucleotide sequence and genome organization of grapevine leafroll-associated virus-2 are similar to beet yellows virus, the closterovirus type member.

The entire genome of grapevine leafroll-associated closterovirus-2 (GLRaV-2), except the exact 5' terminus, was cloned and sequenced. The sequence encompasses nine open reading frames (ORFs) which include, in the 5' to 3' direction, an incomplete ORF1a encoding a putative viral polyprotein and eight ORFs that encode proteins of 52 kDa (ORF1b), 6 kDa (ORF2), 65 kDa (ORF3), 63 kDa (ORF4), 25 kDa (ORF5), 22 kDa (ORF6), 19 kDa (ORF7) and 24 kDa (ORF8) respectively, and 216 nucleotides of the 3' untranslated region. An incomplete ORF1a potentially encoded a large polyprotein containing the conserved domains characteristic of a papain-like protease, methyltransferase and helicase. ORF1b potentially encoded a putative RNA-dependent RNA polymerase. The expression of ORF1b may be via a +1 ribosomal frameshift mechanism, similar to other closteroviruses. A unique gene array, which is conserved in other closteroviruses, was also identified in GLRaV-2; it includes genes encoding a 6 kDa small hydrophobic protein, 65 kDa heat shock protein 70, 63 kDa protein of function unknown, 25 kDa coat protein duplicate and 22 kDa coat protein. Identification of ORF6 (22 kDa) as the coat protein gene was further confirmed by in vivo expression in E. coli and immunoblotting. Phylogenetic analysis comparing different genes of GLRaV-2 with those of other closteroviruses demonstrated a close relationship with beet yellows virus (BYV), beet yellow stunt virus and citrus tristeza virus. GLRaV-2 is the only closterovirus, so far, that matches the genome organization of the type member of the group, BYV, and thus can be unambiguously classified as a definitive member of the genus Closterovirus.

Nucleotide sequence of the 3'-terminal two-thirds of the grapevine leafroll-associated virus-3 genome reveals a typical monopartite closterovirus.

The RNA genome of grapevine leafroll-associated closterovirus-3 (GLRaV-3) was cloned as a cDNA generated from GLRaV-3-specific dsRNA, and a partial genome sequence of 13154 nucleotides (nt) including the 3' terminus was determined. The sequenced portion contained 13 open reading frames (ORFs) potentially encoding, in the 5'-3' direction, proteins of > 77 kDa (ORF1a; helicase, HEL), 61 kDa (ORF1b; RNA-dependent RNA polymerase, RdRp), 6 kDa (ORF2), 5 kDa (ORF3, small transmembrane protein), 59 kDa (ORF4; heat shock protein 70, HSP70), 55 kDa (ORF5), 35 kDa (ORF6; coat protein, CP), 53 kDa (ORF7; diverged coat protein, CPd), 21 kDa (ORF8), 20 kDa (ORF9), 20 kDa (ORF10), 4 kDa (ORF11), 7 kDa (ORF12), and an untranslated region of 277 nt. ORF1b is probably expressed via a +1 ribosomal frameshift mechanism, most similar to that of lettuce infectious yellows virus (LIYV). Phylogenetic analysis using various gene sequences (HEL, RdRp, HSP70 and CP) clearly demonstrated that GLRaV-3, a mealybug-transmissible closterovirus, is positioned independently from aphid-transmissible monopartite closteroviruses (beet yellows, citrus tristeza and beet yellows stunt) and whitefly-transmissible bipartite closterovirus (lettuce infectious yellows, LIYV). However, another alleged mealybug-transmissible closterovirus, little cherry virus, was shown to be more closely related to the whitefly-transmissible LIYV than to GLRaV-3.

The coat protein gene of grapevine leafroll associated closterovirus-3: cloning, nucleotide sequencing and expression in transgenic plants.

A lambda ZAP II cDNA library was constructed by cloning cDNA prepared from a high molecular weight double-stranded RNA (dsRNA, ca. 18 kb) isolated from grapevine leafroll associated closterovirus-3 (GLRaV-3) infected tissues. This cDNA library was immuno-screened with GLRaV-3 coat protein specific polyclonal and monoclonal antibodies and three immuno-positive clones were identified. Analysis of nucleotide sequences from these clones revealed an open reading frame (ORF) which was truncated at the 3' end; the remainder of this ORF was obtained by sequencing a fourth clone that overlapped with one of the immunopositive clones. A total of 2028 bp was sequenced. The putative GLRaV-3 coat protein ORF, 939 bp, encodes a protein (referred to as p35) with a calculated M(r) of 34866. Multiple alignment of the p35 amino acid sequence with coat protein sequences from other closteroviruses revealed that the consensus amino acid residues (R and D) of filamentous plant viruses are preserved in the expected locations. The GLRaV-3 coat protein gene was then engineered for sense and antisense expression in transgenic plants. Transgenic Nicotiana benthamiana plants that contain the sense GLRaV-3 coat protein gene produced a 35 kDa protein that reacted with GLRaV-3 antibody in Western blot.

Expression of the gene encoding the coat protein of cucumber mosaic virus (CMV) strain WL appears to provide protection to tobacco plants against infection by several different CMV strains.

The gene (cp) encoding the coat protein (CP) of cucumber mosaic virus (CMV) strain WL (CMV-WL, which belongs to CMV subgroup II) was custom polymerase chain reaction (CPCR)-engineered for expression as described by Slightom [Gene 100 (1991) 251-255]. CPCR amplification was used to add 5'- and 3'-flanking NcoI sites to the CMV-WL cp gene, and cp was cloned into the expression vector, pUC18cpexp. This CMV-WL cp expression cassette was transferred into the genome of tobacco (Nicotiana tabacum cv. Havana 423) via the Agrobacterium T-DNA transfer mechanism. R0 plants that express the CMV-WL cp gene were subcloned, propagated, and challenge-inoculated with CMV-WL. Several R0 plant lines showed excellent protection against CMV-WL infection; however, plants found to accumulate the highest CP levels did not show the highest degree of protection. Thus in our case, CP levels appear not to be a useful predictor of the degree of protection. Plants from the best protected CMV-WL cp gene-expressing R0 tobacco lines were also inoculated with CMV strains belonging to the other major CMV subgroup (subgroup I), CMV-C and CMV-Chi, and compared in a parallel experiment with a transgenic tobacco plant line that expresses the CMV-C cp gene. Plants expressing the CMV-WL cp gene appeared to show a broader spectrum of protection against infection by the various CMV strains than plants expressing the CMV-C cp gene.