RESUMO
ETHNOPHARMACOLOGICAL RELEVANCE: Saposhnikoviae Radix (SR) was initially documented in Shennong Bencao Jing classics for its properties in dispelling wind, dissolving surface, relieving pain, and alleviating spasms. This herb is commonly used in traditional Chinese medicine to address conditions that affect the body's surface, by aiding in the expulsion of pathogens from the surface and alleviating pain associated with the immune response. Atopic dermatitis (AD) is a prevalent allergic skin disorder, and the therapeutic effects of SR in dispelling wind and relieving the body's surface are consistent with the clinical symptoms commonly observed in AD. AIM OF THE STUDY: The anti-AD effects of SR were examined under three different growth patterns to identify active pharmacodynamic compounds. The results provide insight into the clinical efficacy of wild and cultivated SR. MATERIALS AND METHODS: The efficacy of wild, wild-simulated, and cultivated SR was assessed in a mouse model of AD. In addition, the effects of wild and varying doses of cultivated SR were evaluated in mice with short-term AD symptoms. GC-MS and UPLC-MS/MS were used to analyze the chemical components of the three SR treatments and molecular docking was used to identify active components. RESULTS: A mouse model of AD was used to assess the pharmacodynamic effects of SR prepared by three different cultivation methods. The study found that all three SR preparations improved phenotypic markers and histopathological features in the AD mouse model. The efficacy of wild SR and wild-simulated SR was similar, although there was a significant difference between wild and cultivated SR. Both wild SR and various doses of cultivated SR ameliorated skin injuries and reduced inflammation in serum and skin tissues. Furthermore, skin thickness, inflammatory cells, mast cell infiltration, and IL-33 expression improved following treatment. Notably, wild SR, double-cultivated SR, and triple-cultivated SR demonstrated significant therapeutic effects. An analysis using GC-MS revealed the presence of 55, 52, and 43 volatile oils in the three SR preparations, with more common components observed between wild and wild-simulated SR. Fewer common components were evident between cultivated and wild SR. UPLC-MS/MS analysis identified a total of 37 compounds, with larger relative peak areas observed for the chromogenic ketones. Molecular docking studies revealed that certain compounds, such as n-propyl 9,12-octadecadienoate, (E)-9-octadecenoic acid ethyl ester, and various chromogenic ketones, such as cimifugin, 5-O-methyIvisamminol, hamaudol, 3'-O-acetylhamaudol, 3'-O-angeloyhamandol, adenosine and farnesylaceton, may be the major substances that distinguish the activities of SR with three different growth patterns. CONCLUSION: Variations in the anti-AD efficacy of SR with three growth patterns were identified, and their chemical composition differences were determined. These findings suggest that increasing the dosage of cultivated SR could potentially be a viable clinical alternative for atopic dermatitis treatment.
RESUMO
Purpose: We aimed to compare the relative diagnostic efficacy of 68Ga-Labeled DOTA-ibandronic acid (68Ga-DOTA-IBA) to that of18F-NaF PET/CT as a mean of detecting bone metastases in patients with a range of cancer types. Methods: This study retrospectively enrolled patients with bone metastases associated with various underlying malignancies. All patients underwent both 68Ga-DOTA-IBA and 18F-NaF PET/CT scans. Histopathology and follow-up CT or MRI imaging results were used as reference criteria, with a minimum follow-up period of 3 months. The maximum Standardized Uptake Value (SUVmax) and number of bone metastases were recorded. The Target-Background Ratio (TBR) was calculated along with the detection rate, sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), and accuracy of 68Ga-DOTA-IBA and 18F-NaF PET/CT imaging for overall and partial primary solid tumor bone metastases. Pearson chi-square test, McNemar test, and Kappa test was conducted to assess the correlation and consistency of diagnostic efficiency between the two imaging agents. Receiver Operating Characteristic curve (ROC curve) was performed to compare diagnostic performance and the area under the curve of the two imaging agents, determining optimal critical values for SUVmax and TBR in diagnosing bone metastasis. Differences in SUVmax and TBR values between the two imaging agents for detecting bone metastases were analyzed using the Wilcoxon signed rank test. The difference was statistically significant when P < 0.05. Results: A total of 24 patients (13 women and 11 men) were included in this study, with a mean age of 52 (interquartile range, 49-64 years). The detection rate, sensitivity, specificity, PPV, NPV, accuracy, and AUC of 68Ga-DOTA-IBA and 18F-NaF PET/CT for bone metastases were 81%, 90%, 62%, 95%, 43%, 88%, 0.763, and 89%, 99%, 59%, 95%, 89%, 95%, 0.789, respectively. There was no significant difference between the two imaging methods (P < 0.01), and there was a significant correlation (X2=168.43, P < 0.001) and a strong consistency (Kappa=0.774,P < 0.001) between the diagnostic results of the two imaging agents. The SUVmax values of lesions measured by 68Ga-DOTA-IBA and 18F-NaF imaging in 22 patients with bone metastasis were 5.1 ± 5.4 and 19.6 ± 15.1, respectively, with statistically significant differences (P<0.05). The TBR values of the two imaging methods were 5.0 ± 5.0 and 6.7 ± 6.4, respectively, with statistically significant differences (P<0.05). The AUC of the SUVmax of 68Ga-DOTA-IBA and 18F-NaF curves were 0.824 and 0.862, respectively, with no statistically significant difference (P=0.490). No significant difference was found in the AUC of the TBR of 68Ga-DOTA-IBA and 18F-NaF (0.832 vs 0.890; P=0.248). Subgroup analysis showed significant correlation between the two imaging agents in the diagnosis of bone metastases in lung cancer and breast cancer, with consistent diagnostic results. However, in the diagnosis of bone metastases in prostate cancer, there was a significant difference (P<0.001) and lack of consistency (P=0.109). Conclusion: The diagnostic efficacy of 68Ga-DOTA-IBA for bone metastasis lesions is comparable to that of 18F-NaF. This finding holds significant clinical importance in terms of diagnosis of bone metastasis and selecting treatment plans for patients with malignant tumors.
RESUMO
BACKGROUND: Prostate cancer is the second most frequent cancer and the fifth leading cause of cancer-related deaths in men. Prostate-specific membrane antigen (PSMA) as a target has gained increasing attention. This research aims to investigate and understand how altering size of PEG impacts the in vitro and in vivo behavior and performance of PSMA inhibitors, with a specific focus on their pharmacokinetic characteristics and targeting properties. RESULTS: Two 68Ga-labeled PSMA-targeted radiotracers were developed, namely [68Ga]Ga-PP4-WD and [68Ga]Ga-PP8-WD, with varying sizes of polyethylene glycol (PEG). [68Ga]Ga-PP4-WD and [68Ga]Ga-PP8-WD had excellent affinity for PSMA with IC50 being 8.06 ± 0.91, 6.13 ± 0.79 nM, respectively. Both tracers enabled clear visualization of LNCaP tumors in PET images with excellent tumor-to-background contrast. They also revealed highly efficient uptake and internalization into LNCaP cells, increasing over time. The biodistribution studies demonstrated that both radioligands exhibited significant and specific uptake into LNCaP tumors. Furthermore, they were rapidly cleared through the renal pathway, as evidenced by [68Ga]Ga-PP4-WD and [68Ga]Ga-PP8-WD showing a tenfold and a fivefold less in renal uptake, respectively, compared to [68Ga]Ga-Flu-1 in 30 min. Both in vitro and in vivo experiments demonstrated that PEG size significantly impacted tumor-targeting and pharmacokinetic properties. CONCLUSIONS: These radiotracers have demonstrated their effectiveness in significantly reducing kidney uptake while maintaining the absorbed dose in tumors. Both radiotracers exhibited strong binding and internalization characteristics in vitro, displayed high specificity and affinity for PSMA in vivo.
RESUMO
The brown planthopper (BPH), Nilaparvata lugens, is one of the most destructive pests of rice. Given the threats posed by insecticide resistance to its control, eco-friendly strategies based on microbial pathogens emerged as a promising biocontrol alternative. In the present study, we isolated a native fungal pathogen against BPH from infected BPH cadavers and preliminarily identified as a strain of Aspergillus fumigatus based on morphological and molecular methods. Laboratory bioassay revealed that this fungal strain was highly virulent to BPH both at nymphal and adult stages, with the median lethal times (LT50) of 7.5 and 5.8 days under high conidial concentration of 1 × 109 conidia mL-1. A genome-wide view of gene expressions in BPH against fungal attack was analyzed by transcriptomic sequencing and consequently a large number of differentially expressed genes that mainly involved in host immune defense and cell detoxification were found. RNAi-mediated knockdown of an upregulated gene encoding a serine protease (NlSPN) could cause a significant decrease in BPH survival. Combination of dsRNA injection and fungal infection showed an additive effect on BPH mortality, which provided clues to develop new pest management strategies against BPH.
RESUMO
PURPOSE: This study aimed to explore the imaging value of 68 Ga-FAPI-04 PET/CT in synovitis, acne, pustulosis, hyperostosis, and osteitis (SAPHO) syndrome and compare it with that of 99m Tc-MDP bone scan. METHODS: Nineteen participants with SAPHO syndrome underwent 68 Ga-FAPI-04 PET/CT and 99m Tc-MDP bone scan. Demographic data and clinical features were recorded, SAPHO imaging features were analyzed, and the osteoarticular lesion detection rate in both methods was calculated. RESULTS: This prospective study recruited 4 men and 15 women aged 52.4 ± 8.6 years. The anterior chest wall was involved in all participants (100%). Palmoplantar pustulosis was the most common (36.8%) skin symptom. 99m Tc-MDP bone scan and 68 Ga-FAPI-04 PET/CT together detected 84 osteoarticular lesions, of which 91.7% (77/84) were detected by the former and 96.4% (81/84) by the latter. Furthermore, 68 Ga-FAPI-04 PET/CT detected 5 cases of knee and hip joint synovitis. CONCLUSIONS: 68 Ga-FAPI-04 PET/CT was more sensitive than 99m Tc-MDP bone scan when evaluating osteoarticular lesions in SAPHO syndrome and could also evaluate synovial lesions. 68 Ga-FAPI-04 PET/CT could be a good imaging method for SAPHO syndrome but requires further verification in a more extensive research cohort.
Assuntos
Osso e Ossos , Osteíte/diagnóstico por imagem , Tomografia por Emissão de Pósitrons combinada à Tomografia Computadorizada , Osso e Ossos/diagnóstico por imagem , Acne Vulgar , Sinovite/diagnóstico por imagem , Hiperostose/diagnóstico por imagem , Dermatopatias , Humanos , Masculino , Feminino , Adulto , Pessoa de Meia-Idade , IdosoRESUMO
With the advance of molecular biology, DNA analysis technology has been widely applied in forensic science. Non-human DNA analysis can be used in some special cases and has unique forensic value to provide investigation clues and trial basis. Animal DNA typing plays a more prominent role in the detection of all kinds of non-human DNA related cases and is the main content of forensic non-human DNA analysis. This paper reviews the development history, present situation, advantages and disadvantages of animal DNA typing according to its technology, characteristic, challenges facing forensic science application scenarios, and also its future development.
Assuntos
Impressões Digitais de DNA , Medicina Legal , Animais , DNA/genética , DNA/análise , Ciências Forenses , Biologia Molecular , Genética ForenseRESUMO
ABSTRACT: α-Emitter 225 Ac has been considered a candidate for targeted α-therapy. DOTA-IBA is new a precursor targeting bone metastasis. It can be used for radionuclide labeling with 225 Ac. We present a case with refractory bone pain for bone metastasis, who demonstrated an excellent therapy response after 1 cycle of 225 Ac-DOTA-IBA therapy. Moreover, the patient did not have any observable adverse effects.
Assuntos
Neoplasias Ósseas , Compostos Radiofarmacêuticos , Humanos , Compostos Radiofarmacêuticos/uso terapêutico , Compostos Heterocíclicos com 1 Anel/uso terapêutico , Neoplasias Ósseas/diagnóstico por imagem , Neoplasias Ósseas/radioterapia , Neoplasias Ósseas/secundário , RadioisótoposRESUMO
With the ongoing urbanization in developing regions, integrating regional waste disposal capability is challenging due to unbalanced economic development and rising environmental issues. This research proposed a multi-dimensional symbiotic integration of waste disposal capability. Applying data from the Yangtze River Delta (YRD) in China, we first explore the waste flows and interactions between cities to identify the possibility of inter-municipal collaboration based on the augmented gravity model. We then employ social network analysis to categorize the cities in the collaborative network of waste disposal into subgroups by functionalities. Finally, we proposed the top-down framework of symbiotic networks for waste disposal. Our findings indicate that YRD cities can be classified into four types according to their waste density and disposal efficiency: High-High, Low-High, Low-Low, and High-Low. We also identify three types of inter-municipal collaborative relationships: between high-density and high-efficiency cities, between high-density cities, and between high-efficiency cities. The city subgroups can be categorized into "high-efficiency clusters," "high-density clusters," and "hub clusters," which pave the way for a shared or complementary urban symbiosis in the waste recycling industry. The division of roles among subgroups enables symbiotic activities within the city cluster. This paper extends the spatial scope of industrial symbiosis literature and has practical implications for transitioning to a circular economy in waste management of developing countries.
Assuntos
Eliminação de Resíduos , Gerenciamento de Resíduos , Cidades , Rios , Simbiose , Eliminação de Resíduos/métodos , Gerenciamento de Resíduos/métodos , ChinaRESUMO
Purpose: Early diagnosis of refractory Mycoplasma pneumoniae pneumonia (RMPP) is challenging because of the lack of practical diagnostic imaging tools. Lung ultrasound (LUS) is an emerging tool for diagnosing childhood pneumonia. Hence, we evaluated the role of a nomogram combining LUS findings, clinical features, and laboratory indices in the early prediction of RMPP in children. Patients and Methods: We retrospectively analyzed 225 children with Mycoplasma pneumoniae pneumonia (MPP) admitted to our hospital between Dec 2018 and Aug 2021. Logistic regression analysis incorporated LUS findings and clinical predictors into the nomogram. Ninety patients hospitalized from Sep 2021 to Dec 2021 were used for external validation of the prediction model. Receiver operating characteristics (ROC) and calibration curves were used to evaluate the performance of the nomogram in the early diagnosis of RMPP. Results: Ultimately, Consolidation size /BSA (odds ratio (OR) 1.015, 95% confidence interval (CI) 1.536-2.446), Pleural Effusion (OR 3.551, 95% CI 1.921-15.600), LDH (OR 1.044, 95% CI 1.006-1. 021) and CRP (OR 3.293, 95% CI 1.019-1.098) were independent risk factors for the development of RMPP. The prediction model was represented visually as a nomogram. The area under the ROC curve for the predictive nomogram was 0.955 (95% CI 0.919-0.978) in the training cohort and 0.916 (95% CI 0.838-0.964) in the validation cohort. The calibration curve is close to the diagonal. Conclusion: This is the first-time lung ultrasound was added to the predicted nomogram, which can more comprehensively assess the condition and more accurately predict the occurrence of RMPP early. Therefore, this nomogram can be widely used in the early diagnosis of RMPP, especially in primary care hospitals.
RESUMO
Tomato yellow mottle-associated virus (TYMaV), is a member of the genus Cytorhabdovirus in the family Rhabdoviridae, which has been reported to infect tomato (Lycopersicon esculentum) (Xu et al. 2017), Solanum nigrum (Li et al., 2022) and Nicotiana benthamiana (Zhou et al. 2019). In July 2021, virus-like symptoms of chlorosis, mosaic, and ring spots were observed in pepper, tomato, and eggplant during a survey of viral symptoms in Huzhou City, Zhejiang Province, China. To identify viral agents potentially associated with these diseases, an Oxford Nanopore cDNA library from the mixed samples was generated and sequenced. Briefly, total RNA from 10 leaf tissue samples (3 pepper plants, 4 tomato plants, and 3 eggplant plants) was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan) and pooled in equal amounts (100 ng/ïl each). The library was constructed using a PCR-cDNA sequencing kit (SQK-PCS109; Oxford Nanopore Technologies, Oxford, UK) in accordance with the manufacturer's instructions. Approximately 8.6 million reads were obtained from the Oxford MinION platform. After removing adapters and low-quality reads using iVar v1.3.1 (Grubaugh et al., 2019), the clean reads were subjected to BLASTn search in the GenBank database. We identified sequences derived from potato virus X (PVX), potato virus Y (PVY), cucumber mosaic virus (CMV), pepper mottle virus (PepMoV), and TYMaV. Of these reads, 339 with lengths ranging from 375 to 8651 nt were mapped to the genome of TYMaV (GeneBank Accession No. KY075646.1) at a 98.2% query coverage. To identify TYMaV-infected plants in the pooled samples, all 10 samples were analyzed by two-step RT-PCR using AMV reverse transcriptase (Takara, Tokyo, Japan) combined with random primers N6 (Takara, Dalian, China) and high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan) with primer pairs: N-F 5'- CAGGGAGAGAATGTACAAGTTGATC'/N-R 5'- GACCTTGCTCATCTGATGCAAC -3', amplifying 420 bp of the 3'end of nucleoprotein (N) gene. A pepper sample showing chlorosis symptom was positive for the TYMaV infection, but negative for PVX, PVY, CMV or PepMoV infection when tested using the primers listed in table S1. To confirm the genome sequence of TYMaV Zhejiang isolate (TYMaV-ZJ), we carried out two-step RT-PCR with seven primer pairs (Table S1) designed based on the reference TYMaV genome (GeneBank accession number KY075646.1). PCR products were cloned into pLB vector (Tiangen, Beijing, China) and Sanger sequenced in both directions. At least five independent clones of each fragment were sequenced to avoid possible mutations introduced by PCT. The sequences were assembled into a nearlyfull-length genome of TYMaV -ZJ which was composed of 13344nt (GeneBank accession number OP296980). Pairwise sequence comparison revealed that TYMaV -ZJ genome shared 91.50% and 85.59% nt sequence identity with that of the TYMaV tomato isolate (KY075646.1) and the Solanum nigrum isolate (MW527091.1), which is higher than the species demarcation threshold of 75% for the genus Cytorhabdovirus (Walker et al., 2022). To the best of our knowledge, this is the first report of TYMaV infecting pepper.
RESUMO
Energy consumption and industrial activities are the primary sources of carbon emissions. As the "world's factory" and the largest carbon emitter, China has been emphasizing the core role of technological innovation in promoting industrial structure upgrades (ISU) and energy efficiency (EE) to reduce carbon emissions from industrial production and energy consumption. This study investigated the mechanism (through ISU and EE) and spillover effect of technological innovation on carbon emission reduction using the panel dataset of 30 Chinese provinces from 2008 to 2019 and spatial econometrics models. The study concluded that (1) technological innovation had a negative direct effect on provincial carbon emissions, while it also showed a spatial spillover effect on neighboring provinces; (2) technological innovation had an indirect effect on provincial carbon emissions reduction through the mediation of energy efficiency improvement, while the mediation effect of industrial structure upgrading is not yet significant; and (3) the effect of technological innovation on carbon emission reduction showed heterogeneity in the eastern, central, and western regions of China. This study provided empirical and theoretical references to decision-makers in China and other developing countries in promoting technological and carbon control policies. More specifically, direct technology investment and indirect investment in industrial structure upgrades and energy efficiency could help with regional carbon emissions reduction.
Assuntos
Dióxido de Carbono , Tecnologia , Dióxido de Carbono/análise , China , Desenvolvimento Econômico , Indústrias , Invenções , Investimentos em SaúdeRESUMO
AIMS: We aimed to evaluate the utility of 68Ga-citrate positron emission tomography (PET)/CT in the differentiation of periprosthetic joint infection (PJI) and aseptic loosening (AL), and compare it with 99mTc-methylene bisphosphonates (99mTc-MDP) bone scan. METHODS: We studied 39 patients with suspected PJI or AL. These patients underwent 68Ga-citrate PET/CT, 99mTc-MDP three-phase bone scan and single-photon emission CT (SPECT)/CT. PET/CT was performed at ten minutes and 60 minutes after injection, respectively. Images were evaluated by three nuclear medicine doctors based on: 1) visual analysis of the three methods based on tracer uptake model, and PET images attenuation-corrected with CT and those not attenuation-corrected with CT were analyzed, respectively; and 2) semi-quantitative analysis of PET/CT: maximum standardized uptake value (SUVmax) of lesions, SUVmax of the lesion/SUVmean of the normal bone, and SUVmax of the lesion/SUVmean of the normal muscle. The final diagnosis was based on the clinical and intraoperative findings, and histopathological and microbiological examinations. RESULTS: Overall, 23 and 16 patients were diagnosed with PJI and AL, respectively. The sensitivity and specificity of three-phase bone scan and SPECT/CT were 100% and 62.5%, 82.6%, and 100%, respectively. Attenuation correction (AC) at 60 minutes and non-AC at 60 minutes of PET/CT had the same highest sensitivity and specificity (91.3% and 100%), and AC at 60 minutes combined with SPECT/CT could improve the diagnostic efficiency (sensitivity = 95.7%). Diagnostic efficacy of the SUVmax was low (area under the curve (AUC) of ten minutes and 60 minutes was 0.814 and 0.806, respectively), and SUVmax of the lesion/SUVmean of the normal bone at 60 minutes was the best semi-quantitative parameter (AUC = 0.969). CONCLUSION: 68Ga-citrate showed the potential to differentiate PJI from AL, and visual analysis based on uptake pattern of tracer was reliable. The visual analysis method of AC at 60 minutes, combined with 99mTc-MDP SPECT/CT, could improve the sensitivity from 91.3% to 95.7%. In addition, a major limitation of our study was that it had a limited sample size, and more detailed studies with a larger sample size are warranted. Cite this article: Bone Joint Res 2022;11(6):398-408.
RESUMO
Background: Bone is a common site of metastasis from a malignant tumor. Several radiopharmaceuticals are available to relieve bone pain in patients with cancer. However, every radiopharmaceutical has its own disadvantages, and there is still a need to investigate easily accessible and high bone affinity radiopharmaceuticals. Ibandronate (IBA) and 188Re were used for radiolabeling to develop and evaluate a novel type of bone-seeking radiopharmaceutical. Methods: The preparation conditions of [188Re]Re-IBA were investigated, and thin-layer chromatography was used to analyze radiochemical purity. The stability, plasma protein binding rate, lipid-water distribution coefficient, safety and biodistribution in normal mice, and bone imaging of [188Re]Re-IBA in New Zealand rabbits were studied. In addition, the nude mice model of bone metastasis was established, and biodistribution and imaging characteristics of [188Re]Re-IBA in these nude mice were studied. Results: [188Re]Re-IBA was successfully prepared with radiochemical purity >95%. The optimum preparation conditions were as follows: IBA, 0.8-1.4 mg; ascorbic acid, 0.2-0.5 mg; stannous chloride, 0.14-0.18 mg; potassium perrhenate, 0.005 mg; and [188Re]ReO4 - activity, 18.5-296 MBq, reacted for 30 min at 95°C with pH = 2. [188Re]Re-IBA demonstrated good stability, high plasma protein binding rate, good hydrophilicity, and low toxicity. The biodistribution and bone imaging in normal animals showed rapid blood clearance, high bone uptake, low uptake in the solid organs and soft tissue, and high contrast during imaging. The biodistribution and imaging of bone metastasis in nude mice showed that [188Re]Re-IBA has higher uptake in bone metastasis lesions than normal bone. Conclusions: Our study encompassed the successful preparation of [188Re]Re-IBA, a novel bone-seeking radiopharmaceutical, and confirmed it has potential in the treatment of bone metastasis and monitoring through imaging.
Assuntos
Neoplasias Ósseas , Compostos Radiofarmacêuticos , Animais , Neoplasias Ósseas/diagnóstico por imagem , Neoplasias Ósseas/radioterapia , Neoplasias Ósseas/secundário , Humanos , Ácido Ibandrônico , Camundongos , Camundongos Nus , Coelhos , Compostos Radiofarmacêuticos/química , Nanomedicina Teranóstica , Distribuição TecidualRESUMO
The brown planthopper, Nilaparvata lugens, is a difficult-to-control insect pest affecting rice yields in Asia. As a structural component of the inter-alpha-trypsin inhibitor (ITI), the inter-alpha-trypsin inhibitor heavy chain (ITIH) has been reported to be involved in various inflammatory or malignant disorders, ovarian development, and ovulation. To reveal the function of ITIH4 in N. lugens, the gene encoding N. lugens ITIH4 (NlITIH4) was cloned and characterized. NlITIH4 contains a signal peptide, a vault protein inter-alpha-trypsin domain, and a von Willebrand factor type A domain. qPCR analysis showed that NlITIH4 was expressed at all developmental stages and in all tissues (fat body, ovary, and gut), with the highest expression in the fat body. Double stranded NlITIH4 (dsNlITIH4) injection clearly led to an RNAi-mediated inhibition of the expression of NlITIH4 and resulted in reduced survival, delayed ovarian development, and reduced egg production and egg hatching. These results indicate that NlITIH4 plays an important role in the development and reproduction of N. lugens.
RESUMO
E-waste is one of the fastest growing streams of solid waste globally, and its effective management has become a focused issue, which requires a deep understanding of the core guiding theory of extended producer responsibility (EPR). Over the past 20 years, China, one of the world's largest producers of electrical and electronic equipment (EEE), has made great efforts to improve e-waste management along with the massive generation of e-waste. In 2012, China implemented a unique EPR-based e-waste fund policy. However, the fund policy is unsustainable due to the challenges of non-closed resource use, informal recycling, and fund imbalance. Beginning with an overview of these challenges, this paper focuses on redesigning the fund policy from a closed-loop lifecycle perspective in order to maintain a balanced development of the resource use loop and the fund system in China's ten-year plan. In doing so, two EPR instruments, recycling content standards and consumer-oriented deposits, are added to the current fund policy. Subsequently, three extension scenarios alternately changed a critical parameter of the model to test the impact on sustainable capabilities. In this way, the sustainable supply of funds and secondary resources for the e-waste industry can be established in China and effectively demonstrate solid waste management in developing countries.
Assuntos
Resíduo Eletrônico , Administração Financeira , Gerenciamento de Resíduos , China , Resíduo Eletrônico/análise , Políticas , ReciclagemRESUMO
Adulteration of high-value beef with lower-priced alternatives is a world-wide problem resulting in consumers' distrust and market chaos. Therefore, effective methods for the identification and quantification of adulterated beef products are urgently needed. In this study, we developed a reliable droplet digital PCR (ddPCR) method targeting the single-copy nuclear genes for qualitative and quantitative detection of the presence of porcine and chicken derivatives in beef. A fixed constant (transfer coefficient) was introduced to directly transform the ratio of DNA copy number to the mass proportion of targeted meats. Results revealed that the linearity range of quantification for pork and chicken were both from 1% (w/w) to 90% (w/w). The limit of detection (LOD) and limit of quantification (LOQ) of the developed ddPCR method were the same for pork and chicken in beef, with LOD 0.1% (w/w) and LOQ 1% (w/w). The accuracy and applicability of the method was tested and verified using mixed samples with the known proportions and commercially available beef products. We conclude that our developed ddPCR method was accurate and reliable in identifying and quantifying porcine and chicken derivatives in beef and therefore has great potential to be applied in routine analyses and quality control of beef products.
RESUMO
BACKGROUND: Vascular punctures are widely used in clinical applications; however, clinical trials have identified complications and poor prognosis for patients undergoing common peripheral vein puncture as compared to ultrasound-guided peripheral venipuncture and catheterization. Ultrasound-guided peripheral venipuncture and catheterization is accurate, simple, has fewer associated complications, and will gradually take the place of common peripheral vein puncture. METHODS: To study the safety of ultrasound-guided peripheral venous catheterization, a meta-analysis was conducted of relevant articles dating from establishment date of the database (such as PubMed, MEDLINE and EMBASE) to March 2021, with the search keywords being peripheral venipuncture, ultrasound guidance, vascular injury rate, and hematoma formation rate. A total of 8 trials were used to determine accuracy indicators, which included puncture failure rate, arterial injury rate, hematoma formation rate, pneumothorax incidence rate, and hemothorax incidence rate. RESULTS: There were statistically significant differences between the two methods for peripheral venipuncture and catheterization in terms of puncture failure rate [odds ratio (OR) =0.08; 95% CI: 0.04-0.16; P<0.00001], incidence of vascular injury (OR =0.15; 95% CI: 0.07-0.32; P<0.00001), probability of hematoma formation during the puncture process (OR =0.24; 95% CI: 0.08-0.69; P=0.008), and probability of pneumothorax during puncture (OR =0.10; 95% CI: 0.02-0.55; P=0.008). DISCUSSION: Eight articles were included for meta-analysis. Ultrasound-guided peripheral venipuncture and catheterization is a commonly used puncture method for patients needing rapid fluid infusion with pressure or a pressure pump, repeated transfusion of blood product, or multiple daily venous blood drawing test. The results were very clear, and the puncture failure rate and other complications of ultrasound-guided peripheral venipuncture catheterization were low.
Assuntos
Cateterismo Venoso Central , Flebotomia , Ensaios Clínicos como Assunto , Humanos , Incidência , Flebotomia/efeitos adversos , Ultrassonografia , Ultrassonografia de IntervençãoRESUMO
Cyanobacterial blooms constitute a global ecological problem that can seriously threaten human health. One of the most common bloom-forming cyanobacteria in freshwater is Microcystis aeruginosa, whose secretion of toxic substances (microcystins, MCs) have strong liver toxicity and endanger the health of exposed people through contaminated aquatic products and drinking water. However, few studies on the neurotoxicity of M. aeruginosa to zebrafish have simulated the process of an actual cyanobacterial bloom. In this study, we used the zebrafish (Danio rerio) as an effective model organism to study the acute neurotoxicity of M. aeruginosa, and to clarify its principal mechanism of action. A total of 82 upregulated and 26 downregulated proteins were detected by quantitative proteomics analysis in zebrafish brain after exposure to M. aeruginosa. Intriguingly, these proteins with changed expression were related to Synaptic vesicle cycle and terpenoid skeleton biosynthesis pathway, such as ACAT, STX1A, and V-ATPase. The obtained results uniformly indicated that the neurotoxicity of M. aeruginosa seriously damaged the neurotransmitter conduction in the nervous system and brain information storage and transmission of zebrafish and makes it more susceptible to neurological diseases. Our study provides a new perspective on the neurotoxicity risk of cyanobacterial blooms.
Assuntos
Microcystis , Peixe-Zebra , Animais , Encéfalo , Água Doce , Humanos , Microcistinas/toxicidade , ProteômicaRESUMO
BACKGROUND: Whitefly Bemisia tabaci is a phloem-feeding insect and causes extensive agricultural damage around the world. Although the parasitic wasp Encarsia formosa is widely used to control B. tabaci on glasshouse tomatoes, low efficiency and discontinuity are frequently recorded. It has been well-documented that herbivore-induced plant volatiles (HIPVs) are important cues in the foraging behavior of the natural enemies of herbivores. However, the volatiles emitted from tomatoes infested by different developmental stages of B. tabaci (nymphs versus adults) have not been compared in terms of their effects on E. formosa attraction. RESULTS: Olfactometer assays with four tomato cultivars revealed that the E. formosa wasps showed a significant attraction to the volatiles from adult-infested plants (except for cv. Castlemart), but not to those from nymph-infested plants. In a close-range habitat, however, the wasps appeared to use visual or tactile cues derived from nymphs for host location. Volatile analyses and behavioral assays showed that wasp attraction was correlated with enhanced ß-myrcene and ß-caryophyllene emissions from adult-infested plants. Furthermore, the use of B. tabaci adult-induced plant cues under glasshouse conditions resulted in a higher parasitism rate by this parasitoid. CONCLUSION: Our findings confirm that E. formosa uses the HIPVs resulting from feeding of B. tabaci adults to locate host habitat. Release of ß-myrcene and ß-caryophyllene from dispensers may enhance the efficacy of E. formosa as a biological control agent against B. tabaci in glasshouse production systems.