Plant Promoters and Terminators for High-Precision Bioengineering.

High-precision bioengineering and synthetic biology require fine-tuning gene expression at both transcriptional and posttranscriptional levels. Gene transcription is tightly regulated by promoters and terminators. Promoters determine the timing, tissues and cells, and levels of the expression of genes. Terminators mediate transcription termination of genes and affect mRNA levels posttranscriptionally, e.g., the 3'-end processing, stability, translation efficiency, and nuclear to cytoplasmic export of mRNAs. The promoter and terminator combination affects gene expression. In the present article, we review the function and features of plant core promoters, proximal and distal promoters, and terminators, and their effects on and benchmarking strategies for regulating gene expression.

Stepwise Optimization of Real-Time RT-PCR Analysis.

Quantitative real-time reverse transcription PCR (qRT-PCR) analysis has been used routinely to quantify gene expression levels. Primer design and the optimization of qRT-PCR parameters are critical for the accuracy and reproducibility of qRT-PCR analysis. Computational tool-assisted primer design often overlooks the presence of homologous sequences of the gene of interest and the sequence similarities between homologous genes in a plant genome. This sometimes results in skipping the optimization of qRT-PCR parameters due to the false confidence in the quality of the designed primers. Here we present a stepwise optimization protocol for single nucleotide polymorphisms (SNPs)-based sequence-specific primer design and sequential optimization of primer sequences, annealing temperatures, primer concentrations, and cDNA concentration range for each reference and target gene. The goal of this optimization protocol is to achieve a standard cDNA concentration curve with an R2 ≥ 0.9999 and efficiency (E) = 100 ± 5% for the best primer pair of each gene, which serves as the prerequisite for using the 2-ΔΔCT method for data analysis.

Differential SW16.1 allelic effects and genetic backgrounds contributed to increased seed weight after soybean domestication.

Although seed weight has increased following domestication from wild soybean (Glycine soja) to cultivated soybean (Glycine max), the genetic basis underlying this change is unclear. Using mapping populations derived from chromosome segment substitution lines of wild soybean, we identified SW16.1 as the causative gene underlying a major quantitative trait locus controlling seed weight. SW16.1 encodes a nucleus-localized LIM domain-containing protein. Importantly, the GsSW16.1 allele from wild soybean accession N24852 had a negative effect on seed weight, whereas the GmSW16.1 allele from cultivar NN1138-2 had a positive effect. Gene expression network analysis, reverse-transcription quantitative polymerase chain reaction, and promoter-luciferase reporter transient expression assays suggested that SW16.1 regulates the transcription of MT4, a positive regulator of seed weight. The natural variations in SW16.1 and other known seed weight genes were analyzed in soybean germplasm. The SW16.1 polymorphism was associated with seed weight in 247 soybean accessions, showing much higher frequency of positive-effect alleles in cultivated soybean than in wild soybean. Interestingly, gene allele matrix analysis of the known seed weight genes revealed that G. max has lost 38.5% of the G. soja alleles and that most of the lost alleles had negative effects on seed weight. Our results suggest that eliminating negative alleles from G. soja led to a higher frequency of positive alleles and changed genetic backgrounds in G. max, which contributed to larger seeds in cultivated soybean after domestication from wild soybean. Our findings provide new insights regarding soybean domestication and should assist current soybean breeding programs.

Engineered Cleistogamy in Camelina sativa for bioconfinement.

Camelina sativa is a self-pollinating and facultative outcrossing oilseed crop. Genetic engineering has been used to improve camelina yield potential for altered fatty acid composition, modified protein profiles, improved seed and oil yield, and enhanced drought resistance. The deployment of transgenic camelina in the field posits high risks related to the introgression of transgenes into non-transgenic camelina and wild relatives. Thus, effective bioconfinement strategies need to be developed to prevent pollen-mediated gene flow (PMGF) from transgenic camelina. In the present study, we overexpressed the cleistogamy (i.e. floral petal non-openness)-inducing PpJAZ1 gene from peach in transgenic camelina. Transgenic camelina overexpressing PpJAZ1 showed three levels of cleistogamy, affected pollen germination rates after anthesis but not during anthesis, and caused a minor silicle abortion only on the main branches. We also conducted field trials to examine the effects of the overexpressed PpJAZ1 on PMGF in the field, and found that the overexpressed PpJAZ1 dramatically inhibited PMGF from transgenic camelina to non-transgenic camelina under the field conditions. Thus, the engineered cleistogamy using the overexpressed PpJAZ1 is a highly effective bioconfinement strategy to limit PMGF from transgenic camelina, and could be used for bioconfinement in other dicot species.

The genomic and bulked segregant analysis of Curcuma alismatifolia revealed its diverse bract pigmentation.

Compared with most flowers where the showy part comprises specialized leaves (petals) directly subtending the reproductive structures, most Zingiberaceae species produce showy "flowers" through modifications of leaves (bracts) subtending the true flowers throughout an inflorescence. Curcuma alismatifolia, belonging to the Zingiberaceae family, a plant species originating from Southeast Asia, has become increasingly popular in the flower market worldwide because of its varied and esthetically pleasing bracts produced in different cultivars. Here, we present the chromosome-scale genome assembly of C. alismatifolia "Chiang Mai Pink" and explore the underlying mechanisms of bract pigmentation. Comparative genomic analysis revealed C. alismatifolia contains a residual signal of whole-genome duplication. Duplicated genes, including pigment-related genes, exhibit functional and structural differentiation resulting in diverse bract colors among C. alismatifolia cultivars. In addition, we identified the key genes that produce different colored bracts in C. alismatifolia, such as F3'5'H, DFR, ANS and several transcription factors for anthocyanin synthesis, as well as chlH and CAO in the chlorophyll synthesis pathway by conducting transcriptomic analysis, bulked segregant analysis using both DNA and RNA data, and population genomic analysis. This work provides data for understanding the mechanism of bract pigmentation and will accelerate breeding in developing novel cultivars with richly colored bracts in C. alismatifolia and related species. It is also important to understand the variation in the evolution of the Zingiberaceae family. Supplementary Information: The online version contains supplementary material available at 10.1007/s42994-022-00081-6.

Functional analysis of soybean cyst nematode-inducible synthetic promoters and their regulation by biotic and abiotic stimuli in transgenic soybean (Glycine max).

We previously identified cis-regulatory motifs in the soybean (Glycine max) genome during interaction between soybean and soybean cyst nematode (SCN), Heterodera glycines. The regulatory motifs were used to develop synthetic promoters, and their inducibility in response to SCN infection was shown in transgenic soybean hairy roots. Here, we studied the functionality of two SCN-inducible synthetic promoters; 4 × M1.1 (TAAAATAAAGTTCTTTAATT) and 4 × M2.3 (ATATAATTAAGT) each fused to the -46 CaMV35S core sequence in transgenic soybean. Histochemical GUS analyses of transgenic soybean plants containing the individual synthetic promoter::GUS construct revealed that under unstressed condition, no GUS activity is present in leaves and roots. While upon nematode infection, the synthetic promoters direct GUS expression to roots predominantly in the nematode feeding structures induced by the SCN and by the root-knot nematode (RKN), Meloidogyne incognita. There were no differences in GUS activity in leaves between nematode-infected and non-infected plants. Furthermore, we examined the specificity of the synthetic promoters in response to various biotic (insect: fall armyworm, Spodoptera frugiperda; and bacteria: Pseudomonas syringe pv. glycinea, P. syringe pv. tomato, and P. marginalis) stresses. Additionally, we examined the specificity to various abiotic (dehydration, salt, cold, wounding) as well as to the signal molecules salicylic acid (SA), methyl jasmonate (MeJA), and abscisic acid (ABA) in the transgenic plants. Our wide-range analyses provide insights into the potential applications of synthetic promoter engineering for conditional expression of transgenes leading to transgenic crop development for resistance improvement in plant.

Coordinated transcriptional regulation of the carotenoid biosynthesis contributes to fruit lycopene content in high-lycopene tomato genotypes.

Lycopene content in tomato fruit is largely under genetic control and varies greatly among genotypes. Continued improvement of lycopene content in elite varieties with conventional breeding has become challenging, in part because little is known about the underlying molecular mechanisms in high-lycopene tomatoes (HLYs). We collected 42 HLYs with different genetic backgrounds worldwide. High-performance liquid chromatography (HPLC) analysis revealed lycopene contents differed among the positive control wild tomato Solanum pimpinellifolium, HLYs, the normal lycopene cultivar "Moneymaker", and the non-lycopene cultivar NC 1Y at the pink and red ripe stages. Real-time RT-PCR analysis of expression of the 25 carotenoid biosynthesis pathway genes of each genotype showed a significantly higher expression in nine upstream genes (GGPPS1, GGPPS2, GGPPS3, TPT1, SSU II, PSY2, ZDS, CrtISO and CrtISO-L1 but not the well-studied PSY1, PDS and Z-ISO) at the breaker and/or red ripe stages in HLYs compared to Moneymaker, indicating a higher metabolic flux flow into carotenoid biosynthesis pathway in HLYs. Further conversion of lycopene to carotenes may be prevented via the two downstream genes (ß-LCY2 and ε-LCY), which had low-abundance transcripts at either or both stages. Additionally, the significantly higher expression of four downstream genes (BCH1, ZEP, VDE, and CYP97C11) at either or both ripeness stages leads to significantly lower fruit lycopene content in HLYs than in the wild tomato. This is the first systematic investigation of the role of the complete pathway genes in regulating fruit lycopene biosynthesis across many HLYs, and enables tomato breeding and gene editing for increased fruit lycopene content.

Genotype-independent plant transformation.

Plant transformation and regeneration remain highly species- and genotype-dependent. Conventional hormone-based plant regeneration via somatic embryogenesis or organogenesis is tedious, time-consuming, and requires specialized skills and experience. Over the last 40 years, significant advances have been made to elucidate the molecular mechanisms underlying embryogenesis and organogenesis. These pioneering studies have led to a better understanding of the key steps and factors involved in plant regeneration, resulting in the identification of crucial growth and developmental regulatory genes that can dramatically improve regeneration efficiency, shorten transformation time, and make transformation of recalcitrant genotypes possible. Co-opting these regulatory genes offers great potential to develop innovative genotype-independent genetic transformation methods for various plant species, including specialty crops. Further developing these approaches has the potential to result in plant transformation without the use of hormones, antibiotics, selectable marker genes, or tissue culture. As an enabling technology, the use of these regulatory genes has great potential to enable the application of advanced breeding technologies such as genetic engineering and gene editing for crop improvement in transformation-recalcitrant crops and cultivars. This review will discuss the recent advances in the use of regulatory genes in plant transformation and regeneration, and their potential to facilitate genotype-independent plant transformation and regeneration.

BrABF3 promotes flowering through the direct activation of CONSTANS transcription in pak choi.

Drought stress triggers the accumulation of the phytohormone abscisic acid (ABA), which in turn activates the expression of the floral integrator gene CONSTANS (CO), accelerating flowering. However, the molecular mechanism of ABA-induced CO activation remains elusive. Here, we conducted a yeast one-hybrid assay using the CO promoter from Brassica campestris (syn. Brassica rapa) ssp. chinensis (pak choi) to screen the ABA-induced pak choi library and identified the transcription activator ABF3 (BrABF3). BrABF3, the expression of which was induced by ABA in pak choi, directly bound to the CO promoter from both pak choi and Arabidopsis. The BrABF3 promoter is specifically active in the Arabidopsis leaf vascular tissue, where CO is mainly expressed. Impaired BrABF3 expression in pak choi decreased BrCO expression levels and delayed flowering, whereas ectopic expression of BrABF3 in Arabidopsis increased CO expression and induced earlier flowering under the long-day conditions. Electrophoretic mobility shift assay analysis showed that BrABF3 was enriched at the canonical ABA-responsive element-ABRE binding factor (ABRE-ABF) binding motifs of the BrCO promoter. The direct binding of BrABF3 to the ABRE elements of CO was further confirmed by chromatin immunoprecipitation quantitative PCR. In addition, the induction of BrCO transcription by BrABF3 could be repressed by BrCDF1 in the morning. Thus, our results suggest that ABA could accelerate the floral transition by directly activating BrCO transcription through BrABF3 in pak choi.

The optimization of the "UAV-vehicle" joint delivery route considering mountainous cities.

As a new transportation tool, unmanned aerial vehicle (UAV), has a broad application prospect in logistics distribution, especially for mountainous cities with complex terrain. Due to the limited delivery conditions of UAV, considering the advantages of traditional vehicle delivery, this paper proposes a joint delivery mode of UAV and vehicle, and designs three steps for the joint delivery problem of single UAV and single vehicle: first, mark all special nodes; Secondly, the route of UAV and vehicle is planned; Finally, the total delivery route is optimized to minimize the total delivery distance. Genetic algorithm and single distribution terminal optimization are used to solve the problem, and the joint delivery in this paper is compared with the traditional vehicle delivery and the independent delivery of UAV and vehicle. The results show that UAV and vehicle can cooperate with each other to complete the delivery of all customer demand nodes, and the joint delivery of UAV and vehicle can effectively reduce the total delivery distance. Finally, the sensitivity analysis of UAV's maximum load, maximum flight distance, relative speed between UAV and vehicle, and road impedance coefficient is carried out. By relaxing the restrictions of UAV, the UAV can deliver more customers at a single time, and it complete the delivery task with vehicles efficiently.

Identification of Novel Genomic Regions for Bacterial Leaf Pustule (BLP) Resistance in Soybean (Glycine max L.) via Integrating Linkage Mapping and Association Analysis.

Bacterial leaf pustule (BLP), caused by Xanthornonas axonopodis pv. glycines (Xag), is a worldwide disease of soybean, particularly in warm and humid regions. To date, little is known about the underlying molecular mechanisms of BLP resistance. The only single recessive resistance gene rxp has not been functionally identified yet, even though the genotypes carrying the gene have been widely used for BLP resistance breeding. Using a linkage mapping in a recombinant inbred line (RIL) population against the Xag strain Chinese C5, we identified that quantitative trait locus (QTL) qrxp-17-2 accounted for 74.33% of the total phenotypic variations. We also identified two minor QTLs, qrxp-05-1 and qrxp-17-1, that accounted for 7.26% and 22.26% of the total phenotypic variations, respectively, for the first time. Using a genome-wide association study (GWAS) in 476 cultivars of a soybean breeding germplasm population, we identified a total of 38 quantitative trait nucleotides (QTNs) on chromosomes (Chr) 5, 7, 8, 9,15, 17, 19, and 20 under artificial infection with C5, and 34 QTNs on Chr 4, 5, 6, 9, 13, 16, 17, 18, and 20 under natural morbidity condition. Taken together, three QTLs and 11 stable QTNs were detected in both linkage mapping and GWAS analysis, and located in three genomic regions with the major genomic region containing qrxp_17_2. Real-time RT-PCR analysis of the relative expression levels of five potential candidate genes in the resistant soybean cultivar W82 following Xag treatment showed that of Glyma.17G086300, which is located in qrxp-17-2, significantly increased in W82 at 24 and 72 h post-inoculation (hpi) when compared to that in the susceptible cultivar Jack. These results indicate that Glyma.17G086300 is a potential candidate gene for rxp and the QTLs and QTNs identified in this study will be useful for marker development for the breeding of Xag-resistant soybean cultivars.

An optimized protocol for stepwise optimization of real-time RT-PCR analysis.

Computational tool-assisted primer design for real-time reverse transcription (RT) PCR (qPCR) analysis largely ignores the sequence similarities between sequences of homologous genes in a plant genome. It can lead to false confidence in the quality of the designed primers, which sometimes results in skipping the optimization steps for qPCR. However, the optimization of qPCR parameters plays an essential role in the efficiency, specificity, and sensitivity of each gene's primers. Here, we proposed an optimized approach to sequentially optimizing primer sequences, annealing temperatures, primer concentrations, and cDNA concentration range for each reference (and target) gene. Our approach started with a sequence-specific primer design that should be based on the single-nucleotide polymorphisms (SNPs) present in all the homologous sequences for each of the reference (and target) genes under study. By combining the efficiency calibrated and standard curve methods with the 2-ΔΔCt method, the standard cDNA concentration curve with a logarithmic scale was obtained for each primer pair for each gene. As a result, an R2 ≥ 0.9999 and the efficiency (E) = 100 ± 5% should be achieved for the best primer pair of each gene, which serve as the prerequisite for using the 2-ΔΔCt method for data analysis. We applied our newly developed approach to identify the best reference genes in different tissues and at various inflorescence developmental stages of Tripidium ravennae, an ornamental and biomass grass, and validated their utility under varying abiotic stress conditions. We also applied this approach to test the expression stability of six reference genes in soybean under biotic stress treatment with Xanthomonas axonopodis pv. glycines (Xag). Thus, these case studies demonstrated the effectiveness of our optimized protocol for qPCR analysis.

CNN1 regulates the DKK1/Wnt/ß-catenin/c-myc signaling pathway by activating TIMP2 to inhibit the invasion, migration and EMT of lung squamous cell carcinoma cells.

The present study aimed to investigate the effect of calponin 1 (CNN1) on the invasion and migration of lung squamous cell carcinoma (LUSC) cells and the associations between CNN1, tissue inhibitor of metalloproteinases 2 (TIMP2), Dickkopf-1 (DKK1) and the Wnt/ß-catenin/c-myc signaling pathway. The expression levels of CNN1 and TIMP2 in LUSC cells and the association between CNN1 and TIMP2 were predicted using the GEPIA database. The cells were transiently transfected to overexpress CNN1, which resulted in inhibition of DKK1 and TIMP2 expression levels. Wound healing and Transwell assays were used to detect the invasive and migratory abilities of LUSC cells. Reverse transcription-quantitative PCR and western blotting were used to investigate the expression levels of CNN1, MMP2, MMP9, E-cadherin, N-cadherin (N-cad), SLUG, DKK1, ß-catenin and c-myc. The expression levels of N-cad were detected using immunofluorescence staining. The results indicated that overexpression of CNN1 inhibited the invasion and migration of NCI-H2170 cells. Inhibition of DKK1 reversed this change and the expression levels of ß-catenin and c-myc were upregulated, whereas the expression levels of DKK1 were downregulated with a concomitant inhibition of TIMP2. In summary, these results demonstrated that CNN1 regulated the DKK1/Wnt/ß-catenin/c-myc signaling pathway by activating TIMP2 to inhibit the invasion, migration and epithelial-to-mesenchymal transition of LUSC cells.

Reproductive developmental transcriptome analysis of Tripidium ravennae (Poaceae).

BACKGROUND: Tripidium ravennae is a cold-hardy, diploid species in the sugarcane complex (Poaceae subtribe Saccharinae) with considerable potential as a genetic resource for developing improved bioenergy and ornamental grasses. An improved understanding of the genetic regulation of reproductive processes (e.g., floral induction, inflorescence development, and seed development) will enable future applications of precision breeding and gene editing of floral and seed development. In particular, the ability to silence reproductive processes would allow for developing seedless forms of valuable but potentially invasive plants. The objective of this research was to characterize the gene expression environment of reproductive development in T. ravennae. RESULTS: During the early phases of inflorescence development, multiple key canonical floral integrators and pathways were identified. Annotations of type II subfamily of MADS-box transcription factors, in particular, were over-represented in the GO enrichment analyses and tests for differential expression (FDR p-value < 0.05). The differential expression of floral integrators observed in the early phases of inflorescence development diminished prior to inflorescence determinacy regulation. Differential expression analysis did not identify many unique genes at mid-inflorescence development stages, though typical biological processes involved in plant growth and development expressed abundantly. The increase in inflorescence determinacy regulatory elements and putative homeotic floral development unigenes at mid-inflorescence development coincided with the expression of multiple meiosis annotations and multicellular organism developmental processes. Analysis of seed development identified multiple unigenes involved in oxidative-reductive processes. CONCLUSION: Reproduction in grasses is a dynamic system involving the sequential coordination of complex gene regulatory networks and developmental processes. This research identified differentially expressed transcripts associated with floral induction, inflorescence development, and seed development in T. ravennae. These results provide insights into the molecular regulation of reproductive development and provide a foundation for future investigations and analyses, including genome annotation, functional genomics characterization, gene family evolutionary studies, comparative genomics, and precision breeding.

Synthetic biology approaches in regulation of targeted gene expression.

Synthetic biology approaches are highly sought-after to facilitate the regulation of targeted gene expression in plants for functional genomics research and crop trait improvement. To date, synthetic regulation of gene expression predominantly focuses at the transcription level via engineering of synthetic promoters and transcription factors, while pioneering examples have started to emerge for synthetic regulation of gene expression at the levels of mRNA stability, translation, and protein degradation. This review discusses recent advances in plant synthetic biology for the regulation of gene expression at multiple levels, and highlights their future directions.

Rational design and testing of abiotic stress-inducible synthetic promoters from poplar cis-regulatory elements.

Abiotic stress resistance traits may be especially crucial for sustainable production of bioenergy tree crops. Here, we show the performance of a set of rationally designed osmotic-related and salt stress-inducible synthetic promoters for use in hybrid poplar. De novo motif-detecting algorithms yielded 30 water-deficit (SD) and 34 salt stress (SS) candidate DNA motifs from relevant poplar transcriptomes. We selected three conserved water-deficit stress motifs (SD18, SD13 and SD9) found in 16 co-expressed gene promoters, and we discovered a well-conserved motif for salt response (SS16). We characterized several native poplar stress-inducible promoters to enable comparisons with our synthetic promoters. Fifteen synthetic promoters were designed using various SD and SS subdomains, in which heptameric repeats of five-to-eight subdomain bases were fused to a common core promoter downstream, which, in turn, drove a green fluorescent protein (GFP) gene for reporter assays. These 15 synthetic promoters were screened by transient expression assays in poplar leaf mesophyll protoplasts and agroinfiltrated Nicotiana benthamiana leaves under osmotic stress conditions. Twelve synthetic promoters were induced in transient expression assays with a GFP readout. Of these, five promoters (SD18-1, SD9-2, SS16-1, SS16-2 and SS16-3) endowed higher inducibility under osmotic stress conditions than native promoters. These five synthetic promoters were stably transformed into Arabidopsis thaliana to study inducibility in whole plants. Herein, SD18-1 and SD9-2 were induced by water-deficit stress, whereas SS16-1, SS16-2 and SS16-3 were induced by salt stress. The synthetic biology design pipeline resulted in five synthetic promoters that outperformed endogenous promoters in transgenic plants.

Transcription factor LkWOX4 is involved in adventitious root development in Larix kaempferi.

WUSCHEL-related homeobox4 (WOX4) plays important roles in vascular formation and adventitious root (AR) development. Here, we cloned the WOX4 from the AR of Larix kaempferi, whose cDNA is 1452 bp in length and encodes 483 amino acids. LkWOX4 is mainly expressed in the layer formation area of the stem at 10 days after cutting and its expression levels in the middles and ends of the ARs were higher than that in the AR tips. The fused protein LkWOX4-GFP localized in the nucleus. The heterologous overexpression of LkWOX4 in 84 K poplar significantly increased AR numbers and decreased AR lengths. In LkWOX4 plants, the endogenous jasmonic acid and abscisic acid contents significantly decreased in stems, while the auxin, jasmonic acid and abscisic acid contents significantly increased in ARs. RNA-Seq of those LkWOX4 overexpression poplar plants showed that the expression of plant hormone signaling genes (ARF2, ARF3, ARF7 and ARF18), rooting-related transcription factors (WOX5, LBD29 and SCR) and root development-related genes (CYCD3, GRF1 and TAA1) were affected. Moreover, we found that LkWOX4 interacts with LkPAT18, LkACBP6, and LkCIP7 using yeast two hybrid screening. Thus, we found LkWOX4 involves in the AR initiation and development, which might be regulated through the IAA, JA and ABA signaling pathways.

FaMYB9 is involved in the regulation of C6 volatile biosynthesis in strawberry.

The large-scale untargeted proteomic and metabolomic studies were conducted in strawberry (Fragaria × ananassa) cv. Akihime fruit at five developmental stages. We found that some C6 volatiles highly contributed to the enrichment of volatiles at the red stage of strawberry fruit. We found that 12 genes involved in LOX pathway for volatile biosynthesis showed multiple patterns in protein abundance during fruit development and ripening, and 9 out of the 12 genes exhibited a significant increase in their relative expression levels at the red stage of fruit. We also found that the MYB9 gene (FaMYB9) expression level was positively correlated with the content of C6 volatiles (R = 0.989) and with the relative expression level and protein abundance of FaLOX5 at different strawberry fruit developmental stages (R = 0.954). The interaction between FaMYB9 and FaLOX5 was detected by yeast two-hybrid, co-immunoprecipitation (Co-IP), bimolecular fluorescence complementation (BiFC), and immunofluorescence (IF) analyses. Transient silencing of FaMYB9 delayed the fruit development and ripening, resulting in a significant decrease in the contents of C6 volatiles, while overexpression of FaMYB9 increased the fruit development and ripening and the contents of C6 volatiles in Akihime fruit. Therefore, FaMYB9 is positively involved in C6 volatile biosynthesis.

Lipofection-mediated genome editing using DNA-free delivery of the Cas9/gRNA ribonucleoprotein into plant cells.

KEY MESSAGE: A novel and robust lipofection-mediated transfection approach for the use of DNA-free Cas9/gRNA RNP for gene editing has demonstrated efficacy in plant cells. Precise genome editing has been revolutionized by CRISPR/Cas9 systems. DNA-based delivery of CRISPR/Cas9 is widely used in various plant species. However, protein-based delivery of the in vitro translated Cas9/guide RNA (gRNA) ribonucleoprotein (RNP) complex into plant cells is still in its infancy even though protein delivery has several advantages. These advantages include DNA-free delivery, gene-edited host plants that are not transgenic, ease of use, low cost, relative ease to be adapted to high-throughput systems, and low off-target cleavage rates. Here, we show a novel lipofection-mediated transfection approach for protein delivery of the preassembled Cas9/gRNA RNP into plant cells for genome editing. Two lipofection reagents, Lipofectamine 3000 and RNAiMAX, were adapted for successful delivery into plant cells of Cas9/gRNA RNP. A green fluorescent protein (GFP) reporter was fused in-frame with the C-terminus of the Cas9 protein and the fusion protein was successfully delivered into non-transgenic tobacco cv. 'Bright Yellow-2' (BY2) protoplasts. The optimal efficiencies for Lipofectamine 3000- and RNAiMAX-mediated protein delivery were 66% and 48%, respectively. Furthermore, we developed a biolistic method for protein delivery based on the known proteolistics technique. A transgenic tobacco BY2 line expressing an orange fluorescence protein reporter pporRFP was targeted for knockout. We found that the targeted mutagenesis frequency for our Lipofectamine 3000-mediated protein delivery was 6%. Our results showed that the newly developed lipofection-mediated transfection approach is robust for the use of the DNA-free Cas9/gRNA technology for genome editing in plant cells.