RESUMO
BACKGROUND Helicobacter pylori has a high infection rate worldwide, and epidemiological study of H. pylori is important. Artificial intelligence has been widely used in the field of medical research and has become a hotspot in recent years. This paper proposed a prediction model for H. pylori infection based on machine learning in adults. MATERIAL AND METHODS Adult patients were selected as research participants, and information on 30 factors was collected. The chi-square test, mutual information, ReliefF, and information gain were used to screen the feature factors and establish 2 subsets. We constructed an H. pylori infection prediction model based on XGBoost and optimized the model using a grid search by analyzing the correlation between features. The performance of the model was assessed by comparing its accuracy, recall, precision, F1 score, and AUC with those of 4 other classical machine learning methods. RESULTS The model performed better on the part B subset than on the part A subset. Compared with the other 4 machine learning methods, the model had the highest accuracy, recall, F1 score, and AUC. SHAP was used to evaluate the importance of features in the model. It was found that H. pylori infection of family members, living in rural areas, poor washing hands before meals and after using the toilet were risk factors for H. pylori infection. CONCLUSIONS The model proposed in this paper is superior to other models in predicting H. pylori infection and can provide a scientific basis for identifying the population susceptible to H. pylori and preventing H. pylori infection.
Assuntos
Infecções por Helicobacter , Helicobacter pylori , Aprendizado de Máquina , Humanos , Infecções por Helicobacter/diagnóstico , Infecções por Helicobacter/epidemiologia , Adulto , Masculino , Feminino , Pessoa de Meia-Idade , Fatores de RiscoRESUMO
Microbial nitrate reduction processes involve two competing pathways: denitrification (DEN) and dissimilatory nitrate reduction to ammonium (DNRA). This study investigated the distribution of DNRA in a sole sulfur-driven nitrogen conversion process using a laboratory-scale sequencing biofilm batch reactor (SBBR) through a series of batch tests with varying sulfide/nitrate (S/N) ratios. The results showed that DNRA became more dominant in the sulfide-oxidizing autotrophic denitrification (SOAD) process as the S/N ratio increased to 1.5:1, 1.7:1, and 2:1, reaching a peak of 35.3% at the S/N ratio of 1.5:1. Oxidation-reduction potential (ORP) patterns demonstrated distinct inflection points for nitrate and nitrite consumption under the SOAD-only conditions, whereas these points overlapped when DNRA coexisted with SOAD. Analysis of 16S ribosomal RNA identified Ignavibacterium, Hydrogenophaga, and Geobacter as the dominant genera responsible for DNRA during autotrophic nitrate reduction. The findings of the DNRA divergence investigation provided valuable insights into enhancing biological nitrogen removal processes, particularly when coupled with the anammox.
Assuntos
Desnitrificação , Nitratos , Oxirredução , Sulfetos , Nitratos/metabolismo , Reatores Biológicos , Compostos de Amônio/metabolismo , RNA Ribossômico 16S , NitrogênioRESUMO
Due to disturbances in hormones and long-term glucocorticoid replacement therapy (GRT), congenital adrenocortical hyperplasia (CAH) patients are at risk of impaired bone structure and metabolism. This cross-sectional, case-control study aims to investigate for the first time bone microarchitecture features in 21-hydroxylase deficiency (21OHD; N = 38) and 17α-hydroxylase deficiency (17OHD; N = 16) patients using high-resolution peripheral quantitative computed tomography (HR-pQCT) by matching the same sex and similar age [21OHD vs. control: 29.5 (24.0-34.3) vs. 29.6 (25.9-35.2) years; 17OHD vs. controls: 29.0 (21.5-35.0) vs. 29.7 (24.6-35.3) years] with healthy controls (1:3). All patients underwent HR-pQCT scans of the nondominant radius and tibia, and had received GRT. Compared with corresponding controls, 17OHD cases had higher height (P < 0.001), weight (P = 0.013) and similar body mass index (BMI), while 21OHD had lower height (P < 0.001), similar weight and higher BMI (P < 0.001). 17OHD and 21OHD patients demonstrated various significant bone differences in most HR-pQCT indices, suggesting abnormalities in bone microarchitectures from healthy people. Further correlation analyses revealed that some characteristics, such as height and hormones, may contribute to the bone differences in HR-pQCT indices between two diseases. However, treatment dosage and time were not correlated, indicating that the current glucocorticoid doses may be within safety limits for bone impairment. Overall, our study for the first time revealed changes of bone microarchitecture in CAH patients and their potential relations with clinical characteristics. Further longitudinal researches are required to confirm these findings.
Assuntos
Densidade Óssea , Glucocorticoides , Humanos , Estudos Transversais , Estudos de Casos e Controles , Glucocorticoides/uso terapêutico , Glucocorticoides/metabolismo , Minerais/metabolismo , Rádio (Anatomia) , Tíbia , Oxigenases de Função Mista/metabolismo , Absorciometria de FótonRESUMO
INTRODUCTION: Pars plana vitrectomy (PPV) is a primary strategy to restore vision for patients who have rhegmatogenous retinal detachment (RRD). Perfluorocarbon liquid (PFCL) is frequently used during PPV surgery. However, the unintended intraocular retention of PFCL may cause retina toxicity and thus lead to possible postoperative complications. In this paper, the experiences and surgical outcomes of a NGENUITY 3D Visualization System-assisted PPV are shown to evaluate the possibility of excluding the application of PFCL. METHODS: A consecutive series of 60 cases with RRD were presented, all of whom had undergone 23-gauge PPV with the assistance of a three-dimensional (3D) visualization system. Among them, 30 cases used PFCL to assist the drainage of subretinal fluid (SRF), while the other 30 cases did not. Parameters including retinal reattachment rate (RRR), best-corrected visual acuity (BCVA), operation time, and SRF residual were compared between the two groups. RESULTS: Baseline data showed no statistical significance between the two groups. At the last postoperative follow-up, the RRR of all the 60 cases reached 100% and best-corrected visual acuity (BCVA) gained significant improvement. The BCVA (logMAR) increased from 1.293 ± 0.881 to 0.479 ± 0.316 in the PFCL-excluded group, exhibiting better results than the PFCL included group, whose final BCVA was 0.650 ± 0.371. More importantly, excluding PFCL greatly reduced the operation time (decrease of 20%), therefore, avoiding possible complications caused by both the use of PFCL and the operation process. CONCLUSION: With the assistance of the 3D visualization system, it is feasible to treat RRD and perform PPV without using PFCL. The 3D visualization system is highly recommendable, as not only can it achieve the same surgical effect without the assistance of PFCL, but also simplify the operation procedure, shorten the operation time, save costs, and avoid complications related to PFCL.
RESUMO
BACKGROUND: Cushing's disease (CD) is rare in pediatric patients. It is characterized by elevated plasma adrenocorticotropic hormone (ACTH) from pituitary adenomas, with damage to multiple systems and development. In recent years, genetic studies have shed light on the etiology and several mutations have been identified in patients with CD. CASE PRESENTATION: A girl presented at the age of 10 years and 9 months with facial plethora, hirsutism and acne. Her vision and eye movements were impaired. A quick weight gain and slow growth were also observed. Physical examination revealed central obesity, moon face, buffalo hump, supra-clavicular fat pads and bruising. Her plasma ACTH level ranged between 118 and 151 pg/ml, and sella enhanced MRI showed a giant pituitary tumor of 51.8 × 29.3 × 14.0 mm. Transsphenoidal pituitary debulk adenomectomy was performed and immunohistochemical staining confirmed an ACTH-secreting adenoma. Genetic analysis identified a novel germline GPR101 (p.G169R) and a somatic USP8 (p. S719del) mutation. They were hypothesized to impact tumor growth and function, respectively. CONCLUSIONS: We reported a rare case of pediatric giant pituitary ACTH adenoma and pointed out that unusual concurrent mutations might contribute to its early onset and large volume.
Assuntos
Adenoma Hipofisário Secretor de ACT , Adenoma , Hipersecreção Hipofisária de ACTH , Neoplasias Hipofisárias , Adenoma Hipofisário Secretor de ACT/diagnóstico , Adenoma Hipofisário Secretor de ACT/genética , Adenoma Hipofisário Secretor de ACT/cirurgia , Adenoma/diagnóstico , Adenoma/genética , Adenoma/cirurgia , Hormônio Adrenocorticotrópico , Endopeptidases/genética , Complexos Endossomais de Distribuição Requeridos para Transporte/genética , Feminino , Células Germinativas/patologia , Humanos , Mutação , Hipersecreção Hipofisária de ACTH/diagnóstico , Neoplasias Hipofisárias/genética , Neoplasias Hipofisárias/cirurgia , Receptores Acoplados a Proteínas G , Ubiquitina Tiolesterase/genéticaRESUMO
Objectives: To analyze and summarize the effect of SSA treatment on EAS due to p-NETs (EAS-p-NETs). Methods: Thirteen patients with EAS-p-NETs treated with SSAs at our center or described in the literature were included in this study. Clinical characteristics, laboratory data, imaging studies, histopathologic results, the effect of SSA treatment, and the prognosis of these EAS-p-NET patients were evaluated. Results: Four males and 9 females with an average age of 42.9 years were included in the study. The mean duration of follow-up was 38.8 ± 28.2 months. As one of the combined treatment measures, SSAs controlled the levels of ACTH and cortisol in 9 of the 13 patients (69.2%). Partial response was observed in 3 patients (23.1%), stable disease in 2 patients (15.4%), and progressive disease in 6 patients (46.2%). The median time to tumor progression was 24 months, and the median overall survival was 61 months. The side effects of SSA treatment included temporary mild abdominal pain, diarrhea, gallstones, and cholecystitis. Conclusions: As a supplemental therapy, SSA treatment led to clinical and biochemical improvement with a good safety profile in patients exhibiting EAS-p-NET with metastasis. However, tumor progression was inhibited by SSA treatment in only a few patients. Combined with other treatments, SSAs may improve the prognosis of patients with EAS-p-NETs.
RESUMO
Background: Endogenous Cushing's syndrome (CS), also called hypercortisolism, leads to a significant increase in mortality due to excessive cortisol production, which is mainly due to cardiovascular disease. CS complicated with cardiomyopathies, which is a rare and severe condition, has rarely been reported in the literature. Objective: To investigate the clinical characteristics of CS complicated with cardiomyopathies, we retrospectively reviewed the clinical manifestations, laboratory results, cardiac imaging results and prognosis to further understand the diagnosis, treatment, and management of these cases. Methods: The clinical data of patients diagnosed with CS complicated with cardiomyopathies obtained from discharge sheets from Peking Union Medical College Hospital from January 1986 to August 2021 were collected. Case reports of CS complicated with cardiomyopathies were retrieved from PubMed. In addition, Cushing's disease (CD) patients without cardiomyopathies were collected as controls to compare the clinical features. Results: A total of 19 cases of CS complicated with cardiomyopathies and cases of CD without cardiomyopathies (n = 242) were collected. The causes of CS included pituitary adenoma (n = 8, 42.11%), adrenal adenoma (n = 7, 36.84%), ectopic adrenocorticotropic hormone (ACTH) tumor (n = 2, 10.53%) and unclear causes (n = 2, 10.53%) in the CS complicated with cardiomyopathies group. The types of cardiomyopathies were dilated cardiomyopathies (n = 15, 78.94%) and hypertrophic cardiomyopathies (n = 4, 21.05%). The serum sodium concentration was significantly higher [145.50 (140.50-148.00) mmol/L vs. 141.00 (140.00-143.00) mmol/L], while the serum potassium concentration was significantly lower [2.70 (2.40-3.60) mmol/L] vs. 3.90 (3.50-4.20 mmol/L)] in the CS complicated with cardiomyopathies group compared to the CD patients without cardiomyopathies. There were no significant differences between the CS complicated with cardiomyopathies group and the CD patients without cardiomyopathies in the serum cortisol concentration and 24-h urine free cortisol, but a significant difference in the adrenocorticotropic hormone level [109.00 (91.78-170.30) pg/ml vs. 68.60 (47.85-110.00) pg/ml]. Twelve/16 (75.0%) patients showed significant improvement or even a complete healing of the heart structure and function after remission of hypercortisolemia after treatment with CS. Conclusions: CS complicated with cardiomyopathies is a very rare clinical entity, in which cortisol plays an important role and it can be greatly improved after remission of hypercortisolemia.
RESUMO
Context: Traditionally, low-dose dexamethasone suppression test (LDDST) was used to confirm the diagnosis of Cushing's syndrome (CS), and high-dose dexamethasone suppression test (HDDST) was used to differentiate Cushing's disease (CD) and ectopic adrenocorticotropin (ACTH) syndrome (EAS), but some studies suggested that HDDST might be replaced by LDDST. For the differential diagnosis of CS, dexamethasone suppression test was usually combined with other tests such as bilateral petrosal sinus sampling (BIPSS) and pituitary magnetic resonance imaging, but the optimal pathway to incorporate these tests is still controversial. Objectives: To develop an optimized pathway for the differential diagnosis of CD and EAS based on LDDST. Design and Setting: Single-center retrospective study (2011-2019). Patients: Two hundred sixty-nine CD and 29 EAS patients with pathological diagnosis who underwent consecutive low- and high-dose DST. Results: For the differential diagnosis of CD and EAS, the area under curve (AUC) of LDDST using urine free cortisol (0.881) was higher than that using serum cortisol (0.685) (p < 0.001) in head-to-head comparison among a subgroup of 108 CD and 10 EAS. The AUC of LDDST (0.883) was higher than that of HDDST (0.834) among all the included patients. With the cutoff of <26%, the sensitivity and specificity of LDDST were 39.4% and 100%. We designed a new pathway in which BIPSS was only reserved for those patients with unsuppressed LDDST and adenoma <6mm, yielding an overall sensitivity of 97.7% and specificity of 86.7%. Conclusion: LDDST had similar value to HDDST in differentiating CD and EAS using the specific cutoff point. The pathway that combined LDDST and BIPSS could differentiate CD and EAS accurately.
Assuntos
Síndrome de Cushing/diagnóstico , Dexametasona/farmacologia , Técnicas de Diagnóstico Endócrino , Síndrome de ACTH Ectópico/sangue , Síndrome de ACTH Ectópico/diagnóstico , Adenoma/diagnóstico , Adenoma/metabolismo , Adenoma/patologia , Adolescente , Hormônio Adrenocorticotrópico/sangue , Hormônio Adrenocorticotrópico/metabolismo , Adulto , Idoso , Calibragem , Criança , Síndrome de Cushing/sangue , Síndrome de Cushing/etiologia , Diagnóstico Diferencial , Técnicas de Diagnóstico Endócrino/normas , Relação Dose-Resposta a Droga , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Amostragem do Seio Petroso , Hipersecreção Hipofisária de ACTH/sangue , Hipersecreção Hipofisária de ACTH/diagnóstico , Neoplasias Hipofisárias/diagnóstico , Neoplasias Hipofisárias/metabolismo , Neoplasias Hipofisárias/patologia , Estudos Retrospectivos , Sensibilidade e Especificidade , Adulto JovemRESUMO
Objective: To analyze and summarize the clinical characteristics, treatments, and prognosis of Cushing's syndrome (CS) with nocardiosis. Methods: A patient in our hospital and additional 17 patients of CS with nocardiosis in the English literature were included in this study. Clinical characteristics, laboratory data, imaging studies, treatments, and prognosis were evaluated. Results: A 41-year-old man with CS was diagnosed and treated in our hospital. He had co-infections of nocardiosis and aspergillosis. Together with 17 patients of CS with nocardiosis in the English literature, 2 patients (11.1%) were diagnosed as Cushing's disease (CD) while 16 (88.9%) were diagnosed or suspected as ectopic ACTH syndrome (EAS). The average 24hrUFC was 7,587.1 ± 2,772.0 µg/d. The average serum total cortisol and ACTH (8 AM) was 80.2 ± 18.7 µg/dl and 441.8 ± 131.8 pg/ml, respectively. The most common pulmonary radiologic findings in CT scan were cavitary lesions (10/18) and nodules (8/18). Co-infections were found in 33.3% (6/18) patients. The CS patients with co-infections had higher levels of ACTH (671.5 ± 398.2 vs 245.5 ± 217.1 pg/ml, P = 0.047), and 38.9% (7/18) patients survived through the antibiotic therapy and the treatment of CS. Patients with lower level of ACTH (survival vs mortality: 213.1 ± 159.0 vs 554.7 ± 401.0 pg/ml, P = 0.04), no co-infection, underwent CS surgery, and received antibiotic therapy for more than 6 months, had more possibilities to survive. Conclusions: Nocardia infection should be cautioned when a patient of CS presented with abnormal chest radiographs. The mortality risk factors for CS with nocardiosis are high level of ACTH and co-infections. We should endeavor to make early etiological diagnosis, apply long-term sensitive antibiotics and aggressive treatments of CS.
Assuntos
Síndrome de Cushing/complicações , Nocardiose/complicações , Síndrome de ACTH Ectópico/complicações , Síndrome de ACTH Ectópico/tratamento farmacológico , Hormônio Adrenocorticotrópico/metabolismo , Adulto , Antibacterianos/farmacologia , Síndrome de Cushing/diagnóstico , Síndrome de Cushing/tratamento farmacológico , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Nocardiose/diagnóstico , Nocardiose/tratamento farmacológico , Prognóstico , Radiografia Torácica , Risco , Fatores de RiscoRESUMO
OBJECTIVE: Ectopic adrenocorticotropic hormone syndrome (EAS) is a rare cause of Cushing's syndrome and diagnosis and management remain challenging. The aim of this study was to present the clinical spectrum of a group of EAS cases in a single center to explore better management strategies. METHODS: A retrospective study was conducted to identify 88 confirmed EAS cases at our hospital from 1984 to 2019. The clinical, biochemical, imaging, and pathological features were analyzed. RESULTS: Of the 88 eligible patients with EAS, 38 (43.2%) cases of pulmonary neuroendocrine tumors (NETs) and a larger number of thymic/mediastinal NETs (29 cases, 33%) were identified. The clinical and biological features of EAS and Cushing's disease overlapped but were more severe in EAS. Inferior petrosal sinus sampling (97.4%) and computed tomography (85.4%) provided the highest positive diagnostic accuracy. Computed tomography is also a useful tool to identify tumors in chest cavity compared with nonchest lesions (91.2% vs 57.1%). Although a greater tumor size (4.54 cm vs 1.44 cm) and higher rate of insuppressible high-dose dexamethasone suppression test (83.3% vs 51.5%) were found in thymic/mediastinum NETs than in pulmonary NETs, the level of hormone production had no difference. CONCLUSION: EAS had more common and severe clinical presentations than Cushing's disease, and multiple imaging approaches are required for reliable diagnosis. A higher proportion of thymic/mediastinal NETs was found in our study. For patients without a certain tumor source, long-term follow-up and further evaluations are needed.
Assuntos
Síndrome de ACTH Ectópico , Hormônio Adrenocorticotrópico , Síndrome de ACTH Ectópico/diagnóstico , Diagnóstico Diferencial , Humanos , Amostragem do Seio Petroso , Estudos RetrospectivosRESUMO
Purpose: Silent corticotroph adenoma (SCA) is clinically non-functional pituitary adenoma with expression of corticotropin or Tpit. To further understand the characteristics of this rare type of SCA transforming to a functional SCA, we retrospectively reviewed SCAs that converted to typical Cushing's syndrome at a tertiary medical center and the relevant literature. Methods: Patients were identified based on the diagnosis of pituitary adenoma without symptoms of hypercortisolism at the initial visit with positive Immunohistochemical (IHC) staining for corticotropin or Tpit after surgery and subsequent transformation to functional SCAs during the follow-up period from March 1990 to January 2020 at Peking Union Medical College Hospital and in the literature. The characteristics of the clinical manifestations, biochemical results, imaging findings, pathology findings and outcome were analyzed. Results: Altogether, 16 patients were included in the study with an average age of 42.0 ± 12.48 (18-65) years at the first visit. Females were slightly predominant (F:M = 1.3:1). The median time of conversion from the nonfunctional to the functional type was 30 (13.0, 68.3) months. Once a functional SCA developed, the adrenocorticotropic hormone (ACTH) level and 24-h urine free cortisol were increased 3.8- (2.6, 12.9) and 5.3- (2.6, 19.3) fold, respectively, above the normal range. Approximately 50% of the patients had macrocystic changes on pituitary MRI. All 16 patients experienced 1-5 surgeries with a median of 2.5 (2.0, 4.0) surgeries. The proportion of patients with Ki-67 ≥ 3% increased from 22.2% (2/9) at the beginning to 50% (7/14) at the time of functional SCA diagnosis. Thirteen patients received radiotherapy, and 4 patients (30.8%) achieved remission. Four patients with refractory functional SCAs received temozolomide treatment with the normalization of cortisol in 4 cases and reduced tumor volume in 3 cases. Conclusion: In this study, all cases that transformed to functional SCAs were macroadenomas. Hypercortisolism was more severe in functional SCA patients. The tumors tended to have frequent recurrence and were highly invasive. Temozolomide could be a promising treatment for refractory functional SCA cases. Long-term follow-up is needed for nonfunctional SCAs since some cases have the potential to transform to clinical Cushing's syndrome.
Assuntos
Adenoma Hipofisário Secretor de ACT/tratamento farmacológico , Adenoma/tratamento farmacológico , Temozolomida/uso terapêutico , Adenoma Hipofisário Secretor de ACT/complicações , Adenoma Hipofisário Secretor de ACT/diagnóstico por imagem , Adenoma Hipofisário Secretor de ACT/patologia , Adenoma/complicações , Adenoma/diagnóstico por imagem , Adenoma/patologia , Adolescente , Hormônio Adrenocorticotrópico/sangue , Adulto , Idoso , Feminino , Seguimentos , Humanos , Imuno-Histoquímica , Masculino , Pessoa de Meia-Idade , Estudos Retrospectivos , Adulto JovemRESUMO
Purpose: Cushing's disease (CD) is one of the most severe endocrine disorders and primarily affects women of reproductive age. The peripartum period has been observed to be a common time to develop CD. This study aims to retrospectively analyze the clinical characteristics of CD potentially associated with pregnancy and to evaluate relevant pregnancy outcomes. Methods: Patients who underwent surgery from January 2010 to May 2019 at Peking Union Medical College Hospital (PUMCH) with biochemically and pathologically confirmed CD were retrospectively analyzed. Pregnancy-associated CD was defined as CD onset during gestation or within 12 months after delivery or abortion. Data including demographics, biochemical tests, magnetic resonance imaging (MRI) findings, and disease outcomes were obtained from all patients by reviewing their medical records. Information regarding pregnancy was collected through a supplementary online questionnaire. Results: In a series of female patients (n = 70) of reproductive age with childbearing desire, 27.1% (n = 19) met the criteria for pregnancy-associated CD. The timing of diagnosis of pregnancy-associated CD was 2.7 ± 3.4 years after symptom onset, and the overall remission rate for these women was 89.5%. Three patients with pregnancy-associated CD developed hypertension during pregnancy, two of whom had new-onset hypertension at 16 weeks of gestation and one of whom had a complication of severe diabetes. The rates of spontaneous abortion and preterm birth among the women with pregnancy-associated CD were 26.3 and 28.6%, respectively. The proportions of all low-birth-weight (LBW) newborns (p = 0.002) and term LBW newborns (p = 0.033) were significantly higher in the pregnancy-associated CD group than in the non-pregnancy-associated CD group. Conclusions: In this study, a total of 27.1% of women of reproductive age with CD had pregnancy-associated CD, which might be induced by the hormonal milieu of pregnancy. An increased risk of having a LBW newborn was observed among mothers with pregnancy-associated CD. A high degree of clinical suspicion for CD may be warranted in the peripartum period. Patients with symptoms suspicious for CD throughout pregnancy and after childbirth, such as early-onset hypertension, severe hyperglycemia, and persistent weight gain, should be carefully diagnosed and closely monitored by clinicians.
Assuntos
Hipersecreção Hipofisária de ACTH/epidemiologia , Complicações na Gravidez/epidemiologia , Adulto , Feminino , Humanos , Incidência , Hipersecreção Hipofisária de ACTH/complicações , Hipersecreção Hipofisária de ACTH/cirurgia , Gravidez , Resultado da Gravidez , Estudos RetrospectivosRESUMO
BACKGROUND: Ectopic ACTH-secreting pituitary adenoma (EAPA) are a rare cause of Cushing's disease. Due to the lack of consensus and experience in terms of the diagnosis and treatment of EAPAs, preoperative identification and optimal treatment remain challenging. PURPOSE: To investigate the characteristics of EAPAs and offer some proposals for the diagnosis and management of this uncommon disease, the EAPA patients admitted to our center and all of the EAPA cases reported in the literature were reviewed. METHODS: In a retrospective electronic medical chart review, 6 patients (0.39%) with EAPAs were identified from 1536 consecutive patients who were admitted to our hospital with a diagnosis of Cushing's syndrome between January 2000 and August 2019. A literature review was performed on the online databases PubMed and EMBASE, and 52 cases conformed to the criteria. The data regarding biochemical tests, imaging examinations and follow-ups were analyzed. RESULTS: The mean age of patients with EAPAs was 37.7 years old, and an obvious female predominance (3.5: 1) was demonstrated. The most common location of EAPAs was the cavernous sinus (34.5%), followed by the sphenoid sinus (31.0%) and the suprasellar region (20.7%). No significant differences in the biochemical test results were found among tumors in different locations. Except for sex, no risk factors related to remission were found. Although no significant differences among different locations were found, the tumors in the cavernous sinus had a relatively higher rate of invisibility in terms of imaging and a higher non-remission rate than tumors in other locations. CONCLUSIONS: In patients with negative intrasellar findings, the uncommon disease of EAPA should be considered. Due to the endocrine similarity between intrasellar pituitary corticotrophin adenoma and EAPA, the preoperative identification of EAPA depends on a careful review of the imaging examinations. Locations such as the cavernous sinus, sphenoid sinus and suprasellar region should be considered first. Tumor resection is recommended when the diagnosis is confirmed.
Assuntos
Adenoma Hipofisário Secretor de ACT/epidemiologia , Adenoma Hipofisário Secretor de ACT/etiologia , Adulto , Feminino , Instalações de Saúde/estatística & dados numéricos , Humanos , Masculino , Estudos Retrospectivos , Fatores de RiscoRESUMO
CONTEXTS: Bilateral inferior petrosal sinus sampling (BIPSS) can differentiate Cushing's disease (CD) and ectopic adrenocorticotropin (ACTH) syndrome (EAS). The traditional cutoff of inferior petrosal sinus to peripheral (IPS:P) ACTH gradient was 2 before stimulation and 3 after stimulation, which yielded unsatisfactory sensitivity in some studies. OBJECTIVES: To determine the optimal cutoff in BIPSS before or after desmopressin stimulation and to evaluate the necessity of stimulation. DESIGN AND SETTING: Single-center retrospective study (2011-2018) along with meta-analysis. PATIENTS: 226 CD and 24 EAS patients with confirmed diagnosis who underwent BIPSS with desmopressin stimulation. RESULTS: In the meta-analysis of 25 studies with 1249 CD and 152 EAS patients, the traditional cutoff yielded sensitivity of 86% and 97% and specificity of 98% and 100% before and after stimulation, respectively. We then analyzed the data from our center. With the traditional cutoff, the sensitivity was 87.2% (197/226) and 96.5% (218/226) before and after stimulation, and specificity was both 100% (25/25), which were close to the results of meta-analysis. Receiver operating characteristic analysis revealed that the optimal cutoff was 1.4 before stimulation and 2.8 after stimulation. With the new cutoff, the sensitivity was 94.7% (214/226) and 97.8% (221/226) while the specificity remained 100% (25/25) before and after stimulation. Among the 7 CD patients (7/226; 3.1%) for whom stimulation was necessary to get correct diagnosis, none has a pituitary lesion >6 mm by magnetic resonance imaging, and their sampling lateralization rate (P = .007) and peak ACTH level at dominant inferior petrosal sinus (P = .011) were lower than those among CD patients with IPS:P >1.4 before stimulation. CONCLUSIONS: The optimal cutoff for IPS:P in BIPSS is different from the commonly-used one. The optimal cutoff value can yield satisfactory accuracy even without stimulation, and stimulation may be unnecessary for those with pituitary adenoma >6 mm.
Assuntos
Síndrome de ACTH Ectópico/diagnóstico , Síndrome de Cushing/diagnóstico , Desamino Arginina Vasopressina/farmacologia , Amostragem do Seio Petroso/normas , Adolescente , Adulto , Idoso , Criança , Pré-Escolar , Diagnóstico Diferencial , Feminino , Seguimentos , Hemostáticos/farmacologia , Humanos , Masculino , Metanálise como Assunto , Pessoa de Meia-Idade , Amostragem do Seio Petroso/métodos , Prognóstico , Curva ROC , Estudos Retrospectivos , Adulto JovemRESUMO
Ectopic adrenocorticotropic hormone (ACTH) syndrome (EAS) is a rare cause of Cushing syndrome. If routine imaging examinations cannot identify the source of ACTH production, long-term follow-up observation is necessary to determine the etiology. We present the case of a middle-aged male with gradual weight gain and a Cushingoid appearance over 4 years; he provided written informed consent. Laboratory and endocrine tests strongly suggested EAS, although the origin was not detected by multiple imaging methods. Bilateral adrenalectomy was performed to prevent severe complications in the patient. Two and a half years later, a cardiac mass 18 × 23 × 27 mm in size at the junction between the anterior wall of the left ventricle and the middle septum was found together with multiple bone metastases by 18F-FDG PET/CT, while the 68Ga-DOTATE PET/CT findings were negative. Biopsy of the lumbar vertebrae revealed a neuroendocrine tumor (NET) with positive ACTH staining. The patient underwent chemotherapy by CAPTEM, resulting in shrinkage of the cardiac mass and a significant decrease in the ACTH level. In the case of EAS with an unusual cause, long-term follow-up observation is necessary to determine the source of ACTH production. Cardiac NETs are quite rare in EAS, so treatment selection was also challenging. CAPTEM chemotherapy proved effective in controlling the progression of tumor growth and decreasing the ACTH level in this patient.
RESUMO
Scanning electron microscopy (SEM) plays an important role in the intuitive understanding of microstructures because it can provide ultrahigh magnification. Tens or hundreds of images are regularly generated and saved during a typical microscopy imaging process. Given the subjectivity of a microscopist's focusing operation, blurriness is an important distortion that debases the quality of micrographs. The selection of high-quality micrographs using subjective methods is expensive and time-consuming. This study proposes a new no-reference quality assessment method for evaluating the blurriness of SEM micrographs. The human visual system is more sensitive to the distortions of cartoon components than to those of redundant textured components according to the Gestalt perception psychology and the entropy masking property. Micrographs are initially decomposed into cartoon and textured components. Then, the spectral and spatial sharpness maps of the cartoon components are extracted. One metric is calculated by combining the spatial and spectral sharpness maps of the cartoon components. The other metric is calculated on the basis of the edge of the maximum local variation map of the cartoon components. Finally, the two metrics are combined as the final metric. The objective scores generated using this method exhibit high correlation and consistency with the subjective scores.
RESUMO
Aldosterone synthase deficiency (ASD) is a rare autosomal recessive disorder characterized by severe hyperkalemia, salt loss, vomiting, severe dehydration and failure to thrive. ASD is a life-threatening electrolyte imbalance in infants resulting from mutations in CYP11B2. We described ASD in a Chinese male infant with vomiting, poor feeding and failure to thrive. He was mildly dehydrated, with a weight of 6â¯kg (-3.45 SDS) and length of 67â¯cm (-3.10 SDS). Laboratory tests showed hyponatremia (119â¯mmol/L), serum potassium 5.4â¯mmol/L, low plasma aldosterone and plasma renin activity (PRA) levels. Next-generation sequencing of his DNA revealed compound heterozygous mutations in CYP11B2, a known variant c.1391_1393delTGC (p.Leu464del, rs776404064) and a novel variant c.1294delA (p.Arg432Glyfs*37). The HEK-293T expression system was used to investigate the variants, demonstrating negligible aldosterone synthesis compared with WT CYP11B2. The patient started fludrocortisone and subsequently gained 3.2â¯kg of weight and normalized serum sodium (137â¯mmol/L). We further reviewed reported cases of ASD, summarizing clinical features and CYP11B2 mutations; missense and nonsense mutations are most frequent. Fludrocortisone treatment is essential for ASD, and the need for mineralocorticoid replacement wanes with age; eventually, therapy can be discontinued for many affected children. Our study broadens the ASD phenotypic spectrum and shows the efficiency of next-generation sequencing for patients with atypical clinical manifestations.
Assuntos
Hiperplasia Suprarrenal Congênita/enzimologia , Hiperplasia Suprarrenal Congênita/genética , Citocromo P-450 CYP11B2/genética , Heterozigoto , Mutação , Hiperplasia Suprarrenal Congênita/sangue , Hiperplasia Suprarrenal Congênita/diagnóstico , Células Cultivadas , Citocromo P-450 CYP11B2/deficiência , Citocromo P-450 CYP11B2/metabolismo , Células HEK293 , Humanos , Lactente , MasculinoRESUMO
PURPOSE: Bilateral inferior petrosal sinus sampling (BIPSS) is useful for differential diagnosis of adult Cushing's disease (CD) but may not be so reliable in pediatric cases. The purpose of this study was to evaluate the sensitivity of BIPSS before and after desmopressin stimulation in pediatric CD, and to explore related factors of false-negative results and meanings of sampling lateralization. METHODS: We retrospectively analyzed 16 pediatric CD patients who underwent 17 BIPSS procedures from 2006 to 2017. CD was diagnosed if inferior petrosal sinus (IPS) to peripheral adrenocorticotropic hormone (ACTH) ratio was >2 at baseline or >3 after desmopressin stimulation. Sampling lateralization was yielded if interpetrosal sinus gradient was >1.4. Magnetic resonance imaging (MRI) was conducted. All the patients underwent surgery and the diagnosis was confirmed. RESULTS: The sensitivity was 64.7% (11/17) at baseline and 83.3% (10/12) after desmopressin stimulation. After stimulation, BIPSS reached its best sensitivity at 3 min. Sampling lateralization rate was 62.5% and 63.6% before and after stimulation, and the accordant rate with actual tumor lateralization was 50.0% and 42.9%, respectively. The accuracy of MRI in predicting the tumor lateralization was 80.0%. Sampling lateralization rate (81.8% in true-positive, 20.0% in false-negative, p = 0.036) and ACTH at dominant IPS (p = 0.001) was lower among false-negative patients. CONCLUSIONS: The sensitivity of BIPSS in pediatric CD was low at baseline, but increased after desmopressin stimulation. Sampling lateralization cannot accurately indicate the tumor lateralization, but the absence of sampling lateralization with low ACTH at IPS is a hint of false-negative cases in BIPSS.
Assuntos
Desamino Arginina Vasopressina , Amostragem do Seio Petroso , Hipersecreção Hipofisária de ACTH/diagnóstico , Adolescente , Criança , Feminino , Humanos , Imageamento por Ressonância Magnética , Masculino , Hipersecreção Hipofisária de ACTH/cirurgia , Estudos Retrospectivos , Adulto JovemRESUMO
BACKGROUND: Congenital adrenal hyperplasia (CAH) resulting from steroid 11ß-hydroxylase deficiency (11ß-OHD) is caused by mutations in the CYP11B1 gene. It is the second major form of CAH associated with hypertension and hypopotassemia. The aim of this study was to provide a genetic analysis of 11ß-OHD in a Chinese family. CASE PRESENTATION: A 19-year-old Chinese man was clinically diagnosed with 11ß-OHD. His initial clinical manifestations included precocious puberty, hyperpigmentation, hypertension, and hypopotassemia. The patient had taken an overdose of dexamethasone (0.75 mg/d) for more than 10 years before finally developing iatrogenic Cushing's syndrome. Our aim was to perform a molecular diagnosis of his family. Mutations in the CYP11B1 gene of the patient and his parents were examined using polymerase chain reaction (PCR) resequencing. Additionally, to predict the possible effects of novel mutations on the structure and function of 11ß-hydroxylase, these mutations were analyzed by MutationTaster software. Two novel pathogenic mutations were found in the CYP11B1 gene: a heterozygous in-frame insertion deletion mutation c.1440_1447delinsTAAAAG in exon 9 inherited from the father and a heterozygous mutation c.1094_1120delTGCGTGCGGCCCTCAAGGAGACCTTGC (p.364_372del) in exon 6 inherited from the mother. CONCLUSIONS: A clear genetic diagnosis can be made by analyzing the functional and structural consequences of CYP11B1 gene mutations that lead to 11ß-OHD. Because the dosage of glucocorticoid should be adjusted to minimize the risk of iatrogenic Cushing's syndrome, clinical follow-up should be conducted with these patients.