RESUMO
According to official statistics, in the Republic of Bashkortostan (RB) since 1991 there is noted the increase in the number of patients with cystic echinococcosis. In 2012, the number of recorded cases increased by 55.3% if compared with 2007. In the areas of RB, where there was observed the high index of population morbidity rate, there was noted the extensive growth of the infestation in sheep. The analysis of the landscape-climatic and sanitary characteristics of the territory of the RB, as well as population economic activity revealed a definite relationship between them and the spread of echinococcosis. The performed survey of rural residents of RB showed that the population is poorly informed about the factors of transmission and ways of infection by echinococcosis. Out of respondents 73% were wrong in determining factors of transmission of infection, 34% admitted irregularities in the disposal of slaughtering condemned products. Fully correct answers were given only by 9% of respondents. The research of fruitfulness of hydatid bubbles and viability of Protoscolexes revealed that the effect of hot water (t = 90-100 ° C) is effective for disinfecting of invasive origins of larvocysts. Due to the low level of awareness of the population there is needed an active health education work on effective measures to prevent the spread of echinococcosis in RB--the prevention of feeding dogs with raw slaughtering waste and decontamination in the private courtyard slaughtering condemned products with the hot water.
Assuntos
Equinococose/prevenção & controle , Educação em Saúde/métodos , Higiene , Animais , Bashkiria/epidemiologia , Equinococose/epidemiologia , Humanos , Morbidade/tendênciasRESUMO
This investigation was undertaken to study trends in helminthiasis morbidity in the Republic of Bashkortostan in 2009-2011. A total of 1497 subjects who came to the Laboratory of the Department of Microbiology, Virology, and Immunology, Bashkir State Medical University, in 2009-2011, have been randomly selected for this investigation. IgG antibodies were identified in their blood. Enzyme immunoassay has revealed anti-helminth antibodies in 4.7, 4.9, and 4.6% of the examinees in 2009, 2010, and 2011, respectively. Antibodies against Ascaris, Ecchinococcus, Opisthorchis, and Toxocara were most common in the examinees. According to the official statistics, the Republic of Bashkiria showed a 26.4% decrease in helminthiasis morbidity, alterations in the structure of morbidity, and a reduction in the proportion of helminths habiting the intestine, and an increase in the proportion of tissue helminthiases in the period 2006 to 2011.
Assuntos
Helmintíase , Helmintos/isolamento & purificação , Imunoglobulina G/sangue , Adolescente , Adulto , Animais , Bashkiria/epidemiologia , Feminino , Helmintíase/sangue , Helmintíase/epidemiologia , Helmintíase/parasitologia , Helmintos/imunologia , Humanos , Masculino , Pessoa de Meia-IdadeRESUMO
This investigation was undertaken to study the associations of the polymorphic variants of the HLA-DRBI and HLA-DQB1 loci with the development of cystic echinococcosis in children. The material for the investigation was collected from 57 children admitted for surgery to the clinic of the Department of Pediatric Surgery, Orthopedics, and Anesthesiology, Bashkir State Medical University (Ufa). The PROTRANS kit (Germany) was used to isolate DNA samples from peripheral venous blood served as an object of the investigations. HLA specificities were typed by polymerase chain reaction. Molecular genetic studies established the association of DRB1*07, DQB1*0.9, DQB1*02 specificities with the increased risk of cystic echinococcosis in children. The echinococcosis cyst suppuration-complicated course of the disease was found to be more frequently encountered in DQB1*02 and DRB1*03 allele carriers.
Assuntos
Equinococose/genética , Echinococcus/imunologia , Epitopos/genética , Cadeias beta de HLA-DQ/genética , Cadeias HLA-DRB1/genética , Alelos , Animais , Variação Antigênica/genética , Variação Antigênica/imunologia , Bashkiria , Estudos de Casos e Controles , Criança , Pré-Escolar , Cistos , Equinococose/sangue , Equinococose/imunologia , Epitopos/imunologia , Feminino , Frequência do Gene , Predisposição Genética para Doença , Cadeias beta de HLA-DQ/sangue , Cadeias beta de HLA-DQ/imunologia , Cadeias HLA-DRB1/sangue , Cadeias HLA-DRB1/imunologia , Haplótipos , Heterozigoto , Humanos , Imunofenotipagem , Masculino , Reação em Cadeia da Polimerase , SupuraçãoRESUMO
This study was undertaken to analyze the nucleotide sequences of a marker fragment in the mitochondrial cox1 gene in polymorphic variants of G1 strain from the nucleotide sequence bank "Genbank" and to choose conditions for a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method to differentiate the G1 genotype in E.granulosus isolates. The analysis indicated that G1 genotype polymorphism was due to impact nucleotide replacements and to the varying length of the marker fragment of the coxl gene (by the presence of absence of the 5' GTGGCT 3' site with the coordinates 10275-10280). The procedure of PCR-RFLP was modified to identify the G1 variants due to the varying coxl length. New primers annealed to the variable coxl site of the following structure: 5' TGTGTTGATTTT-GCCTGG 3' (direct); 5' GCCACCACAAACCAAGTATC 3' (inverse) were chosen. Then the localizations of restriction sites were determined for the endonucleases R.Fok 1, R.Sfa NI, and R.Mael and the restriction fragment length was calculated for the RFLP analysis.
Assuntos
Ciclo-Oxigenase 1/genética , Echinococcus granulosus/genética , Proteínas de Helminto/genética , Mitocôndrias/genética , Reação em Cadeia da Polimerase/métodos , Polimorfismo de Fragmento de Restrição , Animais , Sequência de Bases , Primers do DNA , DNA Mitocondrial/genética , Equinococose/parasitologia , Echinococcus granulosus/classificação , Echinococcus granulosus/isolamento & purificação , Humanos , Mitocôndrias/enzimologia , Análise de Sequência de DNARESUMO
Twelve E. granulosus larvocysts obtained from the children of the South Urals during surgery for hydatid disease of the liver were examined. The polymerase chain reaction technique described by J. Bowles, et al. was employed to obtain amplifiers ofa DNA fragment of the mitochondrial gene encoding for the first subunit of cytochrome-C-oxidase. To obtain polymerase chain reaction products from other isolates, the authors used the primers of the following structure: 5'TGTGTTGATTTTGCCTGG 3' (a direct primer) and 5'GCCACCACAAACCAAGTATC 3' (an indirect primer). Hybridization was performed at 52 degrees C; amplification was made in the thermocycler mode: 1 cycle, 94 degrees C, 3 min; 35 cycles, 94 degrees C, 10 sec; 52 degrees C, 10 sec; 72 degrees C, 15 sec; 1 cycle, 72 degrees C, 1 min. Analysis of nucleotide sequences showed a significant similarity of these DNA samples with the genotype G1 of E. granulosus and revealed nucleotide replacement in position T23A.
Assuntos
Equinococose Hepática/diagnóstico , Equinococose Hepática/parasitologia , Echinococcus granulosus/isolamento & purificação , Complexo IV da Cadeia de Transporte de Elétrons/genética , Reação em Cadeia da Polimerase/métodos , Animais , Criança , Primers do DNA , DNA de Helmintos/genética , DNA Mitocondrial/genética , Echinococcus granulosus/enzimologia , Echinococcus granulosus/genética , Genes de Helmintos , HumanosRESUMO
DNA samples isolated from peripheral venous blood lymphocytes in 73 children with hydatid disease were studied. The polymorphism of exon 7 (A4889G) of the CYP1A1 gene was analyzed by polymerase chain reaction, followed by hydrolysis with restriction endonuclease HincII. The material for E. granulosus genotypes to be studied was obtained from the germinal layer of larvocysts. The fragment of the mitochondrial gene encoding for the first subunit of cytochome-C-oxidase was as a DNA marker. The amplified E. granulosus DNA fragments underwent direct sequencing and a genotype was identified. The findings have led to the conclusion that carriage of polymorphic allele Val of exon 7 (A4889G) of the CYP1A1 gene in those infested with E. granulosus genotype G1 (common, sheep strain) is a risk factor of the development of the clinical form of echinococcosis granulosus.
Assuntos
Citocromo P-450 CYP1A1/genética , Equinococose/genética , Echinococcus granulosus , Predisposição Genética para Doença , Adolescente , Alelos , Animais , Criança , Pré-Escolar , Echinococcus granulosus/classificação , Echinococcus granulosus/genética , Echinococcus granulosus/isolamento & purificação , Éxons/genética , Feminino , Genótipo , Heterozigoto , Humanos , Leucócitos Mononucleares , Masculino , Fatores de RiscoRESUMO
A 15-year-old patient living in Bashkortostan was admitted as having a diagnosis of hydatid cyst of the left hepatic lobe for surgical treatment. He had the following concomitant diseases: neurodermatitis, bronchial asthma, and acute respiratory disease. After surgery (laparoscopic echinococcectomy), a portion was taken from the parent vesicle wall for a histological study. The parasite was detected on the inner membrane surface. It is suggested that this is a Pentastoma sp. (Arthropoda, Maxillopoda, Pentastomida, and Cephalobaenida). Thus, the observed patient has a combined hepatic invasion with Echinococcus and Pentastoma).
Assuntos
Artrópodes , Equinococose Hepática/complicações , Doenças Parasitárias/complicações , Doenças Parasitárias/parasitologia , Adolescente , Animais , Artrópodes/anatomia & histologia , Artrópodes/classificação , Humanos , Fígado/parasitologia , MasculinoRESUMO
The topicality of the problem associated with echinococcosis granulosus in the South Urals is determined by its wide spread and a considerable economic damage made to this region by this invasion. The study was undertaken to reveal the intraspecific affiliation of Echinococcus granulosus that induces hydatid disease in the population of the South Urals. Samples for studies were taken from the fertile larval cysts obtained during intraoperative intervention in patients with hydatid disease. As morphological criteria for differentiation, the authors examined the proboscis uncuses of protoscolexes. For E. granulosus genomic typing, polymerase chain reaction (PCR) of DNA synthesis was used, as described by Gasser (1998). As a DNA marker, the authors used a fragment of the mitochondrial gene encoding for the first subunit of cytochome-C-oxidase. The DNA fragments obtained by PCR from 9 isolated underwent the direct enzyme dideoxy-sequencing test (Senger, 1977). As a result, the causative agent of echinococcosis granulosis was first identified in the patient of the South Urals. In children and adults, the clinical form of the disease is caused by E. granulosus with the genotype G - common, that of domestic sheep. Comparative analysis of molecular data revealed the presence of genotype G1 variations circulating in the South Urals homologous to the sequences recorded in the GenBank under numbers U50464 and DQ109036.
Assuntos
Equinococose/parasitologia , Echinococcus granulosus/classificação , Adolescente , Adulto , Animais , Criança , Pré-Escolar , DNA de Helmintos/genética , DNA Mitocondrial/genética , Echinococcus granulosus/anatomia & histologia , Echinococcus granulosus/genética , Complexo IV da Cadeia de Transporte de Elétrons/genética , Humanos , Larva/anatomia & histologia , Larva/classificação , Larva/genética , Reação em Cadeia da Polimerase , Federação Russa , Especificidade da EspécieRESUMO
Nine larvocysts of Echinococcus granulosus isolated from nine patients and one cyst derived from a naturally infested cattle have been examined. Genomic typing was carried out in order to identify strains of E. granulosus. All DNA samples were shown to have the same genotype, E. granulosus G1.
Assuntos
DNA de Helmintos/genética , Equinococose/genética , Echinococcus granulosus/genética , Adolescente , Animais , Bovinos , Criança , Equinococose/epidemiologia , Feminino , Genótipo , Humanos , Masculino , Federação RussaRESUMO
Polymorphism at the HLA-DRB1 locus in six Turkic (Bashkirs, Tatars, and Chuvashes) and Finno-Ugric (Udmurts, Maris, and Komis) populations of the Volga--Ural region was studied by PCR. A total of 12 DRB1 specificities displaying population-specific frequency distribution patterns were described. The most frequently observed specificities in Bashkirs and Udmurts were DRB1*07 (25 and 34%, respectively) and *15 (by 15%). In Tatars the prevalence of *04 (18%), *01 (17%), *07 (16%) and *15 (13%) specificities was observed, while in Chuvashes these were *04 (28%), *11 (18%), *01 (16%), and *07 (16%). High frequencies of *11 (21%), *04 (17%), *01 (13%), and *04 (11%) specificities were characteristic of Komis, whereas Maris were distinguished by high frequencies of *01 (23%), *11 (14%), *07 (13%), and *04 (11%). In general, the pattern of DRB1 allelic polymorphism in populations of the Volga-Ural region, occupying the intermediate position between the Caucasoid- and Mongoloid-specific allelic frequency distribution patterns, was consistent with their anthropological type rather than with their linguistic affiliation.