First report of strawberry polerovirus 1 in strawberry in Nepal.

Strawberry (Fragaria x ananassa Duch.) was introduced to Nepal from Japan in the 1990s, and thus, is a relatively new crop in the country. After the initial introduction of cultivar 'Nyoho' in Kakani, Nuwakot, different agencies and growers have introduced a number of cultivars in large numbers from Japan, Europe, America and India to expand the cultivation of strawberry in Nepal. Such practice has increased the risk of introducing new pathogens in the country. During a field visit at Kakani in October 2018, virus-like symptoms were observed in 5-10% of the plants in a polyhouse (~200 m2). Three strawberry leaf samples showing vein banding, vein clearing or tip necrosis with leaf puckering were collected. Total RNA was extracted from leaves using the RNeasy Plant Mini Kit (Qiagen, Germany) and subjected to high-throughput sequencing (HTS). After ribosomal RNA depletion using the Ribo-Zero rRNA kit, a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA Kit and sequenced on an Illumina NovaSeq 6000 system (Macrogen Inc. Korea). De novo transcriptome assembly of the 67,748,658 reads with Trinity software (r20140717) yielded 116,854 contigs of 201-17,773 nucleotides (nt). BLASTn and BLASTx analysis of the contigs against the NCBI viral reference database showed that one contig with the nearly full genome sequence (5,968 nt, deposited under GenBank accssion number MZ355624) was identified as strawberry polerovirus 1 (SPV-1). A total of 10,401 reads was mapped to the reference SPV-1 nucleotide genome (GenBank accession number NC_025435) with a 263.2 sequence depth. The contig shared 99% nt sequence identity with SPV-1 isolate AB5301 (GenBank accession number KM233705) from Canada and 97% identity with the Argentine SPV-1 isolate 15CA (GenBank accession number MK142237). To confirm the presence of SPV-1, reverse transcription-PCR (RT-PCR) was performed using previously reported specific primers, SPV-1F (AGAGATCGCCGGATTCCGCAA) and SPV-1R (TGACACGCTCGGTATTCACAAACAG), amplifying 281 nt of the P1-P2 fusion protein gene (Thekke-Veetil and Tzanetakis 2016). Of the three samples, only one showing vein banding symptoms (Figure S1) was positive for SPV-1. Sanger sequencing of the RT-PCR products showed 100% nt identity with the HTS-derived sequence. SPV-1, a member of the genus Polerovirus in the family Solemoviridae, was first reported in strawberry showing decline symptom in Canada (Xiang et al. 2015), and was subsequently detected in the USA (Thekke-Veetil and Tzanetakis 2016) and in Argentina (Luciani et al. 2016; 2018). To our knowledge, this is the first report of SPV-1 infection in strawberry in Nepal and Asia.

Mushroom extract inhibits ultraviolet B-induced cellular senescence in human keratinocytes.

Mushrooms possess various bioactivities and are used as nutritional supplements and medicinal products. Twenty-nine bioactive components have been extracted recently from mushrooms grown in Nepal. In this study, we evaluated the ability of these mushroom extracts to augment SIRT1, a mammalian SIR2 homologue localized in cytosol and nuclei. We established a system for screening food ingredients that augment the SIRT1 promoter in HaCaT cells, and identified a SIRT1-augmenting mushroom extract (number 28, Trametes versicolor). UVB irradiation induced cellular senescence in HaCaT cells, as evidenced by increased activity and expression of cellular senescence markers including senescence-associated ß-galactosidase, p21, p16, phosphorylated p38, and γH2AX. Results clearly showed that the mushroom extract (No. 28) suppressed the ultraviolet B irradiation-induced cellular senescence in HaCaT cells possibly through augmenting SIRT1 expression.

Wild Mushrooms in Nepal: Some Potential Candidates as Antioxidant and ACE-Inhibition Sources.

Twenty-nine mushrooms collected in the mountainous areas of Nepal were analyzed for antioxidant activity by different methods, including Folin-Ciocalteu, ORAC, ABTS, and DPPH assays. Intracellular H2O2-scavenging activity was also performed on HaCaT cells. The results showed that phenolic compounds are the main antioxidant of the mushrooms. Among studied samples, Inonotus andersonii, and Phellinus gilvus exhibited very high antioxidant activity with the phenolic contents up to 310.8 and 258.7 mg GAE/g extracts, respectively. The H2O2-scavenging assay on cells also revealed the potential of these mushrooms in the prevention of oxidative stress. In term of ACE-inhibition, results showed that Phlebia tremellosa would be a novel and promising candidate for antihypertensive studies. This mushroom exhibited even higher in vitro ACE-inhibition activity than Ganoderma lingzhi, with the IC50 values of the two mushrooms being 32 µ g/mL and 2 µ g/mL, respectively. This is the first time biological activities of mushrooms collected in Nepal were reported. Information from this study should be a valuable reference for future studies on antioxidant and ACE-inhibitory activities of mushrooms.

Natural occurrence and distribution of entomopathogenic nematodes (Steinernematidae and Heterorhabditidae) in Nepal.

A survey of entomopathogenic nematodes (EPN) was conducted for the first time in Nepal during June-December 2007. EPN were recovered from 29 of the 276 soil samples (10.50%). Molecular and morphological tools were used to identify the isolates. Among 29 positive samples, seven samples (24.14%) yielded heterorhabditids (Heterorhabditis indica) and 22 samples (75.86%) contained steinernematids. Among steinernematids, seven isolates were identified as one of four described species (Steinernema abbasi, S. cholashanense, S. feltiae and S. siamkayai) whereas 15 isolates did not fit any description. H. indica was recovered from diverse habitats. Distribution of steinernematids has followed ecological niches and localized areas.