RESUMO
The management of plant diseases relies on the accurate identification of pathogens that requires a robust and validated tool in terms of specificity, sensitivity, repeatability, and reproducibility. High-throughput sequencing (HTS) has become the method of choice for virus detection when either a complete viral status of a plant is required in a single assay or if an unknown viral agent is expected. To ensure that the most accurate diagnosis is made from an HTS data analysis, a standardized protocol per pathosystem is required. This chapter presents a detailed protocol for the detection of viruses and viroids infecting citrus using HTS. The protocol describes all the steps from sample processing, nucleic acid extraction, and bioinformatic analyses validated to be an efficient method for detection in this pathosystem. The protocol also includes a section on citrus tristeza virus (CTV) genotype differentiation using HTS data.
Assuntos
Citrus , Vírus de Plantas , Viroides , Viroides/genética , Citrus/genética , Reprodutibilidade dos Testes , Genótipo , Sequenciamento de Nucleotídeos em Larga Escala , Doenças das Plantas/genética , Vírus de Plantas/genéticaRESUMO
Recent developments in high-throughput sequencing (HTS) technologies and bioinformatics have drastically changed research in virology, especially for virus discovery. Indeed, proper monitoring of the viral population requires information on the different isolates circulating in the studied area. For this purpose, HTS has greatly facilitated the sequencing of new genomes of detected viruses and their comparison. However, bioinformatics analyses allowing reconstruction of genome sequences and detection of single nucleotide polymorphisms (SNPs) can potentially create bias and has not been widely addressed so far. Therefore, more knowledge is required on the limitations of predicting SNPs based on HTS-generated sequence samples. To address this issue, we compared the ability of 14 plant virology laboratories, each employing a different bioinformatics pipeline, to detect 21 variants of pepino mosaic virus (PepMV) in three samples through large-scale performance testing (PT) using three artificially designed datasets. To evaluate the impact of bioinformatics analyses, they were divided into three key steps: reads pre-processing, virus-isolate identification, and variant calling. Each step was evaluated independently through an original, PT design including discussion and validation between participants at each step. Overall, this work underlines key parameters influencing SNPs detection and proposes recommendations for reliable variant calling for plant viruses. The identification of the closest reference, mapping parameters and manual validation of the detection were recognized as the most impactful analysis steps for the success of the SNPs detections. Strategies to improve the prediction of SNPs are also discussed.
Assuntos
Sequenciamento de Nucleotídeos em Larga Escala , Polimorfismo de Nucleotídeo Único , Humanos , Polimorfismo de Nucleotídeo Único/genética , Genoma Viral/genética , Biologia Computacional , ConhecimentoRESUMO
Grapevine leafroll disease (GLD) is a globally important disease that affects the metabolic composition and biomass of grapes, leading to a reduction in grape yield and quality of wine produced. Grapevine leafroll-associated virus 3 (GLRaV-3) is the main causal agent for GLD. This study aimed to identify protein-protein interactions between GLRaV-3 and its host. A yeast two-hybrid (Y2H) library was constructed from Vitis vinifera mRNA and screened against GLRaV-3 open reading frames encoding structural proteins and those potentially involved in systemic spread and silencing of host defense mechanisms. Five interacting protein pairs were identified, three of which were demonstrated in planta. The minor coat protein of GLRaV-3 was shown to interact with 3-deoxy-D-arabino-heptulosonate 7-phosphate synthase 02, a protein involved in primary carbohydrate metabolism and the biosynthesis of aromatic amino acids. Interactions were also identified between GLRaV-3 p20A and an 18.1-kDa class I small heat shock protein, as well as MAP3K epsilon protein kinase 1. Both proteins are involved in the response of plants to various stressors, including pathogen infections. Two additional proteins, chlorophyll a-b binding protein CP26 and a SMAX1-LIKE 6 protein, were identified as interacting with p20A in yeast but these interactions could not be demonstrated in planta. The findings of this study advance our understanding of the functions of GLRaV-3-encoded proteins and how the interaction between these proteins and those of V. vinifera could lead to GLD.
Assuntos
Closteroviridae , Vitis , Saccharomyces cerevisiae , Clorofila A , Doenças das Plantas , Closteroviridae/genéticaRESUMO
Agapanthus praecox Willd. is an ornamental flowering plant that is indigenous to southern Africa and was reported to be a host of tomato spotted wilt orthotospovirus (TSWV) in Australia in 2000 (Wilson et al. 2000). Tomato spotted wilt orthotospovirus (TSWV) belonging to the genus Orthotospovirus of the family Tospoviridae is a single-stranded negative sense RNA virus known to cause disease symptoms in many crops and ornamental plant species. This virus is in the top 10 of most economically important plant viruses worldwide (Rybicki 2015; Scholthof et al. 2011). In May 2021, leaf material from three agapanthus (Agapanthus praecox) plants displaying chlorotic mottling, and yellow lesions (Supplementary material 1A) was collected in Mbombela, South Africa. One gram of symptomatic leaf material was used for total RNA extraction from each of the three samples using a CTAB extraction protocol (Ruiz-García et al. 2019). The three RNA extracts were pooled, and a sequencing library was constructed using the Ion Total RNA-Seq Kit v2.0 and RiboMinus™ Plant Kit for RNA-Seq (ThermoFisher Scientific) (Central Analytical Facility (CAF), Stellenbosch University). The RNA library was sequenced on an Ion Torrent Proton Instrument (CAF). A total of 34,392,939 single-end reads were obtained. Data was trimmed for quality with Trimmomatic (CROP:250, MINLEN:50). De novo assembly was performed on the remaining 32,281,645 trimmed reads (average readlength: 100 nt, range: 50-250 nt) using SPAdes 3.13.0 and resulted in 4,788 contigs. BLASTn analysis identified viral contigs longer than 1,000 nucleotides (nts) with high nucleotide (nt) identity to TSWV (6 contigs), as well as to the newly discovered viruses, agapanthus tungro virus (AgTV) (1 contig), and agapanthus velarivirus (AgVV) (4 contigs) (Read et al 2021). Read mapping was performed against the relevant reference sequence with the highest nt identity to the contigs. For TSWV, 4995, 21221 and 14574 reads mapped to segment L (KY250488), M (KY250489) and S (KY250490) of isolate LK-1, respectively resulting in 99.97%, 100.00% and 99.97% genome coverage of the reference accessions. The nt identity between the reference accessions and the consensus sequences generated (OP921761-OP921763) were 97.26%, 97.64% and 97.82% for segment L, M and S. The presence of TSWV was confirmed in the HTS sample using an RT-PCR assay (primers L1 and L2) targeting the L segment of TSWV (Mumford et al. 1994). In July 2022, additional leaf samples displaying symptoms of chlorotic mottling, streaking, and ringspots were collected from 31 symptomatic and 3 asymptomatic agapanthus plants in public gardens in Stellenbosch, South Africa. Using the above-mentioned RT-PCR assay, 13 of the symptomatic samples tested positive for TSWV. All six plants displaying ring spot symptoms (Supplementary material 1B) were infected with TSWV. However, plants that displayed yellow streaking (five samples) and chlorotic mottling (two samples) (Supplementary material 1C-D) were also positive for TSWV which could be due to the presence of other viruses, plant growth stage, infection time or just variable symptom expression in a single host species as reported previously (Sherwood et al. 2003). The 275 bp RT-PCR amplicons of the HTS sample and three additional positive samples were validated with bidirectional Sanger sequencing (CAF) and had 96% identity to accession KY250488. The pairwise nt identity between amplicons was 98.55-100%. This is the first report of TSWV infecting agapanthus in South Africa. This study contributes information towards the distribution and incidence of TSWV and highlights the need for nurseries to screen plant material before propagation.
RESUMO
The roles of proteins encoded by members of the genus Ampelovirus, family Closteroviridae are largely inferred by sequence homology or analogy to similarly located ORFs in related viruses. This study employed yeast two-hybrid and bimolecular fluorescence complementation assays to investigate interactions between proteins of grapevine leafroll-associated virus 3 (GLRaV-3). The p5 movement protein, HSP70 homolog, coat protein, and p20B of GLRaV-3 were all found to self-interact, however, the mechanism by which p5 interacts remains unknown due to the absence of a cysteine residue crucial for the dimerisation of the closterovirus homolog of this protein. Although HSP70h forms part of the virion head of closteroviruses, in GLRaV-3, it interacts with the coat protein that makes up the body of the virion. Silencing suppressor p20B has been shown to interact with HSP70h, as well as the major coat protein and the minor coat protein. The results of this study suggest that the virion assembly of a member of the genus Ampelovirus occurs in a similar but not identical manner to those of other genera in the family Closteroviridae. Identification of interactions of p20B with virus structural proteins provides an avenue for future research to explore the mechanisms behind the suppression of host silencing and suggests possible involvement in other aspects of the viral replication cycle.
Assuntos
Closteroviridae , Closterovirus , Genoma Viral , RNA Viral , Closteroviridae/genética , Closterovirus/genética , Doenças das PlantasRESUMO
BACKGROUND: Fruit flies (Diptera: Tephritidae) comprise species of agricultural and economic importance. Five such fruit fly species are known to affect commercial fruit production and export in South Africa: Ceratitis capitata, Ceratitis cosyra, Ceratitis rosa, Ceratitis quilicii, and Bactrocera dorsalis. Management practices for these pests include monitoring, application of pest control products, post-harvest disinfestation measures and inspection of consignments both prior to shipment and at ports of entry. In activities relating to monitoring and inspection, accurate identification of these pests to species level is required. While morphological keys for adult stages of these fruit fly species have been well developed, morphological keys for earlier life stages remain problematic. In instances where closely related species cannot be reliably distinguished morphologically, there is a need for molecular tools to assist in identifying these five fruit fly species during surveillance practices, where sequencing-based approaches would be beneficial. RESULTS: Two complete mitochondrial genomes were assembled for each fruit fly species investigated using high throughput sequencing data generated in this study. A single primer set was designed to amplify a region between tRNAile and tRNAmet. The amplicon consists of a partial segment of tRNAile, intergenic region I (tRNAile - tRNAgln), the complete sequence of tRNAgln, intergenic region II (tRNAgln - tRNAmet), and a partial segment of tRNAmet. PCR amplicons were generated for 20 specimens of each species, five of which were colony adult males, five colony larvae, and 10 wild, trap-collected specimens. Upon analysis of the amplicon, intergenic region I was identified as the most informative region, allowing for unambiguous identification of the five fruit fly species. The similarity in intergenic region II was too high between C. rosa and C. quilicii for accurate differentiation of these species. CONCLUSION: The identity of all five fruit flies investigated in this study can be determined through sequence analysis of the mitochondrial intergenic regions. Within the target amplicon, intergenic region I (tRNAile - tRNAgln) shows interspecific variation sufficient for species differentiation based on multiple sequence alignment. The variation in the length of intergenic region I is proposed as a potential tool for accurately identifying these five fruit flies in South Africa.
Assuntos
Tephritidae , Masculino , Animais , Tephritidae/genética , DNA Intergênico/genética , RNA de Transferência de Glutamina , África do Sul , RNA de Transferência de Isoleucina , RNA de Transferência de Metionina , DrosophilaRESUMO
Plum viroid I (PlVd-I) was recently identified as a new viroid in 2020 present in Japanese plum (Prunus salicina) displaying marbling and corky flesh symptoms (Bester et al. 2020). This viroid is a member of the species Apscaviroid plvd-I (genus Apscaviroid, family Pospiviroidae) (Walker et al. 2022). The first observation of apricot fruits with an uneven, indented surface and irregular shape was in 2003 on Prunus armeniaca cv. Charisma in the Western Cape, South Africa. The symptomatic apricot cv 'Charisma' scions showed symptoms only on the fruits, resembling the marbling disease deformities reported previously on fruits from PlVd-I-infected plum trees (Supplementary material 1). In the summer of 2019, representative leaf samples were collected from 13 'Charisma' apricot trees (seven symptomatic and six healthy trees) from two different apricot orchards on two geographical separate farms in the Western Cape. Total RNA was extracted from 1 g leaf petioles using a modified CTAB extraction protocol (Ruiz-García et al. 2019). Ribo-depleted RNA (RiboMinus™ Plant Kit for RNA-Seq, ThermoFisher Scientific) was prepared, and a sequencing library (Ion Total RNA-Seq Kit v2.0, ThermoFisher Scientific) was constructed from a symptomatic sample (La4) (Central Analytical Facility, Stellenbosch University, CAF-SU). High-throughput sequencing was performed on an Ion Torrent™ Proton™ instrument (CAF-SU). De novo assembly using SPAdes 3.13.0 (default parameters) (Nurk et al. 2013) were performed using 93,760,198 reads (average read length: 143 nt). The 174679 scaffolds obtained were annotated using BLAST+ standalone against a local NCBI nucleotide database. One scaffold (443 nt, read coverage: 23.88) had the highest sequence identity (99.59%) to multiple PlVd-I isolates and two scaffolds of 1440 nucleotides (nt) and 2143 nt had high sequence identity to RNA1 and RNA2 of solanum nigrum ilarvirus 1 (SnIV1) (MN216370: 98%; MN216373: 98%) (Ma et al. 2020). These were the only viral sequences identified in the sample. Consensus sequences for SnIV1 were generated by read mapping using CLC Genomics Workbench 11.0.1 (Qiagen) (default parameters) to SnIV1 (MN216370; MN216373; MN216376) and deposited in GenBank (MT900926-MT900928). To confirm the presence of both PlVd-I and the apricot variant of SnIV1, reverse transcription polymerase chain reactions (RT-PCRs) were performed on the RNA of the 13 samples collected. The samples were tested for PlVd-I using primer set 22F/21R (Bester et al. 2020). Only the symptomatic samples tested positive for PlVd-I providing the first evidence of PlVd-I related symptoms in apricots. Three PlVd-I amplicons were bidirectionally Sanger sequenced (CAF-SU) and submitted to GenBank (MT385845-MT385847). The HTS PlVd-I sequence from sample La4 was 100% identical to MT385845, and 99.37% identical to MT385846 and MT385847. An RT-PCR assay was designed, targeting SnIV1 RNA2 (Ilar_RNA2_402F: CTATCTGCCCGAAGGTCAAC, Ilar_RNA2_1161R: CCTATCAAGAGCGAGCAATGG). All samples tested positive for SnIV1 irrespective of symptom status and therefor SnIV1 appears not be associated with specific symptoms in 'Charisma' apricots. This study is the first to report the presence of PlVd-I in symptomatic apricots presenting with uneven, indented surface morphology in South Africa. This study adds towards the investigation into possible alternative hosts for PlVd-I and will assist the South African certification scheme to assess the incidence and severity in apricots.
RESUMO
The credibility of a pathogen detection assay is measured using specific parameters including repeatability, specificity, sensitivity, and reproducibility. The use of high-throughput sequencing (HTS) as a routine detection assay for viruses and viroids in citrus was previously evaluated and, in this study, the reproducibility and sensitivity of the HTS assay were assessed. To evaluate the reproducibility of HTS, the same plants assayed in a previous study were sampled again, one year later, and assessed in triplicate using the same analyses to construct the virome profile. The sensitivity of the HTS assay was compared to routinely used RT-PCR assays in a time course experiment, to compensate for natural pathogen accumulation in plants over time. The HTS pipeline applied in this study produced reproducible and comparable results to standard RT-PCR assays for the detection of CTV and three viroid species in citrus. Even though the limit of detection of HTS can be influenced by pathogen concentration, sample processing method and sequencing depth, detection with HTS was found to be either equivalent or more sensitive than RT-PCR in this study.
RESUMO
The fruit fly (Diptera: Tephritidae) species, Ceratitis capitata, Ceratitis cosyra, Ceratitis rosa, Ceratitis quilicii, and Bactrocera dorsalis are of economic importance in South Africa. These agricultural pests cause extensive damage to a range of commercially produced fruit, primarily for export. These pests are of phytosanitary significance, and their presence in fruit-producing regions in South Africa has led to restrictions in export trade of fresh produce. Accurate identification of these flies, particularly at immature stages intercepted in fruit consignments originating from South Africa, is essential but remains an ongoing challenge. A rapid and accurate identification assay to differentiate these five species is needed for inspection and pest surveillance. High throughput sequencing data were generated for each of the five fruit fly species, and five sets of species-specific primers were designed for use in a multiplex PCR. Each primer set amplifies an amplicon of a different size for each species allowing for accurate identification. PCR sensitivity tests demonstrate that the limit of detection for this assay is 10 ng and 4 ng of DNA when extracted from larvae and adult specimens, respectively. The assay developed can be applied in fruit inspection and survey activities within the country and at ports of entry.
Assuntos
Ceratitis capitata , Tephritidae , Animais , Ceratitis capitata/genética , Drosophila/genética , Frutas , Reação em Cadeia da Polimerase Multiplex , África do Sul , Tephritidae/genéticaRESUMO
Plum viroid I (PlVd-I) is found in marbling and corky flesh diseased plum trees in South Africa. In this study a reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay for the high-throughput detection of PlVd-I was developed. This assay can be performed on crude extracts and detection can either be a pH dependent colorimetric reaction or a real-time fluorescent signal reaction. The false discovery rate was shown to be low and no decrease in sensitivity was detected compared to RT-PCR. The RT-LAMP assay allows for the fast and cost-effective detection of PlVd-I that will curtail the distribution of infected plant material.
Assuntos
Prunus domestica , Viroides , Técnicas de Diagnóstico Molecular , Técnicas de Amplificação de Ácido Nucleico , Transcrição Reversa , Sensibilidade e Especificidade , Viroides/genéticaRESUMO
Citrus virus A (CiVA), a novel negative-sense single-stranded RNA virus assigned to the species Coguvirus eburi in the genus Coguvirus, was detected in South Africa with the use of high-throughput sequencing after its initial discovery in Italy. CiVA is closely related to citrus concave gum-associated virus (CCGaV), recently assigned to the species Citrus coguvirus. Disease association with CiVA is, however, incomplete. CiVA was detected in grapefruit (C. paradisi Macf.), sweet orange [C. sinensis (L.) Osb.], and clementine (C. reticulata Blanco) in South Africa, and a survey to determine the distribution, symptom association, and genetic diversity was conducted in three provinces and seven citrus production regions. The virus was detected in 'Delta' Valencia trees in six citrus production regions, and a fruit rind symptom was often observed on CiVA-positive trees. Additionally, grapefruit showing symptoms of citrus impietratura disease were positive for CiVA. This virus was primarily detected in older orchards that were established prior to the application of shoot tip grafting for virus elimination in the South African Citrus Improvement Scheme. The three viral-encoded genes of CiVA isolates from each cultivar and region were sequenced to investigate sequence diversity. Genetic differences were detected between the Delta Valencia, grapefruit, and clementine samples, with greater sequence variation observed with the nucleocapsid protein (NP) compared with the RNA-dependent RNA polymerase (RdRp) and the movement protein (MP). A real-time detection assay, targeting the RdRp, was developed to simultaneously detect citrus-infecting coguviruses, CiVA and CCGaV, using a dual priming reverse primer to improve PCR specificity.
Assuntos
Citrus , Vírus de RNA , Variação Genética , Doenças das Plantas , RNA Polimerase Dependente de RNA , Reação em Cadeia da Polimerase Via Transcriptase Reversa , África do SulRESUMO
It has been nearly 100 years since citrus growers in two distinct regions in the northern provinces of South Africa noticed unusual symptoms in their citrus trees, causing significant crop losses. They had no idea that these symptoms would later become part of an almost global pandemic of a disease called greening or huanglongbing (HLB). The rapid spread of the disease indicated that it might be caused by a transmissible pathogen, but it took >50 years to identify the causative agent as 'Candidatus Liberibacter africanus'. Recently, the disease appeared in more African countries, spreading by both infected planting material and Trioza erytreae. To date, five 'Ca. L. africanus' subspecies have been identified in various rutaceous species, with 'Ca. L. africanus subsp. clausenae' the only subspecies for which a biovar was detected in citrus. Efforts to detect and differentiate HLB-causing Liberibacter species are ongoing, and recent developments are discussed here. This review focuses on aspects of the African form of HLB, including its specific bacterial species and subspecies, its main insect vector, its geographic distribution, and current management strategies.
Assuntos
Citrus , Rhizobiaceae , Liberibacter , Doenças das Plantas , África do SulRESUMO
Syrah decline, first identified in Southern France in the 1990s, has become a major concern in the global grape and wine industry. This disease mainly affects Syrah (Shiraz) grapevines. Characteristic symptoms include the bright and uniform reddening of leaves throughout the canopy in late summer or early fall; the appearance of abnormalities on the trunk, mainly at the graft union (swelling, pits, grooves, and necrosis); and a reduction in vine vigor, yield and berry quality. Diseased vines may die a few years after disease onset. Damages to the vine are even more pronounced in cool climate regions such as Ontario (Canada), where the affected vines are subjected to very cold and prolonged winters, leading to large numbers of vine deaths. Despite the extensive efforts of the global grape research community over the past few decades, the etiology of this disease remains unclear. In this study, we conducted extensive analyses of viruses in declining Syrah vines identified in commercial vineyards in the Niagara region (Ontario, Canada) through high-throughput sequencing, PCR, RT-PCR and the profiling of genetic variants of select viruses. Multiple viruses and viral strains, as well as three viroids, were identified. However, an unequivocal causal relationship cannot be established between Syrah decline and any of these viruses, although the possibility that certain virus or genetic variants, or both in combination, may contribute to the disease cannot be excluded. Gleaning all information that is available to date, we feel that the traditional approach and an insistence on finding a single cause for such a complex disorder in a woody perennial fruit crop involving grafting will prove to be futile. We hope that this study offers new conceptual perspectives on the etiology of this economically important but enigmatic disease complex that affects the global grape and wine industry.
Assuntos
Vitis , Vinho , Vinho/análise , Ontário , Frutas , Folhas de PlantaRESUMO
High-throughput sequencing (HTS) was used to construct the virome profile of an old grapevine-leafroll-diseased grapevine (Vitis vinifera). De novo assembly of HTS data showed a complex infection, including a virus sequence with similarity to viruses of the genus Badnavirus, family Caulimoviridae. The complete genome sequence of this virus consists of 7090 nucleotides and has four open reading frames (ORFs). Genome organisation and phylogenetic analysis identify this virus as a divergent variant of grapevine Roditis leaf discoloration-associated virus (GRLDaV) with 90% nucleotide sequence identity to isolate w4 (NC_027131). This is the first genome sequence of a South African variant of GRLDaV.
Assuntos
Badnavirus/genética , Genoma Viral/genética , Doenças das Plantas/virologia , Folhas de Planta/virologia , Vitis/virologia , Vírus de DNA/genética , DNA Viral/genética , Sequenciamento de Nucleotídeos em Larga Escala/métodos , Fases de Leitura Aberta/genética , Filogenia , Análise de Sequência de DNA/métodos , África do Sul , Sequenciamento Completo do Genoma/métodosRESUMO
BACKGROUND: High-throughput sequencing (HTS) has been applied successfully for virus and viroid discovery in many agricultural crops leading to the current drive to apply this technology in routine pathogen detection. The validation of HTS-based pathogen detection is therefore paramount. METHODS: Plant infections were established by graft inoculating a suite of viruses and viroids from established sources for further study. Four plants (one healthy plant and three infected) were sampled in triplicate and total RNA was extracted using two different methods (CTAB extraction protocol and the Zymo Research Quick-RNA Plant Miniprep Kit) and sent for Illumina HTS. One replicate sample of each plant for each RNA extraction method was also sent for HTS on an Ion Torrent platform. The data were evaluated for biological and technical variation focussing on RNA extraction method, platform used and bioinformatic analysis. RESULTS: The study evaluated the influence of different HTS protocols on the sensitivity, specificity and repeatability of HTS as a detection tool. Both extraction methods and sequencing platforms resulted in significant differences between the data sets. Using a de novo assembly approach, complemented with read mapping, the Illumina data allowed a greater proportion of the expected pathogen scaffolds to be inferred, and an accurate virome profile was constructed. The complete virome profile was also constructed using the Ion Torrent data but analyses showed that more sequencing depth is required to be comparative to the Illumina protocol and produce consistent results. The CTAB extraction protocol lowered the proportion of viroid sequences recovered with HTS, and the Zymo Research kit resulted in more variation in the read counts obtained per pathogen sequence. The expression profiles of reference genes were also investigated to assess the suitability of these genes as internal controls to allow for the comparison between samples across different protocols. CONCLUSIONS: This study highlights the need to measure the level of variation that can arise from the different variables of an HTS protocol, from sample preparation to data analysis. HTS is more comprehensive than any assay previously used, but with the necessary validations and standard operating procedures, the implementation of HTS as part of routine pathogen screening practices is possible.
Assuntos
Citrus , Sequenciamento de Nucleotídeos em Larga Escala , Doenças das Plantas/virologia , Vírus de Plantas , Viroides , Citrus/virologia , Vírus de Plantas/genética , Plantas/virologia , RNA , Viroides/genéticaRESUMO
The application of high-throughput sequencing (HTS) has successfully been used for virus discovery to resolve disease etiology in many agricultural crops. The greatest advantage of HTS is that it can provide a complete viral status of a plant, including information on mixed infections of viral species or virus variants. This provides insight into the virus population structure, ecology, or evolution and can be used to differentiate among virus variants that may contribute differently toward disease etiology. In this study, the use of HTS for citrus tristeza virus (CTV) genotype detection was evaluated. A bioinformatic pipeline for CTV genotype detection was constructed and evaluated using simulated and real data sets to determine the parameters to discriminate between false positive read mappings and true genotype-specific genome coverage. A 50% genome coverage cut-off was identified for non-target read mappings. HTS with the associated bioinformatic pipeline was validated and proposed as a CTV genotyping assay.
Assuntos
Citrus/virologia , Closterovirus/genética , Genoma Viral , Biologia Computacional , Variação Genética , Genótipo , Sequenciamento de Nucleotídeos em Larga Escala , Filogenia , Doenças das Plantas/virologia , RNA Viral/genéticaRESUMO
Determination of virus genomes and differentiation of strains and strain variants facilitate the linkage of biological expression to specific genetic units. For effective management of stem pitting disease of citrus tristeza virus (CTV) by cross-protection, an understanding of these links is necessary. The deliberate field application of a biological agent such as a virus first requires a thorough assessment of the long-term impact before it can be applied commercially. Three CTV sources were genetically characterized as different variants of the T68 strain, and their long-term effects on stem pitting and production were investigated. The different CTV sources were inoculated to 'Star Ruby' grapefruit trees and evaluated for a number of biological parameters in a field trial in the Limpopo Province of South Africa over a 10-year period. Significant differences were observed in stem pitting severity, impact on tree growth, yield, and the percentage of small fruit produced. These T68 variants were also associated with different stem pitting phenotypes. The variants differed in only 44 nucleotide positions across their genomes, and these minor genetic differences can therefore be used to identify possible genome regions affecting stem pitting.
Assuntos
Citrus paradisi , Citrus , Closterovirus , Doenças das Plantas , África do SulRESUMO
Huanglongbing (HLB, Asian Citrus Greening), the most devastating disease of citrus has not been detected in southern Africa (Gottwald, 2010). HLB is associated with 'Candidatus Liberibacter asiaticus' (CLas), a phloem-limited bacterium vectored by Diaphorina citri Kuwayama (Hemiptera: Liviidae), the Asian Citrus Psyllid (ACP). African Citrus Greening, associated with 'Candidatus Liberibacter africanus' (CLaf) and its vector the African Citrus Triozid, Trioza erytreae (Del Guercio) (Hemiptera: Triozidae), are endemic to Africa, although not previously reported from Angola. African Greening is less severe than HLB, largely due to heat sensitivity of CLaf and its vector. Introduction of HLB into southern Africa would be devastating to citrus production in commercial and informal sectors. Concern was raised that CLas or ACP might hae inadvertently been introduced into Angola. In July 2019, a survey was conducted in two citrus nurseries in Luanda and Caxito and in different orchards on 7 farms surrounding Calulo and Quibala. Yellow sticky traps for insects were placed at the various localities and collected after c. 3 weeks. Breeding signs of T. erytreae (pit galls) were observed on citrus in some locations, but no insect vectors were detected on traps. Trees were inspected for signs and symptoms of citrus pests and diseases, particularly those that resemble HLB (foliar blotchy mottle, shoot chlorosis, vein yellowing and corking, lopsided fruit with aborted seeds and colour inversion) and its vectors (pit galls on leaves or waxy exudates). Leaves and shoots with suspect symptoms were sampled for laboratory analysis (43 samples). DNA was extracted from petiole and midrib tissue of leaves using a modified CTAB extraction protocol of Doyle and Doyle (1990). Real-time PCR was done using universal Liberibacter primers of Roberts et al. (2015), CLaf specific primers of Li et al. (2006) and CLas specific primers of Bao et al. (2019). All real-time PCR protocols indicated the presence of CLaf in 6 samples (Tab. S1). CLas or other citrus Liberibacter species were not detected. The presence of CLaf in sample 37 was confirmed by constructing a library (NEXTFLEX® DNA Sequencing Kit, PerkinElmer) with extracted DNA and performing high-throughput sequencing on an Ion Torrent™ S5™ platform (Central Analytical Facility, Stellenbosch University). To improve the quality of the reads, all 233,617,700 obtained reads were trimmed from the 3' end to a maximum length of 240 nt using Trimmomatic (Bolger et al. 2014). The high quality reads were mapped to the Citrus sinensis reference genome (NC_023046.1) using Bowtie 2.3.4 (Langmead and Salzberg 2012) to subtract all the reads that had high identity to the host plant (number of mismatches allowed in the seed was set to 1). The 14,691,369 unmapped reads (6.2% of original data) were mapped to the CLaf reference genome NZ_CP004021.1 using CLC Genomics Workbench 10.1.1 (Qiagen) (Length fraction = 0.8; Similarity fraction = 0.9). A CLaf consensus genome was generated that spanned 99.7% of the reference genome and the 163001 mapped reads had a 22.9 mean read coverage. The consensus sequence was 99.7% identical to NZ_CP004021.1 and was submitted to Genbank as accession: CP054879. The positive CLaf detections were from trees with typical HLB or African Citrus Greening symptoms, viz. lopsided fruit with green stylar ends, aborted seed and stained columella at base of fruit button; yellow shoots with leaves showing symptoms of blotchy mottle and vein yellowing and corking (Fig. S1) in a commercial citrus farm outside Calulo and included 2 'Ponkan' mandarin (C. reticulata), 2 Valencia and 1 'Navelina' tree (C. sinensis), and a citrus nursery in Luanda (1 lime tree; C. aurantifolia) (Tab. S1). This first report of CLaf in Angola highlights the need to prevent spread by removing infected trees and managing the insect vector, as well as the need for further surveys to determine the occurrence of African Greening and its vectors in other provinces and to confirm the absence of exotic citrus pests and diseases. References Bao, M. et al. 2020. Plant Dis. 104:527 Bolger, A. M. et al. 2014. Bioinformatics. 30:2114-2120. Doyle, J.J. and Doyle, J.L. 1990. Focus 12:13 Gottwald, T.R. 2010. Annu. Rev. Phytopathol. 48:119 Langmead, B. and Salzberg, S. 2012. Nature Methods. 9:357-359. Li, W. et al. 2006. Jnl. Microbiol. Methods 66:104 Roberts, R. et al. 2015. Int. J. Syst. Evol. Micr. 65:723.
RESUMO
Two isolates of the T68 genotype of citrus tristeza virus (CTV) were derived from a common source, GFMS12, by single aphid transmission. These isolates, named GFMS12-8 and GFMS12-1.3, induced stem pitting with differing severity in 'Duncan' grapefruit (Citrus × paradisi [Macfad.]). Full-genome sequencing of these isolates showed only minor nucleotide sequence differences totaling 45 polymorphisms. Numerous nucleotide changes, in relatively close proximity, were detected in the p33 open reading frame (ORF) and the leader protease domains of ORF1a. This is the first report of full-genome characterization of CTV isolates of a single genotype, derived from the same source, but showing differences in pathogenicity. The results demonstrate the development of intragenotype heterogeneity known to occur with single-stranded RNA viruses. Identification of genetic variability between isolates showing different pathogenicity will enable interrogation of specific genome regions for potential stem pitting determinants.
Assuntos
Citrus paradisi , Citrus , Animais , Closterovirus , Genótipo , Filogenia , Doenças das PlantasRESUMO
High-throughput sequencing (HTS) was used to investigate ringspots on ivy (Hedera helix) leaves. De novo assembly of HTS data generated from a total RNA extract from these leaves yielded a contig with sequence similarity to viruses of the genus Badnavirus, family Caulimoviridae. The complete genome sequence of this virus consists of 8,885 nucleotides and has three open reading frames (ORFs). Genome organisation and phylogenetic analysis identifies this newly identified virus as a new member of the genus Badnavirus for which we propose the name "ivy ringspot-associated virus" (IRSaV).