Novel synthetic inducible promoters controlling gene expression during water-deficit stress with green tissue specificity in transgenic poplar.

Synthetic promoters may be designed using short cis-regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter sequences of leaf palisade and vascular cell type-specific expressed genes in water-deficit stressed poplar (Populus tremula × Populus alba), collected through low-input RNA-seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20-base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5' and 3' regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3-10b-1 (5': GTTAACTTCA) and Syn3-10b-2 (3': GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3-10b-1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3-10b-1 had stronger induction in green tissues under water-deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5' sequence of Syn3 endowed both tissue-specificity and water-deficit inducibility in transgenic poplar, whereas the 3' sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3-10b-1, a green tissue-specific and water-deficit stress-induced promoter, and Syn3, a green tissue-preferential constitutive promoter.

Diurnal cycling of rhizosphere bacterial communities is associated with shifts in carbon metabolism.

BACKGROUND: The circadian clock regulates plant metabolic functions and is an important component in plant health and productivity. Rhizosphere bacteria play critical roles in plant growth, health, and development and are shaped primarily by soil communities. Using Illumina next-generation sequencing and high-resolution mass spectrometry, we characterized bacterial communities of wild-type (Col-0) Arabidopsis thaliana and an acyclic line (OX34) ectopically expressing the circadian clock-associated cca1 transcription factor, relative to a soil control, to determine how cycling dynamics affected the microbial community. Microbial communities associated with Brachypodium distachyon (BD21) were also evaluated. RESULTS: Significantly different bacterial community structures (P = 0.031) were observed in the rhizosphere of wild-type plants between light and dark cycle samples. Furthermore, 13% of the community showed cycling, with abundances of several families, including Burkholderiaceae, Rhodospirillaceae, Planctomycetaceae, and Gaiellaceae, exhibiting fluctuation in abundances relative to the light cycle. However, limited-to-no cycling was observed in the acyclic CCAox34 line or in soil controls. Significant cycling was also observed, to a lesser extent, in Brachypodium. Functional gene inference revealed that genes involved in carbohydrate metabolism were likely more abundant in near-dawn, dark samples. Additionally, the composition of organic matter in the rhizosphere showed a significant variation between dark and light cycles. CONCLUSIONS: The results of this study suggest that the rhizosphere bacterial community is regulated, to some extent, by the circadian clock and is likely influenced by, and exerts influences, on plant metabolism and productivity. The timing of bacterial cycling in relation to that of Arabidopsis further suggests that diurnal dynamics influence plant-microbe carbon metabolism and exchange. Equally important, our results suggest that previous studies done without relevance to time of day may need to be reevaluated with regard to the impact of diurnal cycles on the rhizosphere microbial community.

Transcriptomic and proteomic dynamics in the metabolism of a diazotrophic cyanobacterium, Cyanothece sp. PCC 7822 during a diurnal light-dark cycle.

BACKGROUND: Cyanothece sp. PCC 7822 is an excellent cyanobacterial model organism with great potential to be applied as a biocatalyst for the production of high value compounds. Like other unicellular diazotrophic cyanobacterial species, it has a tightly regulated metabolism synchronized to the light-dark cycle. Utilizing transcriptomic and proteomic methods, we quantified the relationships between transcription and translation underlying central and secondary metabolism in response to nitrogen free, 12 hour light and 12 hour dark conditions. RESULTS: By combining mass-spectrometry based proteomics and RNA-sequencing transcriptomics, we quantitatively measured a total of 6766 mRNAs and 1322 proteins at four time points across a 24 hour light-dark cycle. Photosynthesis, nitrogen fixation, and carbon storage relevant genes were expressed during the preceding light or dark period, concurrent with measured nitrogenase activity in the late light period. We describe many instances of disparity in peak mRNA and protein abundances, and strong correlation of light dependent expression of both antisense and CRISPR-related gene expression. The proteins for nitrogenase and the pentose phosphate pathway were highest in the dark, whereas those for glycolysis and the TCA cycle were more prominent in the light. Interestingly, one copy of the psbA gene encoding the photosystem II (PSII) reaction center protein D1 (psbA4) was highly upregulated only in the dark. This protein likely cannot catalyze O2 evolution and so may be used by the cell to keep PSII intact during N2 fixation. The CRISPR elements were found exclusively at the ends of the large plasmid and we speculate that their presence is crucial to the maintenance of this plasmid. CONCLUSIONS: This investigation of parallel transcriptional and translational activity within Cyanothece sp. PCC 7822 provided quantitative information on expression levels of metabolic pathways relevant to engineering efforts. The identification of expression patterns for both mRNA and protein affords a basis for improving biofuel production in this strain and for further genetic manipulations. Expression analysis of the genes encoded on the 6 plasmids provided insight into the possible acquisition and maintenance of some of these extra-chromosomal elements.

Discovery of a splicing regulator required for cell cycle progression.

In the G1 phase of the cell division cycle, eukaryotic cells prepare many of the resources necessary for a new round of growth including renewal of the transcriptional and protein synthetic capacities and building the machinery for chromosome replication. The function of G1 has an early evolutionary origin and is preserved in single and multicellular organisms, although the regulatory mechanisms conducting G1 specific functions are only understood in a few model eukaryotes. Here we describe a new G1 mutant from an ancient family of apicomplexan protozoans. Toxoplasma gondii temperature-sensitive mutant 12-109C6 conditionally arrests in the G1 phase due to a single point mutation in a novel protein containing a single RNA-recognition-motif (TgRRM1). The resulting tyrosine to asparagine amino acid change in TgRRM1 causes severe temperature instability that generates an effective null phenotype for this protein when the mutant is shifted to the restrictive temperature. Orthologs of TgRRM1 are widely conserved in diverse eukaryote lineages, and the human counterpart (RBM42) can functionally replace the missing Toxoplasma factor. Transcriptome studies demonstrate that gene expression is downregulated in the mutant at the restrictive temperature due to a severe defect in splicing that affects both cell cycle and constitutively expressed mRNAs. The interaction of TgRRM1 with factors of the tri-SNP complex (U4/U6 & U5 snRNPs) indicate this factor may be required to assemble an active spliceosome. Thus, the TgRRM1 family of proteins is an unrecognized and evolutionarily conserved class of splicing regulators. This study demonstrates investigations into diverse unicellular eukaryotes, like the Apicomplexa, have the potential to yield new insights into important mechanisms conserved across modern eukaryotic kingdoms.