Meloidogyne Haplanaria: An Emerging Threat to Tomato Production in Florida.

The Mi-gene is widely used in different tomato cultivars to resist several Meloidogyne spp. (root-kot nematode; RKN), including M. incognita, M. javanica, and M. arenaria. Tomato cultivars with the Mi-gene are widely used in fields. However, factors such as temperatures, high initial population densities, and gene dosage can interfere with the expression of this gene. In addition, the presence of virulent species of RKN can limit the usefulness of the gene. One of the virulent species is M. haplanaria, which was identified infecting RKN-resistant tomato in Florida in 2015. The objectives of this study were to determine the initial damage threshold of M. haplanaria on tomato under greenhouse conditions and to analyze the impact of temperature and genetic background on virulence in tomato cultivars. The results showed a preliminary damage threshold of three eggs and J2/cm3 of soil. In addition, it was observed that M. haplanaria has a shorter life cycle than the virulent M. enterolobii and can infect, reproduce, and damage homozygous or heterozygous RKN-resistant tomato plants. This research demonstrated that M. haplanaria should be considered highly virulent on RKN-resistant tomato and is an important threat to agriculture in Florida.

Genotyping of single spore isolates of a Pasteuria penetrans population occurring in Florida using SNP-based markers.

AIMS: To generate single spore lines of a population of bacterial parasite of root-knot nematode (RKN), Pasteuria penetrans, isolated from Florida and examine genotypic variation and virulence characteristics exist within the population. METHODS AND RESULTS: Six single spore lines (SSP), 16SSP, 17SSP, 18SSP, 25SSP, 26SSP and 30SSP were generated. Genetic variability was evaluated by comparing single-nucleotide polymorphisms (SNPs) in six protein-coding genes and the 16S rRNA gene. An average of one SNP was observed for every 69 bp in the 16S rRNA, whereas no SNPs were observed in the protein-coding sequences. Hierarchical cluster analysis of 16S rRNA sequences placed the clones into three distinct clades. Bio-efficacy analysis revealed significant heterogeneity in the level virulence and host specificity between the individual clones. CONCLUSIONS: The SNP markers developed to the 5' hypervariable region of the 16S rRNA gene may be useful in biotype differentiation within a population of P. penetrans. SIGNIFICANCE AND IMPACT OF THE STUDY: This study demonstrates an efficient method for generating single spore lines of P. penetrans and gives a deep insight into genetic heterogeneity and varying level of virulence exists within a population parasitizing a specific Meloidogyne sp. host. The results also suggest that the application of generalist spore lines in nematode management may achieve broad RKN control.

First Report of the Stubby-Root Nematode (Paratrichodorus allius) From a Corn Field in Ohio.

Stubby-root nematodes (family Trichoridae) are an economically important group of ectoparasites that feed on roots, vector tobraviruses, and cause substantial crop loss (1,2,3). In June 2013, 48 soil samples were submitted to the Nematology Laboratory at Ohio State University for nematode analysis from a field planted to corn in Wood County, Ohio. The soil texture was sandy and the field was previously planted to wheat and soybean in 2011 and 2012, respectively. Nematodes were extracted from 100 cm3 soil by decanting and sieving followed by sucrose centrifugal flotation. Phytoparasitic nematodes were identified and counted based on morphological traits to genus at 40× to 63× magnification. Nematode genera parasitic to corn recovered from these samples included Helicotylenchus, Hoplolaimus, Paratrichodorus, Pratylenchus, and Tylenchorhynchus. Stubby-root nematodes (Paratrichodorus sp.) were detected in more than 60% of the samples with a maximum count of 52 per 100 cm3 soil. Individual stubby-root nematodes were hand-picked and identified to species under a compound light microscope as Paratrichodorus allius (Jensen, 1963) Siddiqi, 1974 according to morphological and morphometric characteristics (1). Females (n = 14) were observed with the intestine not anteriorly overlapping the esophagus, posterior subventral esophageal glands overlapping the intestine, caudal pores, absence of spermatheca, and vaginal sclerotization reduced in lateral view. Body length ranged from 475.8 to 840.5 µm (mean = 652.2 µm), and onchiostylet length ranged from 37.7 to 47.4 µm (mean = 42.9 µm). DNA was extracted from single adult females (n = 4) and the 18S rRNA region was amplified with 18S (TTGATTACGTCCCTGCCCTTT) and 26S (TTTCACTCGCCGTTACTAAGG) primers (4). PCR products were purified and sequenced. The sequence was deposited in GenBank (Accession No. KF887974) and was compared with previously deposited sequences by means of BLAST search. The comparison revealed a sequence similarity of 98 to 99% with both P. allius and P. teres (AM269895, AM087124, AJ439572, FJ040484, AJ439575, and AM087125). P. allius and P. teres can be difficult to discriminate using both morphological characteristics and molecular sequencing (3). Therefore, a universal primer (BL18: 5' CCCGTCGMTACTACCGATT 3') and species-specific primers designed to produce PCR products of 432 bp (PAR2: 5'-CCGTTCAAACGCGTATATGATC-3') and 677 bp (PTR4: 5'-CCTGACAAGC'IWGCACTAGC-3') were used for P. allius and P. teres, respectively (3). DNA from individuals used for sequencing was used in PCR reactions with each species-specific primer. DNA samples yielded PCR products of 432 bp with the P. allius-specific primer set and had no reaction with the P. teres-specific primer set. Molecular results and morphological observations confirmed the presence of P. allius in the samples. P. allius is a polyphagous migratory ectoparasite and a vector for Tobacco rattle virus (TRV). The known distribution of P. allius has previously been limited to the Pacific Northwest, where it was originally described as an important pathogen in potato production (2,3). Corn and wheat have been reported as suitable hosts; although they are not susceptible to TRV, crop loss may result from direct damage to roots (2,3). Nematode management recommendations for corn and wheat will depend on the distribution of this nematode. To our knowledge, this is the first report of P. allius in Ohio. References: (1) W. Decreamer. Rev. Nematol. 3:81, 1980. (2) H. Mojtahedi and G. S. Santo. Am. J. Potato Res. 76:273, 1999. (3) E. Riga et al. Am. J. Potato Res. 84:2, 2007. (4) T. C. Vrain et al. Fundam. Appl. Nematol. 15:563, 1992.

First Report of Lesion Nematode (Pratylenchus vulnus) on Boxwood in Ohio.

Boxwood (Buxus sempervirens L. and other species) is a popular evergreen shrub used in landscaping. In January 2012, three nursery-grown plants of cv. Green Gem boxwood were submitted from Warren County, Ohio to the C. Wayne Ellet Plant and Pest Diagnostic Clinic at The Ohio State University, an Ohio Plant Diagnostic Network laboratory. The plants, established for 4 years, exhibited orange to bronze discoloration of the foliage; foliage was not desiccated and dieback was not evident although stunting was present. Plant root symptoms ranged from nearly complete necrosis to distinct black lesions on living roots. A root scraping showed nematodes present in the lesions. Nematodes were extracted from root and soil subsamples with a Baermann funnel apparatus for 48 h (3). A high number of lesion nematodes (Pratylenchus sp.) were observed from both soil and root samples. Individual nematodes were handpicked and identified under a compound light microscope as Pratylenchus vulnus Allen & Jensen, 1951 according to morphologic and morphometric characteristics (2). Males and females were observed with stylets having rounded knobs, labial regions continuous with the body contour, and three to four lip annuli. The lateral field contained four incisures, with the two inner incisures closer to each other than to the outer ones. The esophagus overlapped the intestine ventrally. Female (n = 12) body length ranged from 410.3 to 654.5 µm (mean 583.0 µm), stylet length from 15.0 to 17.8 µm (mean 16.8 µm), tail length from 23.2 to 37.5 µm (mean 29.2 µm), vulva position from 78.9 to 85.6% (mean 81.7%), dorsal esophageal outlet (DGO) from 2.6 to 3.5 µm (mean 3.1 µm), and with functional oblong spermathecae. De Man ratios were as follows: a = 25.3 to 33.3 (mean 28.4), b = 4.1 to 7.6 (mean 6.0), c = 16.1 to 23.5 (mean 20.1), and c' = 1.8 to 2.6 (mean 2.1). Male (n = 16) body length ranged from 478.0 to 589.0 µm (mean 537.9 µm), stylet length from 15.0 to 17.2 µm (mean 16.2 µm), tail length from 22.7 to 28.1 µm (mean 25.5 µm), spicule from 15.0 to 17.5 µm (mean 16.4 µm), gubernaculum from 3.5 to 4.7 µm (mean 4.0 µm), and DGO from 2.6 to 3.7 µm (mean 3.1 µm). De Man ratios were as follows: a = 26.4 to 36.3 (mean 30.5), b = 5.0 to 7.9 (mean 5.8), c = 19.1 to 23.0 (mean 21.1), and c' = 1.6 to 2.4 (mean 2.0). DNA was extracted from single adult females and the D2-D3 expansion region of the 28S rRNA gene was amplified using forward primer ACAAGTACCGTGAGGGAAAGTTG and reverse primer TCGGAAGGAACCAGCTACTA (4). The PCR product was purified and sequenced. The sequence was deposited in GenBank (Accession No. JQ692308) and was compared with sequences previously deposited in GenBank by means of BLAST search. The comparison revealed a sequence similarity of 98 to 99% with P. vulnus (e.g., GenBank Accession Nos. HM469437.1, EU130886.1, and JQ003994.1). P. vulnus is a known pathogen of boxwood (1). To our knowledge, this is the first report of P. vulnus in Ohio. References: (1) K. R. Barker. Plant Dis. Rep. 58:991, 1974. (2) P. Castillo and N. Vovlas. Pratylenchus (Nematoda: Pratylenchidae): Diagnosis, Biology, Pathogenicity and Management. Koninklijke Brill NV, Leiden, the Netherlands, 2007. (3) D. J. Hooper. In: Laboratory Methods for Work with Plant and Soil Nematodes. J. F. Southey, ed. Reference book 402. Ministry of Agriculture, Fisheries and Food, London, 1986. (4) G. C. Tenente et al. Nematropica 34:1, 2004.

First Report of Meloidogyne marylandi Infecting Bermudagrass in Florida.

Root-knot nematodes (Meloidogyne spp.) are common parasites attacking turfgrasses in the United States, but the species of these nematodes is typically unresolved unless targeted surveys are performed (3). Using morphometric analysis and an RFLP method (3), an investigation of a golf course green in Florida with a history of infestation by root-knot nematodes was conducted to identify the species present. This 'Tifdwarf' bermudagrass (Cynodon dactylon × C. transvaalensis) putting green at the University of Florida Research Unit in Citra, FL, exhibited irregular patches of declining turf. Turf roots in these symptomatic areas had galled root tips with adhering egg masses, characteristic of infection from Meloidogyne spp. Mean populations of 5,149 ± 708 Meloidogyne second stage juveniles per 100 cm3 of soil were extracted from the rhizosphere of these symptomatic plants. Morphological measurements from 20 of these juveniles were slightly less than those published previously for M. marylandi, but were still distinct enough to discriminate them from M. graminis, which commonly infects bermudagrass in Florida (3). Body length averaged 396.1 ± 4.9 (376.7 to 420.0) µm with a mean width of 16.3 ± 0.5 (13.3 to 18.3) µm, stylet lengths were 11.2 ± 0.7 (6.7 to 12.3) µm, tail lengths averaged 54.7 ± 1.9 (47.5 to 65.0) µm with the hyaline region of the tails 9.9 ± 0.7 (8.3 to 14.2) µm. Mature females extracted from symptomatic root tissue lacked a posterior cone-like protuberance of the vulva typical of M. graminis. DNA was extracted from 15 single juveniles using a NaOH digestion method (2). The mitochondrial DNA region was amplified with PCR using the primers C2F3/1108 5'-GGTCAATGTTCAGAAATTTGTGG-3' and 5'-TACCTTTGACCAATCACGCT-3' (3). This resulted in a DNA fragment 520 bp in length, which upon digestion with SspI restriction enzyme produced four bands 148, 103, 91, and 67 bp in length, similar to what has been reported for M. marylandi (3). The PCR products were purified with a QIAquick PCR purification kit (QIAGEN, Valencia, CA) and sequenced at the University of Florida, Cancer Research and Genetics Institute. Sequences were compared with those in GenBank by means of BLAST search. The comparison showed a sequence similarity of 98% with M. marylandi (GenBank Accession No. JN241918.1). Although M. marylandi has been reported on bermudagrass in many areas of the United States and other places throughout the world (1,3,4), to our knowledge, this is the first detection of this nematode in Florida. Further studies will be conducted to determine the prevalence, incidence, severity of damage caused by M. marylandi, and determine a possible mode of dispersal on turfgrasses. References: (1) A. M. Golden. J. Nematol. 21:453, 1989. (2) J. Hübschen et al. Euro. J. Plant Pathol. 110:779, 2004. (3) M. A. McClure et al. Plant Dis. 96:635, 2012. (4) Y. Oka et al. Nematol. 5:727, 2003.