Mediating effects of inequitable gender norms on intimate partner violence and contraceptive use in a cluster randomized control trial in Niger: A causal inference mediation analysis.

Background: Gender inequity, a deeply-rooted driver of poor health globally, is expressed in society through gender norms, the unspoken rules that govern gender-related roles and behavior. The development of public health interventions focused on promoting equitable gender norms are gaining momentum internationally, but there remain critical gaps in the evidence about how these interventions are working to change behavioral outcomes. Methods: A four-arm cluster randomized control trial (cRCT) was conducted to evaluate the effects of the Reaching Married Adolescents in Niger (RMA) intervention on modern contraceptive use and intimate partner violence (IPV) among married adolescent girls and their husbands in Dosso, Niger (T1: 1042 dyads; 24 mos. follow-up: 737 dyads, 2016-2019). This study seeks to understand if changes in perceived inequitable gender norms among husbands are the mechanism behind effects on modern contraceptive use and IPV. We estimated natural direct and indirect effects via these gender norms using inverse odds ratio weighting. An intention-to-treat approach and a difference-in-differences estimator in a hierarchical linear probability model was used to estimate prevalence differences, along with bootstrapping to estimate confidence intervals. Results: The total effects of the RMA small group intervention (Arm 2) is estimated to be an 8% reduction in prevalence of IPV [95% CI: -0.18, 0.01]. For this arm, the natural indirect effect through gender inequitable social norms is associated with a 2% decrease (95% CI: -0.07, 0.12), accounting for 22.3% of this total effect, and the natural direct effect with a 6% decrease (95% CI: -0.20, -0.02) in IPV. Of the total effect of the RMA household visit intervention (Arm 1) on contraceptive use (20% increase), indirect effects via inequitable gender norms were associated with an 11% decrease (95% CI: -0.18, -0.01) and direct effects with a 32% increase (95% CI: 0.13, 0.44) in contraceptive use. For the combination arm, of the total effects on contraceptive use (19% increase), indirect effects were associated with a 9% decrease (95% CI: -0.20, 0.02) and direct effects with a 28% increase (95% CI: 0.12, 0.46). Conclusion: The present study contributes experimental evidence that the small group RMA intervention reduced IPV partially via reductions in perceived inequitable gender norms among husbands. Evidence also suggests that increases in perceived inequitable gender norms resulted in decreased contraceptive use among those receiving the household visit intervention component. Not only do these results open the "black box" around how the RMA small group intervention may create behavior change to help inform its future use, they provide evidence supporting behavior change theories and frameworks that postulate the importance of changing underlying social norms in order to reduce IPV and increase modern contraceptive use.

Fungal Planet description sheets: 154-213.

Novel species of microfungi described in the present study include the following from South Africa: Camarosporium aloes, Phaeococcomyces aloes and Phoma aloes from Aloe, C. psoraleae, Diaporthe psoraleae and D. psoraleae-pinnatae from Psoralea, Colletotrichum euphorbiae from Euphorbia, Coniothyrium prosopidis and Peyronellaea prosopidis from Prosopis, Diaporthe cassines from Cassine, D. diospyricola from Diospyros, Diaporthe maytenicola from Maytenus, Harknessia proteae from Protea, Neofusicoccum ursorum and N. cryptoaustrale from Eucalyptus, Ochrocladosporium adansoniae from Adansonia, Pilidium pseudoconcavum from Greyia radlkoferi, Stagonospora pseudopaludosa from Phragmites and Toxicocladosporium ficiniae from Ficinia. Several species were also described from Thailand, namely: Chaetopsina pini and C. pinicola from Pinus spp., Myrmecridium thailandicum from reed litter, Passalora pseudotithoniae from Tithonia, Pallidocercospora ventilago from Ventilago, Pyricularia bothriochloae from Bothriochloa and Sphaerulina rhododendricola from Rhododendron. Novelties from Spain include Cladophialophora multiseptata, Knufia tsunedae and Pleuroascus rectipilus from soil and Cyphellophora catalaunica from river sediments. Species from the USA include Bipolaris drechsleri from Microstegium, Calonectria blephiliae from Blephilia, Kellermania macrospora (epitype) and K. pseudoyuccigena from Yucca. Three new species are described from Mexico, namely Neophaeosphaeria agaves and K. agaves from Agave and Phytophthora ipomoeae from Ipomoea. Other African species include Calonectria mossambicensis from Eucalyptus (Mozambique), Harzia cameroonensis from an unknown creeper (Cameroon), Mastigosporella anisophylleae from Anisophyllea (Zambia) and Teratosphaeria terminaliae from Terminalia (Zimbabwe). Species from Europe include Auxarthron longisporum from forest soil (Portugal), Discosia pseudoartocreas from Tilia (Austria), Paraconiothyrium polonense and P. lycopodinum from Lycopodium (Poland) and Stachybotrys oleronensis from Iris (France). Two species of Chrysosporium are described from Antarctica, namely C. magnasporum and C. oceanitesii. Finally, Licea xanthospora is described from Australia, Hypochnicium huinayensis from Chile and Custingophora blanchettei from Uruguay. Novel genera of Ascomycetes include Neomycosphaerella from Pseudopentameris macrantha (South Africa), and Paramycosphaerella from Brachystegia sp. (Zimbabwe). Novel hyphomycete genera include Pseudocatenomycopsis from Rothmannia (Zambia), Neopseudocercospora from Terminalia (Zambia) and Neodeightoniella from Phragmites (South Africa), while Dimorphiopsis from Brachystegia (Zambia) represents a novel coelomycetous genus. Furthermore, Alanphillipsia is introduced as a new genus in the Botryosphaeriaceae with four species, A. aloes, A. aloeigena and A. aloetica from Aloe spp. and A. euphorbiae from Euphorbia sp. (South Africa). A new combination is also proposed for Brachysporium torulosum (Deightoniella black tip of banana) as Corynespora torulosa. Morphological and culture characteristics along with ITS DNA barcodes are provided for all taxa.

Phylogeny and taxonomic revision of the Planistromellaceae including its coelomycetous anamorphs: contributions towards a monograph of the genus Kellermania.

The core species of the family Planistromellaceae are included in the teleomorphic genera Planistroma and Planistromella and the connected anamorphic, coelomycetous genera Alpakesa, Kellermania, and Piptarthron. These genera have been defined primarily on the basis of ascospore septation or number of conidial appendages. Due to a lack of DNA sequence data, phylogenetic placement of these genera within the Dothideomycetes, evaluation of monophyly, and questions about generic boundaries could not be adequately addressed in the past. Isolates of nearly all of the known species in these genera were studied genetically and morphologically. DNA sequence data were generated for the nSSU, ITS, nLSU, and RPB1 markers and analysed phylogenetically. These results placed the Planistromellaceae, herein recognised as a distinct family, in an unresolved position relative to other genera within the order Botryosphaeriales. Species representing the core genera of the Planistromellaceae formed a clade and evaluation of its topology revealed that previous morphology-based definitions of genera resulted in an artificial classification system. Alpakesa, Kellermania, Piptarthron, Planistroma, and Planistromella are herein recognised as belonging to the single genus Kellermania. The following new combinations are proposed: Kellermania crassispora, K. dasylirionis, K. macrospora, K. plurilocularis, and K. unilocularis. Five new species are described, namely K. con- fusa, K. dasylirionicola, K. micranthae, K. ramaleyae, and K. rostratae. Descriptions of species in vitro and a key to species known from culture are provided.

Fungal Planet description sheets: 128-153.

Novel species of microfungi described in the present study include the following from Australia: Catenulostroma corymbiae from Corymbia, Devriesia stirlingiae from Stirlingia, Penidiella carpentariae from Carpentaria, Phaeococcomyces eucalypti from Eucalyptus, Phialophora livistonae from Livistona, Phyllosticta aristolochiicola from Aristolochia, Clitopilus austroprunulus on sclerophyll forest litter of Eucalyptus regnans and Toxicocladosporium posoqueriae from Posoqueria. Several species are also described from South Africa, namely: Ceramothyrium podocarpi from Podocarpus, Cercospora chrysanthemoides from Chrysanthemoides, Devriesia shakazului from Aloe, Penidiella drakensbergensis from Protea, Strelitziana cliviae from Clivia and Zasmidium syzygii from Syzygium. Other species include Bipolaris microstegii from Microstegium and Synchaetomella acerina from Acer (USA), Brunneiapiospora austropalmicola from Rhopalostylis (New Zealand), Calonectria pentaseptata from Eucalyptus and Macadamia (Vietnam), Ceramothyrium melastoma from Melastoma (Indonesia), Collembolispora aristata from stream foam (Czech Republic), Devriesia imbrexigena from glazed decorative tiles (Portugal), Microcyclospora rhoicola from Rhus (Canada), Seiridium phylicae from Phylica (Tristan de Cunha, Inaccessible Island), Passalora lobeliae-fistulosis from Lobelia (Brazil) and Zymoseptoria verkleyi from Poa (The Netherlands). Valsalnicola represents a new ascomycete genus from Alnus (Austria) and Parapenidiella a new hyphomycete genus from Eucalyptus (Australia). Morphological and culture characteristics along with ITS DNA barcodes are also provided.

First Report of Leaf Rust of Blueberry Caused by Thekopsora minima in Mexico.

Blueberry (Vaccinium corymbosum L.) is becoming an important crop in the states of Jalisco and Michoacan in Mexico. Leaf rust, a disease causing extensive defoliation on plants with severe infections, was observed in the autumn of 2007 and it has become one of the most significant diseases of blueberry in these states. Symptoms on the upper surfaces of leaves appear as small, yellow spots that later turn necrotic as they enlarge and coalesce and eventually cover large areas of individual leaves. On the undersides of leaves, small flecks surrounded by small water-soaked halos appear, turn yellow, and produce powdery sori that are uredinia with urediniospores. Uredinia were hypophyllous, scattered to gregarious and at times superficially appearing confluent, up to about 300 µm in diameter, dome shaped and peridium hemispherical in cross section, orangish, becoming pulverulent, lacking obviously enlarged, well-differentiated ostiolar cells. Urediniospores were subglobose, obovate, oblong or ellipsoid, 17.6 to 27.2 × 12.8 to 17.6 µm, with hyaline, echinulate walls that are 1.2 to 1.8 µm thick, and with yellow-to-hyaline contents. Telia were not observed. On the basis of uredinial morphology (3,4), the rust was identified as Thekopsora minima P. Syd. & Syd. To distinguish this rust from other rust species causing disease on Vaccinium (2,3), a 1,414-bp region consisting of ITS2 and the 5' end of the 28S was amplified with primers Rust2inv/LR6 from uredinial lesions on infected leaves of V. corymbosum 'Biloxi' and sequenced (BPI 880580; GenBank Accession No. HM439777) (1). Results of a BLAST search of GenBank found 100% (1,414 of 1,414) identity to T. minima (GenBank Accession No. GU355675) from South Africa (3). Pathogenicity tests were completed as follows: (i) during the autumn of 2009, rusted leaves of cvs. Biloxi and Sharpblue were collected from the field; (ii) mature leaves from healthy plants of both blueberry cultivars were surface disinfested with 1% sodium hypochlorite for 2 min and rinsed with sterile distilled water; (iii) fresh urediniospores from rusted leaves were brushed directly onto the undersides of disinfested detached leaves; (iv) to avoid drying, wet cotton balls were placed on the petioles of inoculated leaves that were subsequently placed in resealable plastic bags; and (v) leaves were then incubated in a growth chamber at 22°C with a 12-h photoperiod. For each cultivar, 20 leaves were inoculated and five uninoculated leaves were included as controls and the test was repeated once. Yellow uredinia were observed 13 and 10 days after inoculation in cvs. Biloxi and Sharpblue, respectively. Leaf symptoms and uredinial characters were the same as observed previously in the field. To our knowledge, this is the first report of T. minima in Mexico. This report is significant for growers who need a diagnosis to control the disease and for breeders and plant pathologists who should consider developing more resistant cultivars. References: (1) M. C. Aime. Mycoscience 47:112, 2006. (2) F. L. Caruso and D. C. Ramsdell, eds. Compendium of Blueberry and Cranberry Diseases. The American Phytopathological Society, St. Paul, MN, 1995. (3) L. Mostert et al. Plant Dis. 94:478, 2010. (4) P. Sydow and H. Sydow. Monographia Uredinearum. Vol. III. Fratres Borntraeger, Leipzig, Germany, 1915.

Asperisporium and Pantospora (Mycosphaerellaceae): epitypifications and phylogenetic placement.

The species-rich family Mycosphaerellaceae contains considerable morphological diversity and includes numerous anamorphic genera, many of which are economically important plant pathogens. Recent revisions and phylogenetic research have resulted in taxonomic instability. Ameliorating this problem requires phylogenetic placement of type species of key genera. We present an examination of the type species of the anamorphic Asperisporium and Pantospora. Cultures isolated from recent port interceptions were studied and described, and morphological studies were made of historical and new herbarium specimens. DNA sequence data from the ITS region and nLSU were generated from these type species, analysed phylogenetically, placed into an evolutionary context within Mycosphaerellaceae, and compared to existing phylogenies. Epitype specimens associated with living cultures and DNA sequence data are designated herein. Asperisporium caricae, the type of Asperisporium and cause of a leaf and fruit spot disease of papaya, is closely related to several species of Passalora including P. brachycarpa. The status of Asperisporium as a potential generic synonym of Passalora remains unclear. The monotypic genus Pantospora, typified by the synnematous Pantospora guazumae, is not included in Pseudocercospora sensu stricto or sensu lato. Rather, it represents a distinct lineage in the Mycosphaerellaceae in an unresolved position near Mycosphaerella microsora.

Immigration and sexual partner risk among Latino adolescents in San Francisco.

Sexual partner characteristics increase risk for adverse reproductive health outcomes. Evidence is limited regarding whether choice of sexual partners among Latino adolescents changes with U.S. acculturation/adaptation. We used generalized estimating equations to assess the associations between immigrant generation (recent immigrant, 1.5 [immigrated prior to adolescence], 2nd and 3rd) and sexual partner risk in a prospective cohort study of 411 Latino adolescents aged 14-19. We examined three measures of partner risk and mediating effects of family influence (familism and parental monitoring). The odds of reporting a partner with frequent substance use increased with increasing immigrant generation (odds ratios (OR) [reference = recent immigrants]: 2.3, 3.4, and 5.6) as did having a partner who was in a gang/incarcerated (OR [reference = recent immigrants]: 2.4, 3.6, and 5.7). Though the odds of having high-risk partners decreased with higher parental monitoring, neither family influence measure mediated these relationships. Findings underscore the need for a prevention focus on partner choice with attention to increased risk with increasing U.S. generation.

Uromyces ciceris-arietini, the Cause of Chickpea Rust: New Hosts in the Trifolieae, Fabaceae.

Uromyces ciceris-arietini has been reported on Cicer arietinum (chickpea) and Medicago polyceratia. Plants of Medicago polymorpha in Riverside and San Diego, CA were collected with severe rust caused by U. ciceris-arietini. To confirm the identification and potential new host range, a monouredinial isolate of U. ciceris-arietini from M. polymorpha was inoculated on eight accessions each of C. arietinum and M. polyceratia. All plants showed symptoms of the disease. Consequently, a range of fabaceous hosts were evaluated for their reaction to U. ciceris-arietini. New hosts for U. ciceris-arietini included 29 species of Medicago, specifically M. arabica, M. blancheana, M. ciliaris, M. constricta, M. coronata, M. doliata, M. granadensis, M. intertexta, M. italica, M. laciniata, M. lanigera, M. lesinsii, M. lupulina, M. minima, M. murex, M. muricoleptis, M. orbicularis, M. praecox, M. radiata, M. rigidula, M. rotata, M. rugosa, M. sativa, M. sauvagei, M. scutellata, M. soleirolii, M. tenoreana, M. truncatula, and M. varia, and three species of Melilotus, specifically M. italicus, M. speciosus, and M. spicatus. This isolate of U. ciceris-arietini produced no symptoms on plants in the 33 accessions tested in the genera Anthyllis, Astragalus, Lotus, and Lupinus. DNA sequences are provided to aid in the identification of this pathogen.

First Report of Powdery Mildew Caused by Podosphaera leucotricha on Callery Pear in North America.

Callery pear, often referred to as Bradford pear, is a species native to China that is planted throughout North America as an ornamental tree for its white flowers in spring, bright colored foliage in autumn, and resistance to disease. In some regions it is becoming an invasive species that is replacing native trees. In May 2009, leaves of Pyrus calleryana 'Cleveland Select' showing distortion and signs of powdery mildew were collected in Columbia (Howard County), Maryland. A survey of the surrounding area found numerous similarly diseased trees of this cultivar. Microscopic observation of the leaves revealed a fungus with an Oidium anamorph having nipple-shaped appressoria; conidiophores erect, foot cells cylindric, straight, of terminal origin, 41 to 55 × 9.5 to 12.5 µm, with the following cells present in variable numbers; conidia catenulate, broadly ellipsoid to rarely slightly ovoid, 22 to 27 × 11 to 17 µm, with fibrosin bodies. Chasmothecia were absent. On the basis of morphology and host, the fungus was identified as Podosphaera leucotricha (Ellis & Everh.) E.S. Salmon (Leotiomycetes, Erysiphales) (1). The specimen on P. calleryana was deposited in the U.S. National Fungus Collections as BPI 879141. Additional confirmation resulted from a comparison of internal transcribed spacer (ITS) region DNA sequence data (GenBank Accession No. GU122230) obtained with the custom designed primer, Podoprimer Forward (5'-3' ACTCGTTCTGCGCGGCTGAC), and the ITS4 primer. The sequence of the fungus on Callery pear was identical to available GenBank sequences of P. leucotricha. P. leucotricha is the etiological agent of a powdery mildew disease that occurs on rosaceous plants, primarily Malus and Pyrus. This fungus occurs nearly worldwide (1), and the pathology of the disease on Callery pear is similar to that of known hosts (1,4). To our knowledge, this is the first report of P. leucotricha on Pyrus calleryana in North America. P. leucotricha has been reported previously only once on Callery pear, Pyrus calleryana 'Chanticleer', in Hungary (4). Additionally, the powdery mildew fungus was heavily parasitized by Ampelomyces quisqualis Ces. sensu lato, a cosmopolitan coelomycetous mycoparasite of the Erysiphales that is well known on this species (2,3). ITS region DNA sequence data from the Ampelomyces (GenBank Accession No. GU122231) obtained with the ITS1 and ITS4 primers was identical to that of other isolates parasitic on P. leucotricha (2). References: (1) U. Braun. The Powdery Mildews (Erysiphales) of Europe. Gustav Fischer Verlag, Jena, Germany, 1995. (2) C. Liang et al. Fungal Divers. 24:225, 2007. (3) B. C. Sutton. The Coelomycetes. Fungi Imperfecti with Pycnidia, Acervuli and Stromata. Commonwealth Mycological Institute, Kew, England, 1980. (4) L. Vajna and L. Kiss. Plant Dis. 92:176, 2008.

First Report of Uromyces acuminatus on Honckenya peploides, the Endangered Seabeach Sandwort.

Honckenya peploides (L.) Ehrh. (Caryophyllaceae), commonly known as seabeach sandwort, is a species of special concern in Connecticut (4). Nearly an entire population of H. peploides in New London County, CT was found to be severely infected by the aecial stage of a rust fungus in June of 2008. Representative plants in the population were infected with aecia on more than 50% of the leaves. Aecia were amphigenous, gregarious, cupulate, pulverulent, yellowish, and erumpent with a hyaline to whitish peridium having a lacerate, somewhat recurved margin. Peridial cells were rhomboidal, 26 to 31 × 25 to 29 µm, smooth to finely verrucose. Aeciospores were globose to ellipsoid, 23.5 to 29 × 20.5 to 22 µm, hyaline to pale yellowish with a verrucose surface and hyaline walls 1.5 to 2 µm thick. Morphological characters corresponded to a reference specimen (BPI 000105) of the aecial stage of Uromyces acuminatus Arthur from Nova Scotia, as well as published descriptions (1,2). Subsequently, telia of U. acuminatus were discovered on Spartina patens (Aiton) Muhl. (Poaceae) in May of 2009 in New London County, CT. Telia were adaxial, intercostal, scattered to gregarious, linear and at times elongate, dark brown to black, pulverulent, and erumpent. Teliospores were obovate to ellipsoid with rounded to acuminate apices rarely having two points, 30 to 41 × 19 to 24 µm, with a smooth surface and brownish-yellow to brown walls 9 to 14 µm thick at apex, which is sometimes paler, and 1 to 3 µm thick laterally, pedicels with a portion persisting on the teliospore that is up to 82 µm long and brownish-yellow. The ITS2 and 5' region of the 28S rDNA (998 bp) from the rust on H. peploides (GenBank Accession No. GU109282, BPI 879300) and the rust on S. patens (GenBank Accession No. GU058008, BPI 879285B) were sequenced to confirm the identification of U. acuminatus on H. peploides with the resulting sequences identical. U. acuminatus is widespread in the eastern United States and Canada (1-3). The telial stage is found on Spartina spp., while the aecial stage is found on numerous taxa including members of the Asparagaceae (formerly Ruscaceae, Liliaceae), Caryophyllaceae, Polemoniaceae, and Primulaceae (1-3). Puccinia arenariae (Schumach.) G. Winter, previously reported from H. peploides (4), is microcyclic and stages 0, I, and II are unknown. To our knowledge, this is the first report of U. acuminatus on the genus Honckenya. This report has significance to natural resource conservation managers and scientists working in endangered plant habitats because H. peploides and H. peploides subsp. robusta are listed as plants of special concern or endangered/extirpated in Connecticut, Maryland, New Hampshire, and Rhode Island (4). References: (1) J. C. Arthur. Order Uredinales. N. Am. Flora 7(3):161, 1912. (2) G. B. Cummins. The Rust Fungi of Cereals, Grasses and Bamboos. Springer-Verlag, New York, 1971. (3) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Mycology and Microbiology Laboratory. Online publication. ARS, USDA, 2009. (4) USDA, NRCS. The PLANTS Database. Online publication. National Plant Data Center, Baton Rouge, LA, 2009.

First Report of Japanese Apple Rust Caused by Gymnosporangium yamadae on Malus spp. in North America.

Plants in the genus Malus Mill. are grown in temperate regions for fruit crops such as apple and ornamental landscape plants such as flowering crab apple. Gymnosporangium yamadae Miyabe ex G. Yamada, cause of Japanese apple rust, is known to attack economically important species of Malus in Asia. In August 2004 and July 2008, the aecial stage of a rust fungus was observed in Wilmington, DE and nearby in Media, PA on leaves of toringo crab apple (Malus toringo (Siebold) Siebold ex de Vriese), a cultivated plant native to Asia. On the basis of morphological and molecular characteristics, the fungus was identified as G. yamadae. This pathogen has not been previously reported in North America. The identification was confirmed by morphological comparisons with specimens of G. yamadae from Asia and descriptions (1-3) as well as using the D1/D2 domain of 28S rDNA sequence data G. clavariiforme (GenBank Accession No. AR426211), G. clavipes (GenBank Accession No. DQ354545), G. cornutum (GenBank Accession No. AF426210), G. juniperi-virginianae (GenBank Accession Nos. AF522167, AY629316, and DQ354547), G. libocedri (GenBank Accession No. AF522168), G. sabinae (GenBank Accession Nos. AF426209 and AY512845) and G. yamadae (GenBank Accession Nos. FJ559373 and FJ559375). The specimens from North America included aecia of G. yamadae that are foliicolous, hypophyllous, roestelioid, and 4 to 7 mm high. The peridia are yellow-brown to brown and cornute to tubular with a closed brown tip at the apex and lacerate sides; the peridial remains often form a reticulate pattern. The peridial cells are long-narrow rhomboid, 83 to 120 µm long with smooth outer walls and verrucose to echinulate inner and side walls. The aeciospores are globose, 18 to 28 × 19 to 29 µm, with a slightly coronate surface and brown-yellow walls 2 to 3 µm thick. The telia known on Juniperus spp. were not observed. The specimens were deposited in the U.S. National Fungus Collections (BPI 878846, BPI 878847, BPI 878848, and BPI 878849). The 28S rDNA sequence of G. yamadae from BPI 878849 was deposited in GenBank as Accession No. FJ455091. Aecia of G. juniperi-virginianae, cause of cedar apple rust, differ from G. yamadae in having recurved peridial walls at maturity. References: (1) F. D. Kern. A Revised Taxonomic Account of Gymnosporangium. Pennsylvania State University Press, University Park, PA, 1973. (2) S. K. Lee and M. Kakishima. Mycoscience 40:109, 1999. (3) S. K. Lee and M. Kakishima. Mycoscience 40:121. 1999.

Gang exposure and pregnancy incidence among female adolescents in San Francisco: evidence for the need to integrate reproductive health with violence prevention efforts.

Among a cohort of 237 sexually active females aged 14-19 years recruited from community venues in a predominantly Latino neighborhood in San Francisco, California, the authors examined the relation between gang exposure and pregnancy incidence over 2 years of follow-up between 2001 and 2004. Using discrete-time survival analysis, they investigated whether gang membership by individuals and partners was associated with pregnancy incidence and determined whether partnership characteristics, contraceptive behaviors, and pregnancy intentions mediated the relation between gang membership and pregnancy. Pregnancy incidence was determined by urine-based testing and self-report. Latinas represented 77% of participants, with one in five born outside the United States. One quarter (27.4%) became pregnant over follow-up. Participants' gang membership had no significant effect on pregnancy incidence (hazard ratio = 1.25, 95% confidence interval: 0.54, 3.45); however, having partners who were in gangs was associated with pregnancy (hazard ratio = 1.90, 95% confidence interval: 1.09, 3.32). The male partner's perceived pregnancy intentions and having a partner in detention each mediated the effect of partner's gang membership on pregnancy risk. Increased pregnancy incidence among young women with gang-involved partners highlights the importance of integrating reproductive health prevention into programs for gang-involved youth. In addition, high pregnancy rates indicate a heightened risk for sexually transmitted infections.

Pluteus aurantipes sp. nov. from Wisconsin, United States.

Pluteus aurantipes sp. nov. was discovered in Wisconsin, United States. This agaric species is characterized by its yellowish brown pileus, reddish orange stipe, pileipellis consisting of a trichoderm and lack of pleurocystidia.

Effectiveness of female controlled barrier methods in preventing sexually transmitted infections and HIV: current evidence and future research directions.

OBJECTIVES: To evaluate evidence for the effectiveness of female controlled physical and chemical barrier methods in preventing STI/HIV transmission, to examine recent reviews on microbicide development, and to highlight promising research directions. To discuss challenges in conducting effectiveness research and in translating results to public health intervention. METHODS: Systematic review of articles that examined the disease prevention effectiveness of at least one female controlled barrier method. Review of conference abstracts that presented clinical and preclinical microbicide data. RESULTS: Randomised controlled trials provide evidence that female condoms confer as much protection from STIs as male condoms. Observational studies suggest that the diaphragm protects against STI pathogens. Several microbicide effectiveness studies are under way and new directions, such as adaptation of therapeutic agents as preventive products, are being examined. Substantial attention is now given to product formulation and novel delivery strategies. Combining microbicide products with different mechanisms of action as well as combining chemical and physical barriers will be necessary to maximise prevention effectiveness. CONCLUSIONS: Increased investment in the development and identification of female controlled barrier methods offers promise that additional products will be available in the years ahead. Generalizing trial results to a community setting, promoting products that may be less effective than male condoms, and bringing an effective product to scale introduce public health challenges that warrant attention. The need for female controlled barrier methods that provide women with the opportunity to take an active role in reducing their STI/HIV risk are urgently needed and constitute an essential tool to prevent continued spread of these infections.

Reliability of adolescents' self-reported sexual behavior: a comparison of two diary methodologies.

PURPOSE: To evaluate techniques for measuring high-risk sexual behaviors by comparing the reliability and acceptability of two daily sexual behavior diary modes: a written calendar and an automated telephone interview. METHODS: This randomized controlled study included 105 sexually active female adolescents aged 15-19 years recruited from among teens seeking reproductive health care services at a family planning clinic in the San Francisco Bay Area. Participants completed a standardized sexual behavior questionnaire each day for 4 weeks. Contraceptive use by method type was recorded. Reporting differences between the two diary modes were assessed using generalized estimating equations, concordance of diary and retrospective interview responses was evaluated using kappa statistics, and contingency table analysis and Poisson regression models were constructed to examine mode acceptability. RESULTS: Respondents randomized to the telephone diary cohort reported less frequent use of barrier contraceptive methods, specifically less spermicide use (odds ratio 0.27, 95% confidence interval 0.08, 0.95), and decreasing male condom use over time, whereas reports of male condom use increased for written diary respondents (p = .007). Participant characteristics associated with diary acceptability, defined as the frequency of diary completion, were assessed and teens classified as higher risk provided fewer diary reports (p < .01). Regardless of mode completed, 65% of respondents believed the telephone diary would be preferable to the written diary for most teens. CONCLUSIONS: The automated telephone diary offered an acceptable, even preferred, methodologic alternative to the written diary calendar and elicited more accurate reporting of selected contraceptive behavior.

Choice of female-controlled barrier methods among young women and their male sexual partners.

CONTEXT: Little is known about the factors associated with the choice of female-controlled, over-the-counter barrier contraceptive methods among women and their male sexual partners. METHODS: Predictors of method choice were assessed following an educational presentation on contraceptive use and risk reduction among 510 sexually active females aged 15-30 who were recruited in the San Francisco Bay Area. In addition, the primary partners of 160 of these women participated in the survey RESULTS: Twenty-two percent of women who enrolled in the study alone, 25% of those who enrolled with their main partner and 18% of these male partners chose female-controlled, over-the-counter barrier methods alone. The strongest predictor of this choice was current use of a hormonal contraceptive both for women who participated in the study on their own (odds ratio, 2.1) and for those who enrolled their partner in the study (odds ratio, 6.3). Female-controlled methods were also chosen significantly more often by teenagers than by older women; for example, among those who enrolled with a male partner, the odds ratio for selection of a female-controlled barrier method by women younger than 18 was 6.0. Among women who enrolled without a partner, those who had had multiple partners in the previous six months and those who were current users of male condoms were less likely to choose female-controlled methods (odds ratios, 0.7 and 0.5, respectively). CONCLUSIONS: Although the majority of participants did not choose female-controlled, over-the-counter barrier methods without also choosing male condoms, such female-controlled methods appear to offer an acceptable alternative for prevention of sexually transmitted infections. They may be a particularly attractive option for individuals using hormonal contraceptives and for teenage women.

Reproductive health differences among Latin American- and US-born young women.

Investigations of reproductive health within Latinos living in the United States suggest that sexual behaviors and contraception use practices vary by ethnicity and between foreign- and US-born adolescents. This article compares high-risk sexual behaviors and reproductive health among foreign-born Latinas, US-born Latinas, and US-born non-Latinas aged 15-24 years. We recruited 361 females from reproductive health clinics in the San Francisco Bay Area of California between 1995 and 1998; these women completed an interview that assessed sexual risk behaviors and history of pregnancy, abortion, and sexually transmitted infections. Current chlamydial and gonococcal infections were detected through biological testing. Among participants aged 15-18 years, US-born Latinas were more likely to have been pregnant (odds ratio [OR] comparing US-born Latinas and US-born non-Latinas = 3.9, 95% confidence interval [CI] 1.3, 11.4), whereas among respondents aged 19-24 years, foreign-born Latinas were more likely to have been pregnant than US-born Latinas (OR = 11.3, 95% CI 1.0, 130.8) and US-born non-Latinas (OR = 64.2, 95% CI 9.9, 416.3). US-born Latinas were most likely to have had an abortion (OR comparing US-born Latinas and US-born non-Latinas = 2.0, 95% CI 0.9, 4.7). They were also most likely to have chlamydial infection at study enrollment (8.2% prevalence compared to 2.2% and 1.0%for foreign-born Latinas and US-born non-Latinas, respectively; P =.009). Reproductive health differences between foreign and US-born females and within the US-born population warrant further examination and highlight the need for targeted prevention.