RESUMO
The extensive use of chemical pesticides, such as herbicides, has resulted in significant environmental pollution. Microbial degradation represents a crucial approach for managing this pesticide-associated pollution, with enrichment culturing serving as a method for isolating pesticide-degrading microorganisms. However, the efficiency of this strategy is limited, often yielding only a few isolated strains. In this study, a new mineral salt medium (MSM) was developed, and a high-throughput method was used for screening pendimethalin-degrading bacteria by measuring the bacterial growth in the MSM. The utilization of this method resulted in the isolation of 56 pendimethalin-degrading bacteria from approximately 2 000 bacterial strains, including 37 Bacillus spp., 10 Alcaligenes spp., 5 Pseudomonas spp., and other 4 strains identified for the first time as pendimethalin-degrading strains. This method may hold promise not only for isolating bacterial strains capable of degrading other pesticides but also for facilitating the utilization of the substantial bacterial strains stored in bacterial banks.
RESUMO
Root-knot nematodes (RKNs) are distributed globally, including in agricultural fields contaminated by heavy metals (HM), and can cause serious crop damages. Having a method that could control RKNs in HM-contaminated soil while limit HM accumulation in crops could provide significant benefits to both farmers and consumers. In this study, we showed that the nematophagous fungus Purpureocillium lavendulum YMF1.683 exhibited a high nematocidal activity against the RKN Meloidogyne incognita and a high tolerance to CdCl2. Comparing to the P. lavendulum YMF1.838 which showed low tolerance to Cd2+, strain YMF1.683 effectively suppressed M. incognita infection and significantly reduced the Cd2+ uptake in tomato root and fruit in soils contaminated by 100 mg/kg Cd2+. Transcriptome analyses and validation of gene expression by RT-PCR revealed that the mechanisms contributed to high Cd-resistance in YMF1.683 mainly included activating autophagy pathway, increasing exosome secretion of Cd2+, and activating antioxidation systems. The exosomal secretory inhibitor GW4869 reduced the tolerance of YMF1.683 to Cd2+, which firstly demonstrated that fungal exosome was involved in HM tolerance. The up-regulation of glutathione synthesis pathway, increasing enzyme activities of both catalase and superoxide dismutase also played important roles in Cd2+ tolerance of YMF1.683. In Cd2+-contaminated soil, YMF1.683 limited Cd2+-uptake in tomato by up-regulating the genes of ABCC family in favor of HM sequestration in plant, and down-regulating the genes of ZIP, HMA, NRAMP, YSL families associated with HM absorption, transport, and uptake in plant. Our results demonstrated that YMF1.683 could be a promising bio-agent in eco-friendly management of M. incognita in Cd2+ contaminated soils.
Assuntos
Hypocreales , Metais Pesados , Tylenchoidea , Humanos , Animais , Cádmio/análise , Tylenchoidea/metabolismo , Tylenchoidea/microbiologia , Metais Pesados/análise , Hypocreales/metabolismo , SoloRESUMO
Introduction: Tobacco root-knot nematode (RKN) is a highly destructive soil-borne disease worldwide. However, there is a lack of research on the relationship between RKN and tobacco root microbial community composition under large-scale geographical conditions in China. Methods: In this study, we collected 65 samples from 28 main tobacco-growing areas across 10 provinces in China and conducted 16S rDNA sequencing to investigate the dynamic microbial changes in tobacco soil infected by RKN compared to healthy tobacco soil. Based on the analysis of rhizosphere soil bacterial communities, changes after RKN infection, and soil environmental factors. Results: We found the 28 tobacco-growing areas could be divided into two distinct groups with different microbial compositions and varying responses to RKN infection. In group1 of the provinces of Anhui, Henan, Shanxi, and Heilongjiang, Vicinamibacteria dominated the bacterial community, while Acidobacteriae was present in low abundance. In contrast, group2 of the other six provinces (Yunnan, Guizhou, Chongqing, Guangxi, Hubei, and Shandong) exhibited an opposite pattern. After infected by RKN, the genera Chitinophaga increased significant in group 1, while the genera Rhodococcus in group 2 exhibited a substantial increase. Alpha-diversity analysis revealed that RKN-infected tobacco exhibited a richer and more diverse rhizosphere soil bacterial community compared to healthy tobacco in most growing areas. A total of 12 kinds of soil environmental factors were measured in healthy and RKN-infected tobacco soil, and based on the co-occurrence and correlation analysis between environmental factors and microbial species, the pH level, calcium (Ca), magnesium (Mg), phosphorus (P), iron (Fe), and sodium (Na) were identified as key environmental factors influencing the population composition of rhizosphere microorganisms during RKN infection. We observed that RKN infection further increased the pH in weakly alkaline group 1 soil, while weakly acidic group 2 soil experienced a further decrease in pH. Furthermore, we identified three genera as potential biocontrol or plant growth-promoting bacteria for tobacco. Discussion: These findings provide valuable reference data for managing RKN disease in different tobacco-growing areas and contribute to the exploration of new and effective biological control methods.
RESUMO
Species of Trichoderma are widely distributed around the world. In this study, two new species in Trichoderma, named as T.albidum and T.variegatum, were introduced and illustrated. These species were isolated from diseased tubers of Gastrodiaelata in China and identified based on morphological characteristics and multi-gene sequence analyses of three loci that is the internal transcribed spacer regions of the ribosomal DNA (ITS), the translation elongation factor 1-α encoding gene (tef1-α) and the gene encoding the second largest nuclear RNA polymerase subunit (rpb2). Distinctions between the new species and their close relatives were discussed. According to results of the phylogenetic analyses, T.albidum belonged to the Harzianum clade and T.variegatum are grouped with species of the Spirale clade. The expansion of two clades provided research foundations for the prevention and control of tuber diseases in G.elata.
RESUMO
Dactylellina haptotyla is a typical nematode-trapping fungus that has garnered the attention of many scholars for its highly effective lethal potential for nematodes. Secondary metabolites play an important role in D. haptotyla-nematode interactions, but which metabolites perform which function remains unclear. We report the metabolic functions based on high-quality, chromosome-level genome assembly of wild D. haptotyla YMF1.03409. The results indicate that a large variety of secondary metabolites and their biosynthetic genes were significantly upregulated during the nematode-trapping stage. In parallel, we identified that 2-furoic acid was specifically produced during nematode trapping by D. haptotyla YMF1.03409 and isolated it from fermentation production. 2-Furoic acid demonstrated strong nematicidal activity with an LD50 value of 55.05 µg/mL against Meloidogyne incognita at 48 h. Furthermore, the pot experiment showed that the number of galls of tomato root was significantly reduced in the experimental group treated with 2-furoic acid. The considerable increase in the 2-furoic acid content during the infection process and its virulent nematicidal activity revealed an essential synergistic effect during the process of nematode-trapping fungal infection. IMPORTANCE Dactylellina haptotyla have significant application potential in nematode biocontrol. In this study, we determined the chromosome-level genome sequence of D. haptotyla YMF1.03409 by long-read sequencing technology. Comparative genomic analysis identified a series of pathogenesis-related genes and revealed significant gene family contraction events during the evolution of D. haptotyla YMF1.03409. Combining transcriptomic and metabolomic data as well as in vitro activity test results, a compound with important application potential in nematode biocontrol, 2-furoic acid, was identified. Our result expanded the genetic resource of D. haptotyla and identified a previously unreported nematicidal small molecule, which provides new options for the development of plant biocontrol agents.
RESUMO
Members of Didymellaceae have a wide geographical distribution throughout different ecosystems, and most species are associated with fruit, leaf, stem and root diseases of land plants. However, species that occur in aquatic plants are not clearly known. During a survey of the diversity of endophytes in aquatic plants in Yunnan, Sichuan, and Guizhou provinces, we obtained 51 isolates belonging to Didymellaceae based on internal transcribed spacer region (ITS) sequences. Further, the phylogenetic positions of these isolates were determined by combined sequences composed of ITS, partial large subunit nrRNA gene (28S nrDNA; LSU), RNA polymerase II second largest subunit (rpb2) and partial beta-tubulin gene (tub2). Combining morphological characteristics and multi-locus phylogenetic analyses, two new varieties belong to Boeremia and 12 new species distributed into seven genera were recognized from 51 isolates, i.e., Cumuliphoma, Didymella, Dimorphoma, Ectophoma, Leptosphaerulina, Remotididymella, and Stagonosporopsis. Among these species, only one species of Stagonosporopsis and two species of Leptosphaerulina show teleomorphic stages on OA, but have no anamorphic state. Each new species is described in detail, and the differences between new species and their phylogenetically related species are discussed here. The high frequency of new species indicates that aquatic plants may be a special ecological niche which highly promotes species differentiation. At the same time, the frequent occurrence of new species may indicate the need for extensive investigation of fungal resources in those aquatic environments where fungal diversity may be underestimated.
RESUMO
The complete mitochondrial genome of Drechslerella dactyloides was characterized in this study. This mitogenome is a closed circular molecule of 246860 bp in length with a GC content of 26.16%, including 87 predicted protein-coding genes, 29 transfer RNA genes, and two rRNA gens. Phylogenetic analyses based on concatenated amino acid sequences at 14 conserved mitochondrial protein-coding genes showed that D. dactyloides was closely related to Dactylellina haptotyla.
RESUMO
Brevundimonas diminuta is broadly distributed in terrestrial and aquatic environments and has various biological activities. In this study, we found that B. diminuta exhibited nematicidal activity against the plant root-knot nematode, Meloidogyne javanica. A total of 42 volatile organic compounds (VOCs) from B. diminuta were identified using gas chromatography-mass spectrometry (GC-MS). The nematicidal activity of the 10 main VOCs was tested against M. javanica. Butyl butanoate (4 µL) caused the mortality of 80.13% of M. javanica after 4 h. The nematicidal activity of an additional 38 butyl-butyrate-like volatile esters was also investigated. Of these, seven had strong nematicidal activity against M. javanica, five of which showed egg-hatching inhibitory activity. This study is the first to report that butyl butanoate, ethyl 2-methylbutanoate, ethyl 4-methylpentanoate, ethyl pent-4-enoate, and methyl undecanoate have nematicidal activity against M. javanica. The results indicated that B. diminuta could serve as a candidate microorganism for the biocontrol of plant root-knot nematodes, showing that volatile esters have great potential as nematicides.
RESUMO
The mushroom industry produces a large amount of spent mushroom substrate (SMS), which requires a large geographical footprint and causes pollution. Vermicomposting is a low-cost technology for its value in recycling of organic wastes and production of beneficial organic fertilizers. In this study, the changes of physicochemical properties was characterized during vermicomposting of Pleurotus eryngii SMS with cow dung (CD) as amendment. The efficiency and possible mechanisms of vermicompost suppressing disease induced by Meloidogyne incognita was also investigated. Six combinations with different ratios of SMS and cow dung (CD) was included in the vermicomposting using Eisenia fetida. Effect of vermicompost against disease induced by M. incognita on tobacco was conducted under greenhouse condition. And the possible mechanisms of vermicompost suppressing M. incognita was investigated by evaluated the species diversity of nematode-trapping fungi (NTF) in soil, and the defense response enzymes in tobacco. The combination of 65% SMS +35% CD was more suitable for vermicomposting, in which the highest vermicompost production (57%) and earthworm biomass increment (268%) were achieved. Additionally, the reduction in pH, total organic carbon, carbon: nitrogen ratio, and the pronounced elevation in four overall nutrient status were also observed. Soil amended with vermicompost (100:1 w/w) showed 61% control efficiency against nematode disease caused by M. incognita on tobacco, which significantly higher than that of the normal compost (24%). Comparing to the normal compost, the potential mechanism of vermicompost suppressing M. incognita could be rely on promoting species diversity of NTF in soil and enhancing the activities of the defense response enzymes in tobacco plant. Our findings indicate that vermicomposting is a promising technology for recycling of P. eryngii SMS, and the resulting vermicompost as organic fertilizer can be sued for management of the diseases caused by root-knot nematodes. This study establish a sustainable avenue for P. eryngii SMS disposal and a practical manner for controlling pathogens.
RESUMO
Maize (Zea mays L.) as the most important crops is globally cultivated for food, feedstuff and industrial raw materials. During August to September 2021, we carried out a survey on the soil-borne diseases of tobacco in Guizhou Province. Poorly developed maize plants were observed in the same field of root-knot nematode (RKN) infected tobacco (Nicotiana tabacum L.) in Dafang County, Bijie City (106º00'08"E, 22º24'81"N) (Figure 1A). Roots of maize plant were taken back to laboratory for nematode identification and infecting confirmation in greenhouse. Females, males, second-stage juveniles (J2s) and eggs were collected from the sampling roots and nematodes were identified based on morphological and molecular characteristics. The identification of the nematode was performed by observations of morphological characters of adults (n= 30) and molecular analysis. Perineal pattern of female showed distinct characteristics of a low dorsal arch and lateral field marked by forked and broken striae and without punctate markings between the anus and tail terminus (Fig. 1B). J2s hatched from eggs demonstrated the morphometric characters of body length = 433.25 µm, body width = 16.31 µm, stylet length = 10.43 µm. DGO = 3.62 µm, tail length = 52.78 µm, and hyaline tail terminus = 11.14 µm (Fig. 1C). For molecular analysis, females from infected roots of maize in fields and in Koch's postulate experiment were definitively identified via PCR using the M. arenaria species-specific markers (Far/Rarï¼TCGGCGATAGAGGTAAATGAC/TCGGCGATAGACACTACAACT). PCR products of females amplification were run in the agar gel, and a PCR product of 420 bp band was identified for M. arenaria for all tested female samples (Fig. 1E). The obtained specific fragment was sequenced and submitted to GenBank with accession number of OP503512. A 100% identity of the Fare/Rare sequence with M. arenaria (Accession: GQ395518.1, J. Phytopathol. 160(2): 59-66, 2012, MZ555757.1ï¼MZ555753.1, U42342.1ï¼were found through NCBI blast. Therefore, based on morphological and molecular analysis, the nematodes from maize were determined to be M. arenaria according to the related description of (Perry et al., 2009). Koch's postulate was conducted in greenhouse by inoculation of J2 from the original population to pots containing two-week old maize seedlings (n= 15, 1000 J2/seedling) and 5 seedlings were nonincubated as controls. Plants were maintained in greenhouse at 26 to 28°C. On day 50 after inoculation, all the inoculated plants showed typical RKN symptoms such as stunting and galled roots which were similar to those observed in the field (Fig. 2A). Females, J2 and eggs were found in the roots after staining(Fig. 2B, C, D) by the method of Bybd et al. (1983), while uninoculated control plants presented normal development, confirming that Maize was a host of M. arenaria. M. arenaria is one of the most damaging plant-parasitic nematodes, which can infect many crops worldwide, resulting in great losses on the crop quality and yield. The Southern Root-Knot Nematode (M. incognita) had been known to cause root-knot nematode disease on maize in Shandong Province of China(Shi et al.,2020). As a major rotation crop, maize was recommended for the management of RKNs and most soil-born pathogens in tobacco planting systems in China. However, the findings of M. arenaria on maize demonstrates that further investigation and management strategies should be conduct. To our knowledge, this is the first report of M. arenaria parasitizing maize in Guizhou province of China.
RESUMO
BACKGROUND: Root-knot nematodes (RKN) are among the most important root-damaging plant-parasitic nematodes, causing severe crop losses worldwide. The plant rhizosphere and root endosphere contain rich and diverse bacterial communities. However, little is known about how RKN and root bacteria interact to impact parasitism and plant health. Determining the keystone microbial taxa and their functional contributions to plant health and RKN development is important for understanding RKN parasitism and developing efficient biological control strategies in agriculture. RESULTS: The analyses of rhizosphere and root endosphere microbiota of plants with and without RKN showed that host species, developmental stage, ecological niche, and nematode parasitism, as well as most of their interactions, contributed significantly to variations in root-associated microbiota. Compared with healthy tomato plants at different developmental stages, significant enrichments of bacteria belonging to Rhizobiales, Betaproteobacteriales, and Rhodobacterales were observed in the endophytic microbiota of nematode-parasitized root samples. Functional pathways related to bacterial pathogenesis and biological nitrogen fixation were significantly enriched in nematode-parasitized plants. In addition, we observed significant enrichments of the nifH gene and NifH protein, the key gene/enzyme involved in biological nitrogen fixation, within nematode-parasitized roots, consistent with a potential functional contribution of nitrogen-fixing bacteria to nematode parasitism. Data from a further assay showed that soil nitrogen amendment could reduce both endophytic nitrogen-fixing bacteria and RKN prevalence and galling in tomato plants. CONCLUSIONS: Results demonstrated that (1) community variation and assembly of root endophytic microbiota were significantly affected by RKN parasitism; (2) a taxonomic and functional association was found for endophytic nitrogen-fixing bacteria and nematode parasitism; and (3) the change of nitrogen-fixing bacterial communities through the addition of nitrogen fertilizers could affect the occurrence of RKN. Our results provide new insights into interactions among endophytic microbiota, RKN, and plants, contributing to the potential development of novel management strategies against RKN. Video Abstract.
Assuntos
Microbiota , Nematoides , Bactérias Fixadoras de Nitrogênio , Solanum lycopersicum , Animais , Doenças das Plantas/parasitologia , Plantas , Bactérias/genética , Nitrogênio , Raízes de Plantas/microbiologiaRESUMO
The AWA neurons of Caenorhabditis elegans mainly perceive volatile attractive odors, while the ASH neurons perceive pH, penetration, nociception, odor tropism, etc. The perceptual neurons of Meloidogyne incognita have been little studied. The number of infestations around and within tomato roots was significantly reduced after RNA interference for high-homology genes in AWA and ASH neurons compared between M. incognita and C. elegans. Through in situ hybridization, we further determined the expression and localization of the homologous genes Mi-odr-10 and Mi-gpa-6 in M. incognita. In this study, we found that M. incognita has neuronal sensing pathways similar to AWA and ASH perception of C. elegans for sensing chemical signals from tomato roots. Silencing the homologous genes in these pathways could affect the nematode perception and infestation of tomato root systems. The results contribute to elucidating the process of the plant host perception of M. incognita.
RESUMO
Pochonia chlamydosporia is widely applied in many countries as a biocontrol fungus against parasitic nematodes in plants. In a field experiment, the combined use of Bacillus nematocida B16 increased the biocontrol efficiency of P. chlamydosporia ZK7 against Meloidogyne incognita. Further study indicated that the colonization of P. chlamydosporia ZK7 in the rhizosphere soil and the roots of tomatoes was significantly higher in the combined use group than in the control group. Gas chromatography was conducted to determine the effects of signaling substances. Five compounds, hexanal, (E)-2-hexenal, furfural, benzaldehyde, and 2-nonanone, were found to be highly altered in the volatile compounds produced in the soil under the combined application. The changes in benzaldehyde and 2-nonanone were the main factors that resulted in an increase in the colonization of fungi P. chlamydosporia ZK7 in the tomato roots. Furfural was the main volatile substance that affected the colonization of fungi P. chlamydosporia ZK7 in the soil. The combined use of B. nematocida B16 and P. chlamydosporia ZK7 altered the volatile ranges and resulted in increased colonization of biocontrol fungi and improved biocontrol efficiency against nematodes. This combined model could be used to promote the ability of biocontrol fungi to control root-knot nematodes.
RESUMO
Adaptation to nutrient deprivation depends on the activation of metabolic programs to use reserves of energy. When outside a host plant, second-stage juveniles (J2) of the root-knot nematode (Meloidogyne spp.), an important group of pests responsible for severe losses in the production of crops (e.g., rice, wheat, and tomato), are unable to acquire food. Although lipid hydrolysis has been observed in J2 nematodes, its role in fitness and the underlying mechanisms remain unknown. Using RNA-seq analysis, here, we demonstrated that in the absence of host plants, the pathway for the biosynthesis of polyunsaturated fatty acids was upregulated, thereby increasing the production of arachidonic acid in middle-stage J2 Meloidogyne incognita worms. We also found that arachidonic acid upregulated the expression of the transcription factor hlh-30b, which in turn induced lysosomal biogenesis. Lysosomes promoted lipid hydrolysis via a lysosomal lipase, LIPL-1. Furthermore, our data demonstrated that blockage of lysosomal lipolysis reduced both lifespan and locomotion of J2 worms. Strikingly, disturbance of lysosomal lipolysis resulted in a decline in infectivity of these juveniles on tomato roots. Our findings not only reveal the molecular mechanism of lipolysis in J2 worms but also suggest potential novel strategies for the management of root-knot nematode pests.
Assuntos
Solanum lycopersicum , Tylenchoidea , Animais , Ácidos Araquidônicos/metabolismo , Metabolismo dos Lipídeos , Lipólise , Solanum lycopersicum/parasitologia , Lisossomos , Tylenchoidea/metabolismo , Tylenchoidea/fisiologiaRESUMO
Soil fungistasis is a phenomenon in which the germination and growth of fungal propagules is widely inhibited in soils. Although fungistatic compounds are known to play important roles in the formation of soil fungistasis, how such compounds act on soil fungi is little studied. In this study, it was found that ammonia (NH3) induced global protein misfolding marked by increased ubiquitination levels of proteins (ubiquitylome data and Western blot verification). The misfolded proteins should trigger the endoplasmic reticulum (ER) stress, which was indicated by electron microscope image and proteome data. Results from the mutants of BiP and proteasome subunit alpha 7 suggested that ER stress played a mechanistic role in inhibiting conidial germination. Results from proteome data indicated that, to survive ammonia fungistasis, conidia first activated the unfolded protein response (UPR) to decrease ER stress and restore ER protein homeostasis, and the function of UPR in surviving ammonia was confirmed by using mutant strains. Second, ammonia toxicity could be reduced by upregulating carbon metabolism-related proteins, which benefited ammonia fixation. The results that metabolites (especially glutamate) could relieve the ammonia fungistasis confirmed this indirectly. Finally, results from gene knockout mutants also suggested that the fungistatic mechanism of ammonia is common for soil fungistasis. This study increased our knowledge regarding the mechanism of soil fungistasis and provided potential new strategies for manipulating soil fungistasis. IMPORTANCE Soil fungistasis is a phenomenon in which the germination and growth of fungal propagules is widely inhibited in soil. Although fungistatic compounds are known to play important roles in the formation of soil fungistasis, how such compounds act on soil fungi remains little studied. This study revealed an endoplasmic reticulum stress-related fungistatic mechanism with which ammonia acts on Arthrobotrys oligospora and a survival strategy of conidia under ammonia inhibition. Our study provides the first mechanistic explanation of how ammonia impacts fungal spore germination, and the mechanism may be common for soil fungistasis. This study increases our knowledge regarding the mechanism of soil fungistasis in fungal spores and provides potential new strategies for manipulating soil fungistasis.
RESUMO
A novel Gram-stain-negative, rod-shaped, non-motile, yellowish bacterium, designated strain 1.3611T, was isolated from the wormcast of Eisenia foetida. The strain grew optimally at 30-37 â, at pH 7.0 and with 0-1.0â% (w/v) NaCl. Based on the results of 16S rRNA gene sequence and phylogenetic analyses, strain 1.3611T showed the highest degree of 16S rRNA gene sequence similarity to Sphingobacterium olei HAL-9T (97.0â%), followed by Sphingobacterium alkalisoli Y3L14T (95.8â%). The respiratory quinone of strain 1.3611T was menaquinone-7 (MK-7) and its major cellular fatty acids were iso-C15â:â0 (41.3â%), summed feature 3 (C16â:â1 ω7c and/or C16â:â1 ω6c, 22.1â%) and iso-C17â:â0 3-OH (16.2â%). The major polar lipids were sphingophospholipid, phosphatidylethanolamine, four unidentified glycolipids, two unidentified phospholipids and five unidentified polar lipids. The genomic DNA G+C content was 39.0âmol%. The digital DNA-DNA hybridization and average nucleotide identity values between the genomes of strain 1.3611T and S. olei HAL-9T were 37.9 and 88.9â%, respectively. According to the phenotypic and chemotaxonomic phylogenetic results, strain 1.3611T should represent a novel species of the genus Sphingobacterium, for which the name Sphingobacterium lumbrici sp. nov. is proposed, with strain 1.3611T (=KCTC 62980T=CCTCC AB 2018349T) as the type strain.
Assuntos
Oligoquetos/microbiologia , Filogenia , Sphingobacterium/classificação , Animais , Técnicas de Tipagem Bacteriana , Composição de Bases , China , DNA Bacteriano/genética , Ácidos Graxos/química , Glicolipídeos/química , Hibridização de Ácido Nucleico , Fosfolipídeos/química , Pigmentação , RNA Ribossômico 16S/genética , Análise de Sequência de DNA , Sphingobacterium/isolamento & purificação , Vitamina K 2/análogos & derivados , Vitamina K 2/químicaRESUMO
Biocontrol of root-knot nematode has attracted increasing attention over the past two decades. The inconsistent field performance of biocontrol agents, which is caused by soil fungistasis, often restricts their commercial application. There is still a lack of research on the genes involved in biocontrol fungi response to soil fungistasis, which is important for optimizing practical applications of biocontrol fungi. In this study, the lactoylglutathione lyase-encoding AOL_s00004g335 in the nematophagous fungi Arthrobotrys oligospora was knocked out, and three mutant strains were obtained. The hyphal growth of mutants on the three media was almost the same as that of the wild-type strain, but mutants had slightly higher resistance to NaCl, SDS, and H2O2. Methylglyoxal (MG) significantly increased the resistance of A. oligospora to ammonia, but decreased the resistance to benzaldehyde. Furthermore, the resistance of the mutants to soil fungistasis was largely weakened and MG could not increase the resistance of A. oligospora to soil fungistasis. Our results revealed that MG has different effects on the fungistatic roles of ammonia and benzaldehyde and that lactoylglutathione lyase is very important for A. oligospora to resist soil fungistasis.
Assuntos
Lactoilglutationa Liase , Nematoides , Amônia , Animais , Ascomicetos , Benzaldeídos , Peróxido de Hidrogênio , Aldeído Pirúvico , SoloRESUMO
An aerobic, rod-shaped, Gram-stain-positive, actinobacterial strain, designated 1.0914T, was isolated from a stalactite sample collected from a cave located in Guizhou Province, southwest PR China. Based on 16S rRNA gene sequence analysis, strain 1.0914T shared highest similarities values with Nocardioides pelophilus CGMCC 4.7388T (97.7â%), Nocardioides immobilis CCTCC AB 2017083T (97.5â%) and Nocardioides silvaticus CCTCC AB 2018079T (97.3â%) and values lower than 97.0â% to other members of the genus Nocardioides. Phylogenetic trees based on 16S rRNA gene sequences indicated that strain 1.0914T formed an isolated branch with N. pelophilus CGMCC 4.7388T, N. immobilis CCTCC AB 2017083T and N. silvaticus CCTCC AB 2018079T. The polar lipids contained phosphatidylglycerol, diphosphatidylglycerol, phosphatidylinositol and one unidentified phospholipid in the cellular membrane. The major fatty acids were identified as iso-C16â:â0, C18â:â1 ω9c, C17â:â1 ω8c and C16â:â0. The predominant respiratory quinone was MK-8(H4) and ll-diaminopimelic acid was the diagnostic diamino acid in the cell-wall peptidoglycan. The genomic DNA G+C content was 71.1âmol%. The orthologous average nucleotide identiy values between N. pelophilus CGMCC 4.7388T, N. immobilis CCTCC AB 2017083T, N. silvaticus CCTCC 2018079T and strain 1.0914T were 82.3, 81.7 and 81.9â% respectively. DNA-DNA hybridization values between N. pelophilus CGMCC 4.7388T, N. immobilis CCTCC AB 2017083T, N. silvaticus CCTCC 2018079T and strain 1.0914T were 25.2, 24.6 and 24.5â% respectively. The phylogenetic, phenotypic and chemotaxonomic data supported the classification of strain 1.0914T as representing a new species of Nocardioides, for which the name Nocardioides stalactiti sp. nov. is proposed. The type strain is 1.0914T (=CCTCC AB 2018266T=KCTC 49243T).
Assuntos
Cavernas/microbiologia , Nocardioides/classificação , Filogenia , Técnicas de Tipagem Bacteriana , Composição de Bases , China , DNA Bacteriano/genética , Ácido Diaminopimélico/química , Ácidos Graxos/química , Nocardioides/isolamento & purificação , Fosfolipídeos/química , RNA Ribossômico 16S/genética , Análise de Sequência de DNA , Vitamina K 2/análogos & derivados , Vitamina K 2/químicaRESUMO
A Gram-stain negative, aerobic, motile and rod-shaped bacterium, designated strain 3.1105T, was isolated from a karst district soil sample collected from Tiandong cave, Guizhou province, south-west PR China. The isolate grew at 10-40 °C and pH 5.0-8.0 and tolerated up to 1â% NaCl (w/v) on R2A medium, with optimal growth at 25-30 °C, pH 7.0 and 0â% NaCl (w/v). Cells showed oxidase-positive and catalase-positive reactions. The respiratory quinone was Q-10. The predominant cellular fatty acids contained C18â:â1ω7c 11-methyl, summed feature 8 (C18â:â1ω7c or C18â:â1ω6c), C16â:â0 and C17â:â0. The major polar lipids were phosphatidylglycerol and monoglycosyldiglycerides. The genomic DNA G+C content was 56.0 mol%. Phylogenetic analysis based on 16S rRNA gene sequences indicated that 3.1105T should be affiliated to the genus Asticcacaulis and showed highest 16S rRNA gene sequence similarity values with Asticcacaulis excentricus CB 48T (96.0 %), Asticcacaulis endophyticus ZFGT-14T (95.3â%) and lower than 95.3â% similarity to other species of the genus Asticcacaulis. The polyphasic taxonomic characteristics indicated that strain 3.1105T represents a novel species of the genus Asticcacaulis, for which the name Asticcacaulis tiandongensis sp. nov., (type strain 3.1105T=KCTC 62978T=CCTCC AB 2018268T) is proposed.
Assuntos
Caulobacteraceae/classificação , Cavernas/microbiologia , Filogenia , Microbiologia do Solo , Técnicas de Tipagem Bacteriana , Composição de Bases , Caulobacteraceae/isolamento & purificação , China , DNA Bacteriano/genética , Ácidos Graxos/química , Hibridização de Ácido Nucleico , Fosfolipídeos/química , RNA Ribossômico 16S/genética , Análise de Sequência de DNA , Ubiquinona/análogos & derivados , Ubiquinona/químicaRESUMO
A Gram-stain-negative, yellow-green bacterium, designated 1.1416T, was isolated from wormcast of Eisenia foetida. The strain was non-motile, rod-shaped, and grew optimally on NA medium at 30 °C, pH 7.0 and with 0â% (w/v) NaCl. On the basis of the 16S rRNA gene sequence and phylogenetic analysis, 1.1416T showed the highest degree of 16S rRNA gene sequence similarity to Luteimonas arsenica 26-35T (96.2â%), followed by Luteimonas lutimaris G3T (96.1â%). The respiratory quinone of 1.1416T was ubiquinone-8 (Q-8), and its major cellular fatty acids were iso-C15â:â0 (39.8â%), summed feature 9 (iso-C17â:â1 ω9c or C16â:â0 10-methyl) (18.6â%). The major polar lipids of 1.1416T were phosphatidylglycerol, diphosphatidylglycerol, phosphatidylethanolamine and six unidentified phospholipids. The genomic DNA G+C content of 1.1416T was 71.0 mol%. According to the results of the phenotypic and chemotaxonomic phylogenetic analyses, strain 1.1416T represents a novel species of the genus Luteimonas, for which the name Luteimonas lumbrici sp. nov. is proposed, with strain 1.1416T (=KCTC 62979T=CCTCC AB 2018348T) as the type strain.