Parâmetros hematológicos normais em coelhos Nova Zelândia do biotério da Faculdade de Medicina da USP / Normal Haematological parameters in New Zealand rabbits from Faculdade de Medicina da USP animal facility

OBJETIVO: realizar análise comparativa de valores hematológicos entre sexos no mesmo período: anos de 2008, 2009 e 2010; bem como a comparação dos resultados agrupados. MATERIAL E MÉTODOS: 60 coelhos da raça Nova Zelândia, 30 machos e 30 fêmeas, idade entre 2-4 meses, criados em condições convencionais, foram submetidos a exames hematológicos, coletando-se o sangue pela artéria auricular central. As médias foram comparadas aplicando-se o teste t-Student, para p<0,05. RESULTADOS: foram observadas diferenças significantes entre as médias e os desvios padrão de machos e de fêmeas, para: hematócrito e hemoglobina, ano de 2010; eosinófilos, em 2008 e 2009; monócitos, ano de 2009, e neutrófilos, ano de 2010, na comparação dos sexos no mesmo período. A análise dos dados agrupados em 3 anos não apontou diferenças significantes entre os sexos. CONCLUSÃO: resultados encontrados, de machos e de fêmeas, respectivamente: eritrócitos x 106/mm3: 5,94±2,97, 4,86±3,63; Hematócrito %: 31,20±1,78, 26,40±4,50; Hemoglobina g/dL: 10,58±4,70, 8,94±3,57; volume corpuscular médio %: 52,58±3,86, 54,02±2,86; hemoglobina corpuscular média fl (fentolitros): 17,83±7,45, 36,22±7,35; concentração de hemoglobina corpuscular média %: 33,89±0,44, 34,10±0,02; Leucócitos x 103 /mm3: 9,98±2,45, 6,66±2,81; eosinófilos %: 5,40±1,14, 5,20±1,17; monócitos %: 2,40±0,89, 2,00±0,63; Linfócitos %:39,00±4,47, 40,02±20,93; Basófilos %: 0,00±0, 0,00±0; Bastonetes %: 11,40±1,34, 12,60±3,55; Segmentados %: 37,00±5,19, 40,20±1,60; Neutrófilos %: 48,40±4,93, 52,80±3,56. CEUA nº 251/11.

OBJECTIVE: To conduct a comparative analysis of hematologic values between sexes in the same period of the years 2008, 2009 and 2010, and the comparison of the pooled results. MAT ERIAL AND METHODS: 60 New Zealand rabbits, 30 males and 30 females, aged 2 to 4 months, bred in conventional conditions, were subjected to blood tests, blood was collected by the central auricular artery. Means were compared applying the Student t test, p <0.05. RESULTS: Significant differences were observed between the means and standard deviations of males and females, for hematocrit and hemoglobin, 2010; eosinophils, in 2008 and 2009; monocytes, 2009, and neutrophils, 2010, in comparison of the sexes in the same period. The analysis of pooled data over 3 years showed no significant differences between the sexes. CONCLUSION: We found the following results of males and females, respectively: erythrocytes x 106/mm3: 5.94±2.97, 4.86±3.63; hematocrit %: 31.20±1.78, 26.40±4.50; hemoglobin g/dL, 10.58±4.70, 8.94 ± 3.57; mean corpuscular volume %: 52.58±3.86, 54.02±2.86; mean corpuscular hemoglobin fl (fentoliter): 17.83±7.45, 36.22±7.35; mean corpuscular hemoglobin concentration %: 33.89±0.44, 34.10±0.02; leukocytes x103/mm3: 9.98±2.45, 6.66±2.81; eosinophils %: 5.40±1.14, 5.20±1.17; monocytes %: 2.40±0.89, 2.00±0.63; lymphocytes %: 39.00±4.47, 40.02±20.93; basophils %: 0.00±0, 0.00±0; rods %: 11.40±1.34; 12.60±3.55; segmented %: 37.00±5.19, 40.20±1.60; neutrophils %: 48.40±4.93, 52.80±3.56. CEUA No. 251/11.

Estudo comparativo de sensibilidade das técnicas de cultura bacteriana e PCR para a detecção de Pasteurella pneumotropica em roedores / /Comparative sensivity for Pasteurella pneumotropica detection of rodents by bacterial culture and PCR techniques

Objetivo: Realizar uma comparação, em relação a sensibilidade, das técnicas de cultura bacteriana e PCR para detecção de Pasteurella pneumotropica, em colônias convencionais de camundongos das linhagens isogênicas C57BL/6, BALB/c e heterogênica Swiss; ratos Wistar e Hamster Golden. Materiais e Métodos: 230 amostras de traquéia foram coletadas e divididas em partes iguais: uma parte foi encaminhada para a cultura bacteriana, onde foram realizadas provas bioquímicas manuais e semi-automatizadas. A outra parte foi submetida à reação de PCR, onde os oligonucleotídeos iniciadores foram F; 5’ ACCTACTCTTGACATCCAGA 3’ e R; 5’ CGCTCCACATCGCTGCTT 3’ que amplificam em 296 pb. Os produtos obtidos foram separados por eletroforese em gel de agarose. A visualização e fotodocumentação foram realizadas sob luz ultravioleta. Resultados e conclusão: Os resultados obtidos através da cultura bacteriana foram de 1,75% de casos positivos e 98,25% de negativos. Em relação ao PCR observamos o resultado de 63% de positivos e 37% de casos negativos. Concluindo, nossos resultados demonstram que a técnica de PCR oferece significativamente maior sensibilidade para detecção de P. pneumotropica quando comparado a cultura bacteriana. CEUA nº 251/11.

OBJECTIVE: To conduct a comparative study of the sensitivity by bacterial culture and PCR detection of Pasteurella pneumotropica in conventional colonies of inbred mice strains C57BL/6, BALB/c and Swiss outbred; Golden Hamster and Wistar rats. MATERIALS AND METHODS: 230 samples of the trachea were collected and divided into equal parts: one part was sent for culture, where biochemical tests were performed manually and semi-automated, after bacterial isolation. The other part was subjected to PCR, used primers F, 5 ‘ACCTACTCTTGACATCCAGA 3’ and R, 5 ‘CGCTCCACATCGCTGCTT 3’ which amplifies at 296 bp. The products obtained were separated by electrophoresis in agarose gel. Visualization and photodocumentation were performed under ultraviolet light. RESULTS AND CONCLUSION: The results obtained by bacterial culture were 1.75% of positive cases and negative in 98.25%; 63% and 37% of cases positive and negative, respectively, by PCR. These results point to the greater sensitivity of PCR (x2 = 0.10, 0.80 < p <0.50) when compared to bacterial culture. CEUA nº 251/11

Detecção de Proteus mirabilis nas fezes de camundongos spf / /Detection of Proteus mirabilis in specifc pathogen free mice feces

O presente estudo teve como objetivo apresentar os resultados de pesquisa de positividade do microorganismo Proteus mirabilis em camundongos das linhagens C57BL/6, BALB/c e BALB/c Nude, originários do setor de criação de camundongos livres de patógenos específicos (SPF) do Centro de Bioterismo da Faculdade de Medicina da USP e relatar a importância do isolamento deste microorganismo em colônias de animais. Para tanto, amostras de fezes de 71 camundongos da linhagem C57BL/6, 48 camundongos da linhagem BALB/c e 26 camundongos da linhagem BALB/c Nude, foram semeadas em meios específicos para bactérias gram negativas e diagnosticado no Enterokit B da Probac do Brasil. Nossos resultados mostraram que, as linhagens de camundongos C57BL/6, BALB/c e BALB/c Nude apresentaram P.mirabilis nas fezes, nas porcentagens de 80,3%, 62,5% e 73,1% respectivamente, sendo inadequadas para utilização em protocolos experimentais das áreas de radiobiologia, imunologia, oncologia e cirurgias experimentais invasivas, por interferirem potencialmente nos resultados destas áreas. CEUA nº 251/11.

This study aimed to present the positive results of Proteus mirabilis research from strains inbred mice C57BL/6, BALB/c and BALB/c Nude, originating from the sector of Specific Pathogen Free (SPF) mice - Animal Facilities of Faculdade de Medicina (USP – University of São Paulo) and report the importance of isolation of this microorganism in colonies of animals. For this, stool samples from: 71 C57BL/6, 48 BALB/c and 26 BALB /c Nude inbred mice, were inoculated in cultural bacteria specific media and diagnosed in the B Enterokit Probac-Brasil. Our results showed that the strains of C57BL/6, BALB/c and BALB/c Nude presented P.mirabilis in stool, percentages of 80.3%, 62.5% and 73.1% respectively, being unsuitable for use in experimental protocols in the fields of radiobiology, immunology, oncology, and experimental invasive surgeries by interfering mainly on the results of these areas. CEUA No. 251/11.

Detecção de Proteus mirabilis nas fezes de camundongos spf / /Detection of Proteus mirabilis in specifc pathogen free mice feces

O presente estudo teve como objetivo apresentar os resultados de pesquisa de positividade do microorganismo Proteus mirabilis em camundongos das linhagens C57BL/6, BALB/c e BALB/c Nude, originários do setor de criação de camundongos livres de patógenos específicos (SPF) do Centro de Bioterismo da Faculdade de Medicina da USP e relatar a importância do isolamento deste microorganismo em colônias de animais. Para tanto, amostras de fezes de 71 camundongos da linhagem C57BL/6, 48 camundongos da linhagem BALB/c e 26 camundongos da linhagem BALB/c Nude, foram semeadas em meios específicos para bactérias gram negativas e diagnosticado no Enterokit B da Probac do Brasil. Nossos resultados mostraram que, as linhagens de camundongos C57BL/6, BALB/c e BALB/c Nude apresentaram P.mirabilis nas fezes, nas porcentagens de 80,3%, 62,5% e 73,1% respectivamente, sendo inadequadas para utilização em protocolos experimentais das áreas de radiobiologia, imunologia, oncologia e cirurgias experimentais invasivas, por interferirem potencialmente nos resultados destas áreas. CEUA nº 251/11.(AU)

This study aimed to present the positive results of Proteus mirabilis research from strains inbred mice C57BL/6, BALB/c and BALB/c Nude, originating from the sector of Specific Pathogen Free (SPF) mice - Animal Facilities of Faculdade de Medicina (USP University of São Paulo) and report the importance of isolation of this microorganism in colonies of animals. For this, stool samples from: 71 C57BL/6, 48 BALB/c and 26 BALB /c Nude inbred mice, were inoculated in cultural bacteria specific media and diagnosed in the B Enterokit Probac-Brasil. Our results showed that the strains of C57BL/6, BALB/c and BALB/c Nude presented P.mirabilis in stool, percentages of 80.3%, 62.5% and 73.1% respectively, being unsuitable for use in experimental protocols in the fields of radiobiology, immunology, oncology, and experimental invasive surgeries by interfering mainly on the results of these areas. CEUA No. 251/11.(AU)

Estudo comparativo de sensibilidade das técnicas de cultura bacteriana e PCR para a detecção de Pasteurella pneumotropica em roedores / /Comparative sensivity for Pasteurella pneumotropica detection of rodents by bacterial culture and PCR techniques

Objetivo: Realizar uma comparação, em relação a sensibilidade, das técnicas de cultura bacteriana e PCR para detecção de Pasteurella pneumotropica, em colônias convencionais de camundongos das linhagens isogênicas C57BL/6, BALB/c e heterogênica Swiss; ratos Wistar e Hamster Golden. Materiais e Métodos: 230 amostras de traquéia foram coletadas e divididas em partes iguais: uma parte foi encaminhada para a cultura bacteriana, onde foram realizadas provas bioquímicas manuais e semi-automatizadas. A outra parte foi submetida à reação de PCR, onde os oligonucleotídeos iniciadores foram F; 5 ACCTACTCTTGACATCCAGA 3 e R; 5 CGCTCCACATCGCTGCTT 3 que amplificam em 296 pb. Os produtos obtidos foram separados por eletroforese em gel de agarose. A visualização e fotodocumentação foram realizadas sob luz ultravioleta. Resultados e conclusão: Os resultados obtidos através da cultura bacteriana foram de 1,75% de casos positivos e 98,25% de negativos. Em relação ao PCR observamos o resultado de 63% de positivos e 37% de casos negativos. Concluindo, nossos resultados demonstram que a técnica de PCR oferece significativamente maior sensibilidade para detecção de P. pneumotropica quando comparado a cultura bacteriana. CEUA nº 251/11.(AU)

OBJECTIVE: To conduct a comparative study of the sensitivity by bacterial culture and PCR detection of Pasteurella pneumotropica in conventional colonies of inbred mice strains C57BL/6, BALB/c and Swiss outbred; Golden Hamster and Wistar rats. MATERIALS AND METHODS: 230 samples of the trachea were collected and divided into equal parts: one part was sent for culture, where biochemical tests were performed manually and semi-automated, after bacterial isolation. The other part was subjected to PCR, used primers F, 5 ‘ACCTACTCTTGACATCCAGA 3 and R, 5 ‘CGCTCCACATCGCTGCTT 3 which amplifies at 296 bp. The products obtained were separated by electrophoresis in agarose gel. Visualization and photodocumentation were performed under ultraviolet light. RESULTS AND CONCLUSION: The results obtained by bacterial culture were 1.75% of positive cases and negative in 98.25%; 63% and 37% of cases positive and negative, respectively, by PCR. These results point to the greater sensitivity of PCR (x2 = 0.10, 0.80 < p <0.50) when compared to bacterial culture. CEUA nº 251/11(AU)

Parâmetros hematológicos normais em coelhos Nova Zelândia do biotério da Faculdade de Medicina da USP / Normal Haematological parameters in New Zealand rabbits from Faculdade de Medicina da USP animal facility

OBJETIVO: realizar análise comparativa de valores hematológicos entre sexos no mesmo período: anos de 2008, 2009 e 2010; bem como a comparação dos resultados agrupados. MATERIAL E MÉTODOS: 60 coelhos da raça Nova Zelândia, 30 machos e 30 fêmeas, idade entre 2-4 meses, criados em condições convencionais, foram submetidos a exames hematológicos, coletando-se o sangue pela artéria auricular central. As médias foram comparadas aplicando-se o teste t-Student, para p<0,05. RESULTADOS: foram observadas diferenças significantes entre as médias e os desvios padrão de machos e de fêmeas, para: hematócrito e hemoglobina, ano de 2010; eosinófilos, em 2008 e 2009; monócitos, ano de 2009, e neutrófilos, ano de 2010, na comparação dos sexos no mesmo período. A análise dos dados agrupados em 3 anos não apontou diferenças significantes entre os sexos. CONCLUSÃO: resultados encontrados, de machos e de fêmeas, respectivamente: eritrócitos x 106/mm3: 5,94±2,97, 4,86±3,63; Hematócrito %: 31,20±1,78, 26,40±4,50; Hemoglobina g/dL: 10,58±4,70, 8,94±3,57; volume corpuscular médio %: 52,58±3,86, 54,02±2,86; hemoglobina corpuscular média fl (fentolitros): 17,83±7,45, 36,22±7,35; concentração de hemoglobina corpuscular média %: 33,89±0,44, 34,10±0,02; Leucócitos x 103 /mm3: 9,98±2,45, 6,66±2,81; eosinófilos %: 5,40±1,14, 5,20±1,17; monócitos %: 2,40±0,89, 2,00±0,63; Linfócitos %:39,00±4,47, 40,02±20,93; Basófilos %: 0,00±0, 0,00±0; Bastonetes %: 11,40±1,34, 12,60±3,55; Segmentados %: 37,00±5,19, 40,20±1,60; Neutrófilos %: 48,40±4,93, 52,80±3,56. CEUA nº 251/11.(AU)

OBJECTIVE: To conduct a comparative analysis of hematologic values between sexes in the same period of the years 2008, 2009 and 2010, and the comparison of the pooled results. MAT ERIAL AND METHODS: 60 New Zealand rabbits, 30 males and 30 females, aged 2 to 4 months, bred in conventional conditions, were subjected to blood tests, blood was collected by the central auricular artery. Means were compared applying the Student t test, p <0.05. RESULTS: Significant differences were observed between the means and standard deviations of males and females, for hematocrit and hemoglobin, 2010; eosinophils, in 2008 and 2009; monocytes, 2009, and neutrophils, 2010, in comparison of the sexes in the same period. The analysis of pooled data over 3 years showed no significant differences between the sexes. CONCLUSION: We found the following results of males and females, respectively: erythrocytes x 106/mm3: 5.94±2.97, 4.86±3.63; hematocrit %: 31.20±1.78, 26.40±4.50; hemoglobin g/dL, 10.58±4.70, 8.94 ± 3.57; mean corpuscular volume %: 52.58±3.86, 54.02±2.86; mean corpuscular hemoglobin fl (fentoliter): 17.83±7.45, 36.22±7.35; mean corpuscular hemoglobin concentration %: 33.89±0.44, 34.10±0.02; leukocytes x103/mm3: 9.98±2.45, 6.66±2.81; eosinophils %: 5.40±1.14, 5.20±1.17; monocytes %: 2.40±0.89, 2.00±0.63; lymphocytes %: 39.00±4.47, 40.02±20.93; basophils %: 0.00±0, 0.00±0; rods %: 11.40±1.34; 12.60±3.55; segmented %: 37.00±5.19, 40.20±1.60; neutrophils %: 48.40±4.93, 52.80±3.56. CEUA No. 251/11.(AU)

Núcleo de desenvolvimento em fertilização in vitro I. Estudo da resposta à superovulação e viabilidade embrionária / / Genter for development in vitro fertilization. I.Study of response to super ovulation and embryo viability

Este trabalho tem como objetivo implantar novas tecnologias na área de bioterismo, com a formação de um núcleo de desenvolvimento de Fertilização In Vitro (FIV) para criação de um banco de embriões de camundongos isogênicos, transgênicos ou "nocautes", estudando inicialmente a superovulação e viabilidade embrionária de diferentes linhagens de camundongos. As fêmeas com oito semanas foram estimuladas com os hormônios PMSG e HCG, em seguida, eutanasiadas para obtenção dos oócitos e os machos, das respectivas linhagens, foram também eutanasiados para obtenção dos espermatozóides. Após a fertilização in vitro, os embriões em duas células foram coletados e transferidos para fêmeas pseudográvidas. Os resultados da FIV mostraram que as linhagens 129sv ABR, CPA, C5BL/10 e ALOX apresentaram maior número de oócitos em relação às demais linhagens testadas: A/J, BALB/c IL-4, BALB/c SCID, C57BL/6 TLR2, CBA, C57BL/6 CD1, BALB/c CARECA, C57BL/6 IL-4 e C57BL/6 TLR4. Com relação ao - nº de oócitos/ nº de embriões em duas células - as linhagens A/J (42/30) e CBA (20/14), apesar de apresentarem um número de oócitos inferior quando comparamos com os animais da linhagem 129 (165/53), apresentaram um maior número de embriões em duas células. Com a linhagem C57BL/10.A, o número de oócitos (119) foi maior em comparação com a linhagem A/J e CBA, no entanto, o número de embriões em duas células obtidos pela linhagem C57BL/10.A (22) foi menor em comparação com os animais da linhagem A/J e CBA. A linhagem XPA, apresentou grande número de oócitos e também de embriões em duas células (116/76). A eficiência da FIV foi validada pelos primeiros nascimentos de embriões, obtidos com animais das linhagens C57BL/6 IL4, C57BL/6 TLR2 e da linhagem 129sv ABR. Em conjunto, os nossos resultados mostram que a resposta à superovulação é um fenômeno linhagem específico, além disso, dentro da particularidade de cada linhagem, os embriões que se diferenciaram em duas células são capazes de ser gerados em fêmeas receptoras e se desenvolveram até o nascimento. Com essa ferramenta, abrimos novas possibilidades de avanços tecnológicos na área de bioterismo. Certificado CEUA nº 098/11 HCFMUSP.

This study aimed to deploy new technologies in the Laboratory Animal Science, with the formation of a core development in vitro fertilization (IVF) to create an embryo bank of inbred mice, transgenic or “knockout”, initially studying the super ovulation and embryo viability of different strains of mice. Females 8 weeks, were stimulated with PMSG and HCG hormones then euthanized to obtain the oocytes and males, their lines were also euthanized to obtain sperm. After in vitro fertilization, the embryo into two cells were collected and transferred to pseudo-pregnant females. The IVF results showed that strains 129sv ABR, XPA, and C57BL/10.A ALOX had a higher number of oocytes compared with other tested strains: A/J, BALB/c IL-4, BALB/c SCID, C57BL/TLR2 6, CBA, C57BL/6 CD1, BALB/c BALD, C57BL/6 IL -4 and C57BL/6 TLR4. With respect to -n oocyte/embryo -n into two cells - the strains A/J (42/30) and CBA (20/14), although with a lower number of oocytes when compared with the strain 129 (165/53), showed a higher number of embryos in two cells. With the line C57BL/10.A, the number of oocytes (119) was higher in comparison with strain A/J and CBA, however, the number of two-cell embryos obtained by C57BL/10.A (22) was lower compared with animals from the strain A/J and CBA. The strain XPA, showed a large number of oocytes and embryos also two cells (116/76). The efficiency of IVF, has been validated by the first births of embryos obtained from animals of the strains C57BL/6 IL4, C57BL/6 and TLR2 strain 129sv ABR. Together, our results showed that the response to ovulation is a super strain-specific phenomenon, moreover, within the particularity of each strain, the embryos which differentiated into two cells are able to be generated in recipient females and develop to the birth. With this tool, we have opened new possibilities for technological advances in the Laboratory Animal Science. Certified CEUA Nº 098/11 HCFMUSP.

Estudo comparativo dos valores hematológicos entre sexo e categorias sanitárias de camundongos C57BL/6 e BALB/c / Hematological comparative study between sex and sanitary categories of C57BL/6 and BALB/C Mouse

A finalidade deste estudo é oferecer aos pesquisadores dados que possam ser relevantes na escolha do modelo experimental a ser utilizado, comparando os valores hematologicos de camundongos de linhagens isogênicas, mantidos em biotérios Convencional e SPF - (Specific Pathogen Free). foram utilizados 80 camundongos selecionados por categoria sanitária e sexo, sem sinais clínicos de doenças, acima de 10 semanas. O perfil gematológico analisado foi determinado pelo processo de citometria, no qual a separação de entrócitos e leucócitos ocorre por volume celular, sendo utilizada a identificação celular pelo método em suspensão e qualificação. Os exames realizados foram eitrograma e leucograma no equipamento (Celm CC510) e os derivados hematológicos como índices hematimétricos; a quantificação morfológica de leucócitos e eritrócitos foram determinadas por varredura (Panótico-comercial) e hemoglobina por espectrofolometria (Celm E210D). A comparação dos valores hematológicos de camundongos das linhagens isogênicas BALB/c e C57BL/6, mantidos em biotérios Convencional e SPF não apresentou diferenças entre os parâmetros: contagem de hemácias, hematoctiyo, hemoglobina corpuscular média; contagem de leucócitos, monócitos, linfócitos e basofilos. Os eosinófilos apresentam valores diferentes entre os secos e entre as categorias sanitárias, em ambas as linhagens. Os neutrófilos, nas fêmeas C57Bl/6, foram superiores em número, nos convencionais quando comparadas às fêmeas SPF. Certificado CEAU nº 251/11 HCFMUSP.

The purpose of this study was to provide researchers with data that may be relevant in the choice of experimental model to be used, comparing the haematological values of isogenic strains of mice kept in conventional animal facilities and SPF - (Specific Pathogen Free). 80 mice were used for selected health category and sex, without clinical signs of disease, over 10 weeks, The blood profile analysis was determined by flow cytometry process, where the separation of erythrocytes and leukocytes occurs by cell volume and is used to identify the cell suspension method and quantification. The tests were performed on the equipment erythrogram and WBC (Celma CC510) and RBC indices as derived from hematological, morphological quantification of leukocytes and erythrocytes were determined by scanning (Panótico-commercial) and hemoglobin by spectrophometry (Celm, E210D). Comparison of leukocytes occurs by cell volume and is used to identify the cell sushaematological values of isogenic strains of mice BALB/c and C57BL/6, kept in conventional animal facilities and SPF, showed no differences between the parameters: erythrocyte count, hematocrit, hemoglobin, mean corpuscular volume, mean corpuscular hemoglobin, hemoglobin concentration mean corpuscular; WBC, monocytes, lymphocytes, and basophils. Eosinophils showed different values between the sexes and between health categories, in both strains. Neutrophilis, in the female C57BL/6 were greater in number in females qhen compared to conventional SPF. Certified nº 251/11 CEAU HCFMUSP.

Perfil bioquímico dos animais de laboratório do biotério da Faculdade de Medicina da USP / / Biochemical profile of laboratory animals of the Medical School USP

Objetivo: Os parãmetros bioquímicos são utilizados em pesquisas cientificas, em conjunto com outros fatores, para análise dos resultados experimentais. Animais de laboratório criados em diferentes biotérios apresentam variações em seus valores devido a dieta, manejo, estado sanitário, idade, vias de coleta do sangue e outros interferentes. Desta forma, o objetivo deste trabalho foi determinar o perfil bioquímico de camundongos, ratos, hamsters e coelhos convencionais criados pelo Centro de bioterismo da FMUSP. Materiais e Métodos: Foram utilizados 20 camundongos das linhagens isogênicas BALB/c e C57Bl/6 e da heterogênica Swiss; 40 ratos Wistar, 40 hamsters Golden e 40 coelhos New Zealand. Os exames realizados foram: uréia/BUN (Blood Urea Nitrogen), creatinina, proteínas totais, albumina e globulinas, ferro, fósforo, glicose, colesterol total e suas frações LDI (Low Density Lipoprotein), HDL (High Density Lipoprotein), VLDL (Very Low Density Lipoprotein), Bilirrubina total e frações (direta, indireta), cloretos, magnésio, triglicerides, Alt/AST (alanina aminotransferase, aspartato aminotransaminase), amônia, cálcio, ALP (fosfatase alcalina) e LDH (desidrogenase lática), determinados por fotocolorimetria semi-automática (Cobas Mira) e kits bioclin, Labtest e Byosystems. Resultados: Apresentados pelas médias e os erros padrões das concentrações de analitos, no plasma, agrupados por sexo. Conclusão: Foram determinados os perfis bioquímicos de camundongos, ratos, hamsters e coelhos convencionais do centro de Bioterismo da FMUSP, oferecendo uma ferramenta valiosa aos pesquisadores ao analisar seus resultados experimentais. Certificado CEAU nº 251/11 HCFMUSP.

Objective: The biochemical parameters are used in scientific research in conjunction with other factors, to analyze the experimental results. Laboratory animals raised in different animal houses have variations in their values due to diet, management health status, age, the process of colecting blood and other interferences. Thus, the objective of this study was to created by conventional Bioterty Center FMUSP . Materials and Methods: We used 20 isogenic strains of mice BALB/6 and C57BL/6 and Swiss heterogeneous, 40 Wistat rats, 40 rabbits and 40 hamsters Golden New Zealand. The tests performed were: urea / BUN (Blood Urea Nitrogen), creatine, total protein, albumin and globulins, iron, phosphorus, glucose, total cholesterol and LDL (Low Density Lipoprotein), HDL (High Density Lipoprotein), VLDL (very Low Density Lipoprotein), total bilirubin and fractions (direct, indirect), chlondes, magnesium, triglucerides, ALT/AST (alanine aminotransferase, aspartate aminotransaminase), ammonium, calcium, ALP (alkaline phosphatase) and LDH (lactate denydrogenase), certain by semi-automatic spectrophotometer (Cobas Mira) and Bioclin kitas, and Labtest Biosystems. Results: Presented by the means and standard errors of the concentrations of analytes in plasma, grouped by sex. Conclusion: We determined the biochemical profiles of mice, rats, hamsters and rabbits conventional Biotery FMUSP Center, offering a valuable tool for researchers to analyze their experimental results. Certified No 251/11 CEAU HCFMUSP.

Detecção de Mycoplasma pulmonis no trato respiratório superior em roedores através da técnica de PCR / /Mycoplasma pulmonis detection in the rodents respiratoru tract by PCR

Objetivo: apresentar a técnica de PCR para a detecção de Mycoplasma pulmonis das colônias convencionais de camundongos das linhagens isogênicas C57BL/6, BALB/c e heterogênica Swiss, e ratos Wistar. Material e Métodos: A extração do DNA foi realizada a partir de fragmento de traqueia, utilizando para a reação de PCR os oligonucleotídeos iniciadores F: 5’- CA TGT TCT TGG CCA CCTAT - 3’ e R:5’ - ATC CCT CAA TGA GCT GGT TC - 3' que amplificam um produto de 152 pb. Os produtos obtidos foram separados por eletrólise em gel de agarose. A visualização e fotodocumentação foram realizadas sob luz ultravioleta. Resultados e conclusões: A PCR possibilitou a detecção de camundongos positivos, sendo 38% da linhagem C57BL/6, 24% da linhagem BALB/c, 14% da linhagem heterogênica Swiss e 52% de ratos Wistar. Esses resultados sugerem que o emprego da técnica de PCR foi eficaz para o diagnóstico de Mycoplasma pulmonis em colônias de animais de laboratório. Certificado CEAU nº 251/11 HCFMUSP.

Objective: To introduce the PCR technique for detection of Mycoplasma pulmonis in conventional colony of mice inbred strains C5BL/6, BALB/c, outbred Swiss, and Whistar rats. Methods: DNA extraction was made from a fragment of the trachea, using the PCR primers F: 5’-CA TCT TGG TGT CCA CCTAT - 3’ and R:5’ - ATC CCT CAA TGA GCT GGT TC-3' which amplify a product of 152 bp. The products were separated by agarose gel electrophoresis. The viewing and photo documentation were performed under ultravioleta light. Results and Conclusion: The PCR allowed the detection of positive mice, 38% of C57BL/6, 24% of BALB/c 14% of Swiss and 52% of Wistar rats. These results suggest that the use of PCR technique was effective for the diagnosis of Mycoplasma pulmonis in colonies of laboratory animals. Certified CEAU nº 251/11 HCFMUSP.

Triagem de Helicobacter spp. em fezes de roedores de laboratório através da técnica de PCR / / Screening for Helicobacter spp inrodent feces laboratory using PCR technique

Este trabalho tem como objetivo otimizar a triagem da bactéria Helicobacter spp em programa de controle sanitário de animais de laboratório, aplicando a técnica de PCR (Polymerase Chain Reaction). Cinquenta amostras de fezes de cada linhagem ou espécie: camundongo C57BL/6, BALB/c, Swiss; ratos Wistar e Hamster foram submetidas à reação de PCR, utilizando os oligonucleotídeos iniciadores F: 5’ CTATGACGGGTATCCGGC 3' E R: 5' ATTCCACCTACCTCTCCCA 3' que amplificam um produto de 374 Este trabalho tem como objetivo otimizar a triagem da bactéria Helicobacter spp em programa de controle sanitário de animais de laboratório, aplicando a técnica de PCR (Polymerase Chain Reaction). Cinquenta amostras de fezes de cada linhagem ou espécie: camundongo C57BL/6, BALB/c, Swiss; ratos Wistar e Hamster foram submetidas à reação de PCR, utilizando os oligonucleotídeos iniciadores F: 5’ CTATGACGGGTApb. Separados por eletroforese em gel de agarose, os produtos foram visualizados e fotodocumentados sob luz ultravioleta.A técnica de PCR possibilitou a detecção de camundongos positivos, sendo 18% da linhagem C57BL/6, 52% da linhagem BALB/c, 62% da linhagem Swiss. Em ratos da linhagem Wistar, foram detectados 28% de positividade e em hamster, 44%. Esses resultados sugerem que a técnica de PCR empregada foi eficaz para a triagem de Helicobacter spp em colônias de animais de laboratório. Certificado CEAU nº 251/11 HCFMUSP.

This work aimed to optimize the screening of the bacterium Helicobacter spp in sanitary control program of laboratory animals, using the PCR (Polymerase Chain Reaction). Fifty stool samples from each strain or species: C57BL/6, BALB/c, Swiss, Hamster and Wistar rats were subjected to PCR using the primers F: 5’ CTATGACGGGTATCCGGC 3' and R: 5' ATTCCACCTACCTCTCCCA 3' that amplofy 374 bp product. Separated by agarose gel electrophoresis, products were visualized and photographed under ultraviolet light. The PCR technique allowed the detection of positive mice, 18% of C57BL/6, 52% of the strain BALB/c, 62% of Swiss strain. In Wistar rats were detected 28% ´possivity and hamster 44%. These results suggest that the PCR technique used was effective in screening for Helicobacter spp in colonies of laboratory animals. Certified CRAU Nº 251/11 HCFMUSP.

Triagem de Helicobacter spp. em fezes de roedores de laboratório através da técnica de PCR / / Screening for Helicobacter spp inrodent feces laboratory using PCR technique

Este trabalho tem como objetivo otimizar a triagem da bactéria Helicobacter spp em programa de controle sanitário de animais de laboratório, aplicando a técnica de PCR (Polymerase Chain Reaction). Cinquenta amostras de fezes de cada linhagem ou espécie: camundongo C57BL/6, BALB/c, Swiss; ratos Wistar e Hamster foram submetidas à reação de PCR, utilizando os oligonucleotídeos iniciadores F: 5 CTATGACGGGTATCCGGC 3' E R: 5' ATTCCACCTACCTCTCCCA 3' que amplificam um produto de 374 Este trabalho tem como objetivo otimizar a triagem da bactéria Helicobacter spp em programa de controle sanitário de animais de laboratório, aplicando a técnica de PCR (Polymerase Chain Reaction). Cinquenta amostras de fezes de cada linhagem ou espécie: camundongo C57BL/6, BALB/c, Swiss; ratos Wistar e Hamster foram submetidas à reação de PCR, utilizando os oligonucleotídeos iniciadores F: 5 CTATGACGGGTApb. Separados por eletroforese em gel de agarose, os produtos foram visualizados e fotodocumentados sob luz ultravioleta.A técnica de PCR possibilitou a detecção de camundongos positivos, sendo 18% da linhagem C57BL/6, 52% da linhagem BALB/c, 62% da linhagem Swiss. Em ratos da linhagem Wistar, foram detectados 28% de positividade e em hamster, 44%. Esses resultados sugerem que a técnica de PCR empregada foi eficaz para a triagem de Helicobacter spp em colônias de animais de laboratório. Certificado CEAU nº 251/11 HCFMUSP. (AU)

This work aimed to optimize the screening of the bacterium Helicobacter spp in sanitary control program of laboratory animals, using the PCR (Polymerase Chain Reaction). Fifty stool samples from each strain or species: C57BL/6, BALB/c, Swiss, Hamster and Wistar rats were subjected to PCR using the primers F: 5 CTATGACGGGTATCCGGC 3' and R: 5' ATTCCACCTACCTCTCCCA 3' that amplofy 374 bp product. Separated by agarose gel electrophoresis, products were visualized and photographed under ultraviolet light. The PCR technique allowed the detection of positive mice, 18% of C57BL/6, 52% of the strain BALB/c, 62% of Swiss strain. In Wistar rats were detected 28% ´possivity and hamster 44%. These results suggest that the PCR technique used was effective in screening for Helicobacter spp in colonies of laboratory animals. Certified CRAU Nº 251/11 HCFMUSP.(AU)

Detecção de Mycoplasma pulmonis no trato respiratório superior em roedores através da técnica de PCR / /Mycoplasma pulmonis detection in the rodents respiratoru tract by PCR

Objetivo: apresentar a técnica de PCR para a detecção de Mycoplasma pulmonis das colônias convencionais de camundongos das linhagens isogênicas C57BL/6, BALB/c e heterogênica Swiss, e ratos Wistar. Material e Métodos: A extração do DNA foi realizada a partir de fragmento de traqueia, utilizando para a reação de PCR os oligonucleotídeos iniciadores F: 5- CA TGT TCT TGG CCA CCTAT - 3 e R:5 - ATC CCT CAA TGA GCT GGT TC - 3' que amplificam um produto de 152 pb. Os produtos obtidos foram separados por eletrólise em gel de agarose. A visualização e fotodocumentação foram realizadas sob luz ultravioleta. Resultados e conclusões: A PCR possibilitou a detecção de camundongos positivos, sendo 38% da linhagem C57BL/6, 24% da linhagem BALB/c, 14% da linhagem heterogênica Swiss e 52% de ratos Wistar. Esses resultados sugerem que o emprego da técnica de PCR foi eficaz para o diagnóstico de Mycoplasma pulmonis em colônias de animais de laboratório. Certificado CEAU nº 251/11 HCFMUSP. (AU)

Objective: To introduce the PCR technique for detection of Mycoplasma pulmonis in conventional colony of mice inbred strains C5BL/6, BALB/c, outbred Swiss, and Whistar rats. Methods: DNA extraction was made from a fragment of the trachea, using the PCR primers F: 5-CA TCT TGG TGT CCA CCTAT - 3 and R:5 - ATC CCT CAA TGA GCT GGT TC-3' which amplify a product of 152 bp. The products were separated by agarose gel electrophoresis. The viewing and photo documentation were performed under ultravioleta light. Results and Conclusion: The PCR allowed the detection of positive mice, 38% of C57BL/6, 24% of BALB/c 14% of Swiss and 52% of Wistar rats. These results suggest that the use of PCR technique was effective for the diagnosis of Mycoplasma pulmonis in colonies of laboratory animals. Certified CEAU nº 251/11 HCFMUSP.(AU)

Perfil bioquímico dos animais de laboratório do biotério da Faculdade de Medicina da USP pt / / Biochemical profile of laboratory animals of the Medical School USP

Objetivo: Os parãmetros bioquímicos são utilizados em pesquisas cientificas, em conjunto com outros fatores, para análise dos resultados experimentais. Animais de laboratório criados em diferentes biotérios apresentam variações em seus valores devido a dieta, manejo, estado sanitário, idade, vias de coleta do sangue e outros interferentes. Desta forma, o objetivo deste trabalho foi determinar o perfil bioquímico de camundongos, ratos, hamsters e coelhos convencionais criados pelo Centro de bioterismo da FMUSP. Materiais e Métodos: Foram utilizados 20 camundongos das linhagens isogênicas BALB/c e C57Bl/6 e da heterogênica Swiss; 40 ratos Wistar, 40 hamsters Golden e 40 coelhos New Zealand. Os exames realizados foram: uréia/BUN (Blood Urea Nitrogen), creatinina, proteínas totais, albumina e globulinas, ferro, fósforo, glicose, colesterol total e suas frações LDI (Low Density Lipoprotein), HDL (High Density Lipoprotein), VLDL (Very Low Density Lipoprotein), Bilirrubina total e frações (direta, indireta), cloretos, magnésio, triglicerides, Alt/AST (alanina aminotransferase, aspartato aminotransaminase), amônia, cálcio, ALP (fosfatase alcalina) e LDH (desidrogenase lática), determinados por fotocolorimetria semi-automática (Cobas Mira) e kits bioclin, Labtest e Byosystems. Resultados: Apresentados pelas médias e os erros padrões das concentrações de analitos, no plasma, agrupados por sexo. Conclusão: Foram determinados os perfis bioquímicos de camundongos, ratos, hamsters e coelhos convencionais do centro de Bioterismo da FMUSP, oferecendo uma ferramenta valiosa aos pesquisadores ao analisar seus resultados experimentais. Certificado CEAU nº 251/11 HCFMUSP. (AU)

Objective: The biochemical parameters are used in scientific research in conjunction with other factors, to analyze the experimental results. Laboratory animals raised in different animal houses have variations in their values due to diet, management health status, age, the process of colecting blood and other interferences. Thus, the objective of this study was to created by conventional Bioterty Center FMUSP . Materials and Methods: We used 20 isogenic strains of mice BALB/6 and C57BL/6 and Swiss heterogeneous, 40 Wistat rats, 40 rabbits and 40 hamsters Golden New Zealand. The tests performed were: urea / BUN (Blood Urea Nitrogen), creatine, total protein, albumin and globulins, iron, phosphorus, glucose, total cholesterol and LDL (Low Density Lipoprotein), HDL (High Density Lipoprotein), VLDL (very Low Density Lipoprotein), total bilirubin and fractions (direct, indirect), chlondes, magnesium, triglucerides, ALT/AST (alanine aminotransferase, aspartate aminotransaminase), ammonium, calcium, ALP (alkaline phosphatase) and LDH (lactate denydrogenase), certain by semi-automatic spectrophotometer (Cobas Mira) and Bioclin kitas, and Labtest Biosystems. Results: Presented by the means and standard errors of the concentrations of analytes in plasma, grouped by sex. Conclusion: We determined the biochemical profiles of mice, rats, hamsters and rabbits conventional Biotery FMUSP Center, offering a valuable tool for researchers to analyze their experimental results. Certified No 251/11 CEAU HCFMUSP.(AU)

Estudo comparativo dos valores hematológicos entre sexo e categorias sanitárias de camundongos C57BL/6 e BALB/c / Hematological comparative study between sex and sanitary categories of C57BL/6 and BALB/C Mouse

A finalidade deste estudo é oferecer aos pesquisadores dados que possam ser relevantes na escolha do modelo experimental a ser utilizado, comparando os valores hematologicos de camundongos de linhagens isogênicas, mantidos em biotérios Convencional e SPF - (Specific Pathogen Free). foram utilizados 80 camundongos selecionados por categoria sanitária e sexo, sem sinais clínicos de doenças, acima de 10 semanas. O perfil gematológico analisado foi determinado pelo processo de citometria, no qual a separação de entrócitos e leucócitos ocorre por volume celular, sendo utilizada a identificação celular pelo método em suspensão e qualificação. Os exames realizados foram eitrograma e leucograma no equipamento (Celm CC510) e os derivados hematológicos como índices hematimétricos; a quantificação morfológica de leucócitos e eritrócitos foram determinadas por varredura (Panótico-comercial) e hemoglobina por espectrofolometria (Celm E210D). A comparação dos valores hematológicos de camundongos das linhagens isogênicas BALB/c e C57BL/6, mantidos em biotérios Convencional e SPF não apresentou diferenças entre os parâmetros: contagem de hemácias, hematoctiyo, hemoglobina corpuscular média; contagem de leucócitos, monócitos, linfócitos e basofilos. Os eosinófilos apresentam valores diferentes entre os secos e entre as categorias sanitárias, em ambas as linhagens. Os neutrófilos, nas fêmeas C57Bl/6, foram superiores em número, nos convencionais quando comparadas às fêmeas SPF. Certificado CEAU nº 251/11 HCFMUSP.(AU)

The purpose of this study was to provide researchers with data that may be relevant in the choice of experimental model to be used, comparing the haematological values of isogenic strains of mice kept in conventional animal facilities and SPF - (Specific Pathogen Free). 80 mice were used for selected health category and sex, without clinical signs of disease, over 10 weeks, The blood profile analysis was determined by flow cytometry process, where the separation of erythrocytes and leukocytes occurs by cell volume and is used to identify the cell suspension method and quantification. The tests were performed on the equipment erythrogram and WBC (Celma CC510) and RBC indices as derived from hematological, morphological quantification of leukocytes and erythrocytes were determined by scanning (Panótico-commercial) and hemoglobin by spectrophometry (Celm, E210D). Comparison of leukocytes occurs by cell volume and is used to identify the cell sushaematological values of isogenic strains of mice BALB/c and C57BL/6, kept in conventional animal facilities and SPF, showed no differences between the parameters: erythrocyte count, hematocrit, hemoglobin, mean corpuscular volume, mean corpuscular hemoglobin, hemoglobin concentration mean corpuscular; WBC, monocytes, lymphocytes, and basophils. Eosinophils showed different values between the sexes and between health categories, in both strains. Neutrophilis, in the female C57BL/6 were greater in number in females qhen compared to conventional SPF. Certified nº 251/11 CEAU HCFMUSP.(AU)

Núcleo de desenvolvimento em fertilização in vitro I. Estudo da resposta à superovulação e viabilidade embrionária / / Genter for development in vitro fertilization. I.Study of response to super ovulation and embryo viability

Este trabalho tem como objetivo implantar novas tecnologias na área de bioterismo, com a formação de um núcleo de desenvolvimento de Fertilização In Vitro (FIV) para criação de um banco de embriões de camundongos isogênicos, transgênicos ou "nocautes", estudando inicialmente a superovulação e viabilidade embrionária de diferentes linhagens de camundongos. As fêmeas com oito semanas foram estimuladas com os hormônios PMSG e HCG, em seguida, eutanasiadas para obtenção dos oócitos e os machos, das respectivas linhagens, foram também eutanasiados para obtenção dos espermatozóides. Após a fertilização in vitro, os embriões em duas células foram coletados e transferidos para fêmeas pseudográvidas. Os resultados da FIV mostraram que as linhagens 129sv ABR, CPA, C5BL/10 e ALOX apresentaram maior número de oócitos em relação às demais linhagens testadas: A/J, BALB/c IL-4, BALB/c SCID, C57BL/6 TLR2, CBA, C57BL/6 CD1, BALB/c CARECA, C57BL/6 IL-4 e C57BL/6 TLR4. Com relação ao - nº de oócitos/ nº de embriões em duas células - as linhagens A/J (42/30) e CBA (20/14), apesar de apresentarem um número de oócitos inferior quando comparamos com os animais da linhagem 129 (165/53), apresentaram um maior número de embriões em duas células. Com a linhagem C57BL/10.A, o número de oócitos (119) foi maior em comparação com a linhagem A/J e CBA, no entanto, o número de embriões em duas células obtidos pela linhagem C57BL/10.A (22) foi menor em comparação com os animais da linhagem A/J e CBA. A linhagem XPA, apresentou grande número de oócitos e também de embriões em duas células (116/76). A eficiência da FIV foi validada pelos primeiros nascimentos de embriões, obtidos com animais das linhagens C57BL/6 IL4, C57BL/6 TLR2 e da linhagem 129sv ABR. Em conjunto, os nossos resultados mostram que a resposta à superovulação é um fenômeno linhagem específico, além disso, dentro da particularidade de cada linhagem, os embriões que se diferenciaram em duas células são capazes de ser gerados em fêmeas receptoras e se desenvolveram até o nascimento. Com essa ferramenta, abrimos novas possibilidades de avanços tecnológicos na área de bioterismo. Certificado CEUA nº 098/11 HCFMUSP.(AU)

This study aimed to deploy new technologies in the Laboratory Animal Science, with the formation of a core development in vitro fertilization (IVF) to create an embryo bank of inbred mice, transgenic or “knockout”, initially studying the super ovulation and embryo viability of different strains of mice. Females 8 weeks, were stimulated with PMSG and HCG hormones then euthanized to obtain the oocytes and males, their lines were also euthanized to obtain sperm. After in vitro fertilization, the embryo into two cells were collected and transferred to pseudo-pregnant females. The IVF results showed that strains 129sv ABR, XPA, and C57BL/10.A ALOX had a higher number of oocytes compared with other tested strains: A/J, BALB/c IL-4, BALB/c SCID, C57BL/TLR2 6, CBA, C57BL/6 CD1, BALB/c BALD, C57BL/6 IL -4 and C57BL/6 TLR4. With respect to -n oocyte/embryo -n into two cells - the strains A/J (42/30) and CBA (20/14), although with a lower number of oocytes when compared with the strain 129 (165/53), showed a higher number of embryos in two cells. With the line C57BL/10.A, the number of oocytes (119) was higher in comparison with strain A/J and CBA, however, the number of two-cell embryos obtained by C57BL/10.A (22) was lower compared with animals from the strain A/J and CBA. The strain XPA, showed a large number of oocytes and embryos also two cells (116/76). The efficiency of IVF, has been validated by the first births of embryos obtained from animals of the strains C57BL/6 IL4, C57BL/6 and TLR2 strain 129sv ABR. Together, our results showed that the response to ovulation is a super strain-specific phenomenon, moreover, within the particularity of each strain, the embryos which differentiated into two cells are able to be generated in recipient females and develop to the birth. With this tool, we have opened new possibilities for technological advances in the Laboratory Animal Science. Certified CEUA Nº 098/11 HCFMUSP.(AU)