Nanostructured lipopeptide-based membranomimetics for stabilizing bacteriorhodopsin.

Nanostructured 7-9-residue cyclic and unstructured lipopeptide-based facial detergents have been engineered to stabilize the model integral membrane protein, bacteriorhodopsin. Formation of a cylindrical-type micelle assembly induced by facial amphipathic lipopeptides resembles a biological membrane more effectively than conventional micelles. The hydrophobic face of this cylindrical-type micelle provides extended stability to the membrane protein and the hydrophilic surface interacts with an aqueous environment. In our present study, we have demonstrated experimentally and computationally that lipopeptide-based facial detergents having an unstructured or ß-turn conformation can stabilize membrane proteins. However, constrained peptide detergents can provide enhanced stability to bacteriorhodopsin. In this study, we have computationally examined the structural stability of bacteriorhodopsin in the presence of helical, beta-strand, and cyclic unstructured peptide detergents, and conventional detergent-like peptides. Our study demonstrates that optimal membranomimetics (detergents) for stabilizing a specific membrane protein can be screened based on the following criteria: (i) hydrodynamic radii of the self-assembled peptide detergents, (ii) stability assay of detergent-encased membrane proteins, (iii) percentage covered area of detergent-encased membrane proteins obtained computationally and (iv) protein-detergent interaction energy.

Maturation of siRNA by strand separation: Steered molecular dynamics study.

RNA interference, particularly siRNA induced gene silencing is becoming an important avenue of modern therapeutics. The siRNA is delivered to the cells as short double helical RNA which becomes single stranded for forming the RISC complex. Significant experimental evidence is available for most of the steps except the process of the separation of the two strands. We have attempted to understand the pathway for double stranded siRNA (dsRNA) to single stranded (ssRNA) molecules using steered molecular dynamics simulations. As the process is completely unexplored we have applied force from all possible directions restraining all possible residues to convert dsRNA to ssRNA. We found pulling one strand along the helical axis direction restraining the far end of the other strand demands excessive force for ssRNA formation. Pulling a central residue of one strand, in a direction perpendicular to the helix axis, while keeping the base paired residue fixed requires intermediate force for strand separation. Moreover, we found that in this process the force requirement is quite high for the first bubble formation (nucleation energy) and the bubble propagation energies are quite small. We believe the success rate of the design of siRNA sequences for gene silencing may increase if this mechanistic knowledge is utilized for such a design process.Communicated by Ramaswamy H. Sarma.

Engineered Histidine-Enriched Facial Lipopeptides for Enhanced Intracellular Delivery of Functional siRNA to Triple Negative Breast Cancer Cells.

Cytosolic delivery of functional siRNA remains the major challenge to develop siRNA-based therapeutics. Designing clinically safe and effective siRNA transporter to deliver functional siRNA across the plasma and endosomal membrane remains a key hurdle. With the aim of improving endosomal release, we have designed cyclic and linear peptide-based transporters having an Arg-DHis-Arg template. Computational studies show that the Arg-DHis-Arg template is also stabilized by the Arg-His side-chain hydrogen bonding interaction at physiological pH, which dissociates at lower pH. The overall atomistic interactions were examined by molecular dynamics simulations, which indicate that the extent of peptide_siRNA assembly formation depends greatly on physicochemical properties of the peptides. Our designed peptides having the Arg-DHis-Arg template and two lipidic moieties facilitate high yield of intracellular delivery of siRNA. Additionally, unsaturated lipid, linoleic acid moieties were introduced to promote fusogenicity and facilitate endosomal release and cytosolic delivery. Interestingly, such protease-resistant peptides provide serum stability to siRNA and exhibit high efficacy of erk1 and erk2 gene silencing in the triple negative breast cancer (TNBC) cell line. The peptide having two linoleyl moieties demonstrated comparable efficacy with commercial transfection reagent HiPerFect, as evidenced by the erk1 and erk2 gene knockdown experiment. Additionally, our study shows that ERK1/2 silencing siRNA and doxorubicin-loaded gramicidin-mediated combination therapy is more effective than siRNA-mediated gene silencing-based monotherapy for TNBC treatment.

Deciphering complex dynamics of water counteraction around secondary structural elements of allosteric protein complex: Case study of SAP-SLAM system in signal transduction cascade.

The first hydration shell of a protein exhibits heterogeneous behavior owing to several attributes, majorly local polarity and structural flexibility as revealed by solvation dynamics of secondary structural elements. We attempt to recognize the change in complex water counteraction generated due to substantial alteration in flexibility during protein complex formation. The investigation is carried out with the signaling lymphocytic activation molecule (SLAM) family of receptors, expressed by an array of immune cells, and interacting with SLAM-associated protein (SAP), composed of one SH2 domain. All atom molecular dynamics simulations are employed to the aqueous solutions of free SAP and SLAM-peptide bound SAP. We observed that water dynamics around different secondary structural elements became highly affected as well as nicely correlated with the SLAM-peptide induced change in structural rigidity obtained by thermodynamic quantification. A few instances of contradictory dynamic features of water to the change in structural flexibility are explained by means of occluded polar residues by the peptide. For ßD, EFloop, and BGloop, both structural flexibility and solvent accessibility of the residues confirm the obvious contribution. Most importantly, we have quantified enhanced restriction in water dynamics around the second Fyn-binding site of the SAP due to SAP-SLAM complexation, even prior to the presence of Fyn. This observation leads to a novel argument that SLAM induced more restricted water molecules could offer more water entropic contribution during the subsequent Fyn binding and provide enhanced stability to the SAP-Fyn complex in the signaling cascade. Finally, SLAM induced water counteraction around the second binding site of the SAP sheds light on the allosteric property of the SAP, which becomes an integral part of the underlying signal transduction mechanism.

Co-operative intra-protein structural response due to protein-protein complexation revealed through thermodynamic quantification: study of MDM2-p53 binding.

The p53 protein activation protects the organism from propagation of cells with damaged DNA having oncogenic mutations. In normal cells, activity of p53 is controlled by interaction with MDM2. The well understood p53-MDM2 interaction facilitates design of ligands that could potentially disrupt or prevent the complexation owing to its emergence as an important objective for cancer therapy. However, thermodynamic quantification of the p53-peptide induced structural changes of the MDM2-protein remains an area to be explored. This study attempts to understand the conformational free energy and entropy costs due to this complex formation from the histograms of dihedral angles generated from molecular dynamics simulations. Residue-specific quantification illustrates that, hydrophobic residues of the protein contribute maximum to the conformational thermodynamic changes. Thermodynamic quantification of structural changes of the protein unfold the fact that, p53 binding provides a source of inter-element cooperativity among the protein secondary structural elements, where the highest affected structural elements (α2 and α4) found at the binding site of the protein affects faraway structural elements (ß1 and Loop1) of the protein. The communication perhaps involves water mediated hydrogen bonded network formation. Further, we infer that in inhibitory F19A mutation of P53, though Phe19 is important in the recognition process, it has less prominent contribution in the stability of the complex. Collectively, this study provides vivid microscopic understanding of the interaction within the protein complex along with exploring mutation sites, which will contribute further to engineer the protein function and binding affinity.

Engineered isopeptide bond stabilized fibrin inspired nanoscale peptide based sealants for efficient blood clotting.

Designing biologically inspired nanoscale molecular assembly with desired functionality is a challenging endeavour. Here we report the designing of fibrin-inspired nanostructured peptide based sealants which facilitate remarkably fast entrapping of blood corpuscles (~28 seconds) in contrast to fibrin (~56 seconds). Our engineered sealants are stabilized by lysine-aspartate ionic interactions and also by Nε(γ-glutamyl) lysine isopeptide bond mediated covalent interaction. Each sealant is formed by two peptides having complementary charges to promote lysine-aspartate ionic interactions and designed isopeptide bond mediated interactions. Computational analysis reveals the isopeptide bond mediated energetically favourable peptide assemblies in sealants 1-3. Our designed sealants 2 and 3 mimic fibrin-mediated clot formation mechanism in presence of transglutaminase enzyme and blood corpuscles. These fibrin-inspired peptides assemble to form sealants having superior hemostatic activities than fibrin. Designed sealants feature mechanical properties, biocompatibility, biodegradability and high adhesive strength. Such nature-inspired robust sealants might be potentially translated into clinics for facilitating efficient blood clotting to handle traumatic coagulopathy and impaired blood clotting.

Melting of polymeric DNA double helix at elevated temperature: a molecular dynamics approach.

Genomic DNA of higher organisms exists as extremely long polymers, while in bacteria and other lower organisms it is circular with no terminal base pairs. Temperature-induced melting of the DNA double helix by localized strand separation has been unattainable by molecular dynamic simulations due to more rapid fraying of the terminal base pairs in oligomeric DNA. However, local-sequence-dependent unfolding of the DNA double helix is extremely important for understanding various biochemical phenomena, and can be addressed by simulating a model polymeric DNA duplex. Here, we present simulations of polymeric B-DNA of sequence d(CGCGCGCGAATTCGCGCGCG)2 at elevated temperatures, along with its equivalent oligomeric constructs for comparison. Initiation of temperature-induced DNA melting was observed with higher fluctuations of the central d(AATT) region only in the model polymer. The polymeric construct shows a definite melting start site at the weaker A/T stretch, which propagates slowly through the CG rich regions. The melting is reflected in the hydrogen bond breaking, i.e. basepair opening, and by disruption of stacking interaction between successive basepairs. Melting at higher temperature of the oligomer, however, was only through terminal fraying, as also reported earlier.

Microscopic insight into thermodynamics of conformational changes of SAP-SLAM complex in signal transduction cascade.

The signalling lymphocytic activation molecule (SLAM) family of receptors, expressed by an array of immune cells, associate with SLAM-associated protein (SAP)-related molecules, composed of single SH2 domain architecture. SAP activates Src-family kinase Fyn after SLAM ligation, resulting in a SLAM-SAP-Fyn complex, where, SAP binds the Fyn SH3 domain that does not involve canonical SH3 or SH2 interactions. This demands insight into this SAP mediated signalling cascade. Thermodynamics of the conformational changes are extracted from the histograms of dihedral angles obtained from the all-atom molecular dynamics simulations of this structurally well characterized SAP-SLAM complex. The results incorporate the binding induced thermodynamic changes of individual amino acid as well as the secondary structural elements of the protein and the solvent. Stabilization of the peptide partially comes through a strong hydrogen bonding network with the protein, while hydrophobic interactions also play a significant role where the peptide inserts itself into a hydrophobic cavity of the protein. SLAM binding widens SAP's second binding site for Fyn, which is the next step in the signal transduction cascade. The higher stabilization and less fluctuation of specific residues of SAP in the Fyn binding site, induced by SAP-SLAM complexation, emerge as the key structural elements to trigger the recognition of SAP by the SH3 domain of Fyn. The thermodynamic quantification of the protein due to complexation not only throws deeper understanding in the established mode of SAP-SLAM interaction but also assists in the recognition of the relevant residues of the protein responsible for alterations in its activity.

Effect of temperature on the structure and hydration layer of TATA-box DNA: A molecular dynamics simulation study.

DNA within the living cells experiences a diverse range of temperature, ranging from freezing condition to hot spring water. How the structure, the mechanical properties of DNA, and the solvation dynamics around DNA changes with the temperature is important to understand the functionality of DNA under those acute temperature conditions. In that notion, we have carried out molecular dynamics simulations of a DNA oligomer, containing TATA-box sequence for three different temperatures (250K, 300K and 350K). We observed that the structure of the DNA, in terms of backbone torsion angles, sugar pucker, base pair parameters, and base pair step parameters, did not show any unusual properties within the studied range of temperatures, but significant structural alteration was noticed between BI and BII forms at higher temperature. As expected, the flexibility of the DNA, in terms of the torsional rigidity and the bending rigidity is highly temperature dependent, confirming that flexibility increases with increase in temperature. Additionally, the groove widths of the studied DNA showed temperature sensitivity, specifically, the major groove width decreases and the minor groove width increases, respectively, with the increase in temperature. We observed that at higher temperature, water around both the major and the minor groove of the DNA is less structured. However, the water dynamics around the minor groove of the DNA is more restricted as compared to the water around the major groove throughout the studied range of temperatures, without any anomalous behavior.

Stacking geometry for non-canonical G:U wobble base pair containing dinucleotide sequences in RNA: dispersion-corrected DFT-D study.

Emergence of thousands of crystal structures of noncoding RNA molecules indicates its structural and functional diversity. RNA function is based upon a large variety of structural elements which are specifically assembled in the folded molecules. Along with the canonical Watson-Crick base pairs, different orientations of the bases to form hydrogen-bonded non-canonical base pairs have also been observed in the available RNA structures. Frequencies of occurrences of different non-canonical base pairs in RNA indicate their important role to maintain overall structure and functions of RNA. There are several reports on geometry and energetic stabilities of these non-canonical base pairs. However, their stacking geometry and stacking stability with the neighboring base pairs are not well studied. Among the different non-canonical base pairs, the G:U wobble base pair (G:U W:WC) is most frequently observed in the RNA double helices. Using quantum chemical method and available experimental data set we have studied the stacking geometry of G:U W:WC base pair containing dinucleotide sequences in roll-slide parameters hyperspace for different values of twist. This study indicates that the G:U W:WC base pair can stack well with the canonical base pairs giving rise to large interaction energy. The overall preferred stacking geometry in terms of roll, twist and slide for the eleven possible dinucleotide sequences is seen to be quite dependent on their sequences.

Stacking interactions in RNA and DNA: Roll-slide energy hyperspace for ten unique dinucleotide steps.

Understanding dinucleotide sequence directed structures of nuleic acids and their variability from experimental observation remained ineffective due to unavailability of statistically meaningful data. We have attempted to understand this from energy scan along twist, roll, and slide degrees of freedom which are mostly dependent on dinucleotide sequence using ab initio density functional theory. We have carried out stacking energy analysis in these dinucleotide parameter phase space for all ten unique dinucleotide steps in DNA and RNA using DFT-D by ωB97X-D/6-31G(2d,2p), which appears to satisfactorily explain conformational preferences for AU/AU step in our recent study. We show that values of roll, slide, and twist of most of the dinucleotide sequences in crystal structures fall in the low energy region. The minimum energy regions with large twist values are associated with the roll and slide values of B-DNA, whereas, smaller twist values correspond to higher stability to RNA and A-DNA like conformations. Incorporation of solvent effect by CPCM method could explain the preference shown by some sequences to occur in B-DNA or A-DNA conformations. Conformational preference of BII sub-state in B-DNA is preferentially displayed mainly by pyrimidine-purine steps and partly by purine-purine steps. The purine-pyrimidine steps show largest effect of 5-methyl group of thymine in stacking energy and the introduction of solvent reduces this effect significantly. These predicted structures and variabilities can explain the effect of sequence on DNA and RNA functionality.

Contribution of phenylalanine side chain intercalation to the TATA-box binding protein-DNA interaction: molecular dynamics and dispersion-corrected density functional theory studies.

Deformation of DNA takes place quite often due to binding of small molecules or proteins with DNA. Such deformation is significant due to minor groove binding and, besides electrostatic interactions, other non-covalent interactions may also play an important role in generating such deformation. TATA-box binding protein (TBP) binds to the minor groove of DNA at the TATA box sequence, producing a large-scale deformation in DNA and initiating transcription. In order to observe the interactions of protein residues with DNA in the minor groove that produce the deformation in the DNA structure, we carried out molecular dynamics simulations of the TBP-DNA system. The results reveal consistent partial intercalation of two Phe residues, distorting stacking interactions at two dinucleotide step sites. We carried out calculations based on dispersion-corrected density functional theory to understand the source of such stabilization. We observed favorable interaction energies between the Phe residues and the base pairs with which they interact. We suggest that salt-bridge interactions between the phosphate groups and Lys or Arg residues, along with the intercalation of Phe residues between two base pair stacks, stabilize the kinked and opened-up DNA conformation.

Temperature effect on poly(dA).poly(dT): molecular dynamics simulation studies of polymeric and oligomeric constructs.

Understanding unwinding and melting of double helical DNA is very important to characterize role of DNA in replication, transcription, translation etc. Sequence dependent melting thermodynamics is used extensively for detecting promoter regions but melting studies are generally done for short oligonucleotides. This study reports several molecular dynamics (MD) simulations of homopolymeric poly(dA).poly(dT) as regular oligonucleotide fragments as well as its corresponding polymeric constructs with water and charge-neutralizing counterions at different temperatures ranging from 300 to 400 K. We have eliminated the end-effect or terminal peeling propensity by employing MD simulation of DNA oligonucleotides in such a manner that gives rise to properties of polymeric DNA of infinite length. The dynamic properties such as basepairing and stacking geometry, groove width, backbone conformational parameters, bending, distribution of counter ions and number of hydrogen bonds of oligomeric and polymeric constructs of poly(dA).poly(dT) have been analyzed. The oligomer shows terminal fraying or peeling effect at temperatures above 340 K. The polymer shows partial melting at elevated temperatures although complete denaturations of basepairs do not take place. The analysis of cross strand hydrogen bonds shows that the number of N-H···O hydrogen bonds increases with increase in temperature while C-H···O hydrogen bond frequencies decrease with temperature. Restructuring of counterions in the minor groove with temperature appear as initiation of melting in duplex structures.

Energy hyperspace for stacking interaction in AU/AU dinucleotide step: Dispersion-corrected density functional theory study.

Double helical structures of DNA and RNA are mostly determined by base pair stacking interactions, which give them the base sequence-directed features, such as small roll values for the purine-pyrimidine steps. Earlier attempts to characterize stacking interactions were mostly restricted to calculations on fiber diffraction geometries or optimized structure using ab initio calculations lacking variation in geometry to comment on rather unusual large roll values observed in AU/AU base pair step in crystal structures of RNA double helices. We have generated stacking energy hyperspace by modeling geometries with variations along the important degrees of freedom, roll, and slide, which were chosen via statistical analysis as maximally sequence dependent. Corresponding energy contours were constructed by several quantum chemical methods including dispersion corrections. This analysis established the most suitable methods for stacked base pair systems despite the limitation imparted by number of atom in a base pair step to employ very high level of theory. All the methods predict negative roll value and near-zero slide to be most favorable for the purine-pyrimidine steps, in agreement with Calladine's steric clash based rule. Successive base pairs in RNA are always linked by sugar-phosphate backbone with C3'-endo sugars and this demands C1'-C1' distance of about 5.4 Å along the chains. Consideration of an energy penalty term for deviation of C1'-C1' distance from the mean value, to the recent DFT-D functionals, specifically ωB97X-D appears to predict reliable energy contour for AU/AU step. Such distance-based penalty improves energy contours for the other purine-pyrimidine sequences also. © 2013 Wiley Periodicals, Inc. Biopolymers 101: 107-120, 2014.

Influence of divalent magnesium ion on DNA: molecular dynamics simulation studies.

A large amount of experimental evidence is available on the effect of magnesium ions on the structure and stability of DNA double helix. Less is known, however, on how these ions affect the stability and dynamics of the molecule. The static time average pictures from X-ray structures or the quantum chemical energy minimized structures lack understanding of the dynamic DNA-ion interaction. The present work addresses these questions by molecular dynamics simulation studies on two DNA duplexes and their interaction with magnesium ions. Results show typical B-DNA character with occasional excursions to deviated states. We detected expected stability of the duplexes in terms of backbone conformations and base pair parameter by the CHARMM-27 force field. Ion environment analysis shows that Mg²âº retains the coordination sphere throughout the simulation with a preference for major groove over minor. An extensive analysis of the influence of the Mg²âº ion shows no evidence of the popular predictions of groove width narrowing by dipositive metal ion. The major groove atoms show higher occupancy and residence time compared to minor groove for magnesium, where no such distinction is found for the charge neutralizing Na⁺ ions. The determining factor of Mg²âº ion's choice in DNA binding site evolves as the steric hindrance faced by the bulky hexahydrated cation where wider major groove gets the preference. We have shown that in case of binding of Mg²âº to DNA non electrostatic contributions play a major role. An animated Interactive 3D Complement (I3DC) is available in Proteopedia at http://proteopedia.org/w/Journal:JBSD:5.

Rab7 mutants associated with Charcot-Marie-Tooth disease cause delayed growth factor receptor transport and altered endosomal and nuclear signaling.

Rab7 belongs to the Ras superfamily of small GTPases and is a master regulator of early to late endocytic membrane transport. Four missense mutations in the late endosomal Rab7 GTPase (L129F, K157N, N161T, and V162M) cause the autosomal dominant peripheral neuropathy Charcot-Marie-Tooth type 2B (CMT2B) disease. As yet, the pathological mechanisms connecting mutant Rab7 protein expression to altered neuronal function are undefined. Here, we analyze the effects of Rab7 CMT2B mutants on epidermal growth factor (EGF)-dependent intracellular signaling and trafficking. Three different cell lines expressing Rab7 CMT2B mutants and stimulated with EGF exhibited delayed trafficking of EGF to LAMP1-positive late endosomes and lysosomes and slowed EGF receptor (EGFR) degradation. Expression of all Rab7 CMT2B mutants altered the Rab7 activation cycle, leading to enhanced and prolonged EGFR signaling as well as variable increases in p38 and ERK1/2 activation. However, due to reduced nuclear translocation of p38 and ERK1/2, the downstream nuclear activation of Elk-1 was decreased along with the expression of immediate early genes like c-fos and Egr-1 by the disease mutants. In conclusion, our results demonstrate that Rab7 CMT2B mutants impair growth factor receptor trafficking and, in turn, alter p38 and ERK1/2 signaling from perinuclear, clustered signaling endosomes. The resulting down-regulation of EGFR-dependent nuclear transcription that is crucial for normal axon outgrowth and peripheral innervation offers a crucial new mechanistic insight into disease pathogenesis that is relevant to other neurodegenerative diseases.

Effect of temperature on DNA double helix: An insight from molecular dynamics simulation.

The three-dimensional structure of DNA contains various sequence-dependent structural information, which control many cellular processes in life, such as replication, transcription, DNA repair, etc. For the above functions, DNA double helices need to unwind or melt locally, which is different from terminal melting, as often seen in molecular dynamics (MD) simulations or even in many DNA crystal structures. We have carried out detailed MD simulations of DNA double helices of regular oligonucleotide fragments as well as in polymeric constructs with water and charge-neutralizing counter-ions at several different temperatures. We wanted to eliminate the end-effect or terminal melting propensity by employing MD simulation of DNA oligonucleotides in such a manner that gives rise to properties of polymeric DNA of infinite length. The polymeric construct is expected to allow us to see local melting at elevated temperatures. Comparative structural analysis of oligonucleotides and its corresponding virtual polymer at various temperatures ranging from 300 K to 400 K is discussed. The general behaviour, such as volume expansion coefficients of both the simulations show high similarity, indicating polymeric construct, does not give many artificial constraints. Local melting of a polymer, even at elevated temperature, may need a high nucleation energy that was not available in the short (7 ns) simulations. We expected to observe such nucleation followed by cooperative melting of the polymers in longer MD runs. Such simulations of different polymeric sequences would facilitate us to predict probable melting origins in a polymeric DNA.

Rab7 mutants associated with Charcot-Marie-Tooth disease exhibit enhanced NGF-stimulated signaling.

Missense mutants in the late endosomal Rab7 GTPase cause the autosomal dominant peripheral neuropathy Charcot-Marie-Tooth disease type 2B (CMT2B). As yet, the pathological mechanisms connecting mutant Rab7 protein expression to altered neuronal function are undefined. Here, we analyze the effects Rab7 CMT2B mutants on nerve growth factor (NGF) dependent intracellular signaling in PC12 cells. The nerve growth factor receptor TrkA interacted similarly with Rab7 wild-type and CMT2B mutant proteins, but the mutant proteins significantly enhanced TrkA phosphorylation in response to brief NGF stimulation. Two downstream signaling pathways (Erk1/2 and Akt) that are directly activated in response to phospho-TrkA were differentially affected. Akt signaling, arising in response to activated TrkA at the plasma membrane was unaffected. However Erk1/2 phosphorylation, triggered on signaling endosomes, was increased. Cytoplasmic phospho-Erk1/2 persisted at elevated levels relative to control samples for up to 24 h following NGF stimulation. Nuclear shuttling of phospho Erk1/2, which is required to induce MAPK phosphatase expression and down regulate signaling, was greatly reduced by the Rab7 CMT2B mutants and explains the previously reported inhibition in PC12 neurite outgrowth. In conclusion, the data demonstrate a mechanistic link between Rab7 CMT2B mutants and altered TrkA and Erk1/2 signaling from endosomes.

Mutational analysis of the intramembranous H10 loop of yeast Nhx1 reveals a critical role in ion homoeostasis and vesicle trafficking.

Yeast Nhx1 [Na+(K+)/H+ exchanger 1] is an intracellular Na+(K+)/H+ exchanger, localizing to the late endosome where it is important for ion homoeostasis and vesicle trafficking. Phylogenetic analysis of NHE (Na+/H+ exchanger) sequences has identified orthologous proteins, including HsNHE6 (human NHE6), HsNHE7 and HsNHE9 of unknown physiological role. These appear distinct from well-studied mammalian plasma membrane isoforms (NHE1-NHE5). To explore the differences between plasma membrane and intracellular NHEs and understand the link between ion homoeostasis and vesicle trafficking, we examined the consequence of replacing residues in the intramembranous H10 loop of Nhx1 between transmembrane segments 9 and 10. The critical role for the carboxy group of Glu355 in ion transport is consistent with the invariance of this residue in all NHEs. Surprisingly, residues specifically conserved in the intracellular isoforms (such as Phe357 and Tyr361) could not be replaced with closely similar residues (leucine and phenylalanine) found in the plasma membrane isoforms without loss of function, revealing unexpected side chain specificity. The trafficking phenotypes of all Nhx1 mutants, including hygromycin-sensitivity and missorting of carboxypeptidase Y, were found to directly correlate with pH homoeostasis defects and could be proportionately corrected by titration with weak base. The present study demonstrates the importance of the H10 loop of the NHE family, highlights the differences between plasma membrane and intracellular isoforms and shows that trafficking defects are tightly coupled with pH homoeostasis.

Vesicular trafficking of tyrosine kinase receptors and associated proteins in the regulation of signaling and vascular function.

Receptor tyrosine kinases (RTKs) play a pivotal role in the development and function of the cardiovascular system. Ligand-activated RTKs promote numerous downstream signal transduction pathways that lead to vascular permeability, as well as proliferation, migration, and differentiation of vascular endothelia and smooth muscle cells. Ligand binding also promotes internalization of the activated receptors either to downregulate the signaling via degradation of the ligand/receptor complex or to signal from endosomes. However, the outcomes of receptor internalization via clathrin-dependent or caveolar pathways and trafficking mechanisms are incompletely clarified in vascular systems. Activity modulation through endocytosis and vesicular trafficking significantly impacts downstream targets of RTKs such as endothelial nitric oxide synthase (eNOS) and VE-cadherin. RTKs and their associated targets are also transported to the nucleus, where they may directly impact nuclear signaling. Although the nuclear transport pathways are just beginning to be unraveled, it appears that endocytosis and vesicular trafficking are involved. In this review, we discuss the mechanisms by which activated RTKs and the downstream targets eNOS and VE-cadherin may be internalized and transported to various intracellular compartments. How localization and interacting proteins impact protein function and influence signaling is an important theme, as is the potential for modulating signaling through therapeutic targeting of activated receptors and components of the endocytic machinery.