RESUMO
Pilocytic astrocytomas (PAs) are the most common pediatric central nervous system tumors. They constitute around 30% of all primary central nervous tumors in the pediatric age group. Their clinical behavior may vary but most of them are indolent and do not undergo malignant transformations compared with their adult counterparts. PAs are primarily treated with surgery and in cases of progression; chemotherapy may be needed. They usually carry a good prognosis, with a 10-year survival rate of 90%. BRAFV600E mutations have been identified in approximately 9-15% of patients with PA. These relatively high mutation frequencies in PA open avenues for treatment using targeted therapies such as BRAFV600E inhibitors (e.g., dabrafenib). There have been a few published case reports and case series showing clinical benefits with BRAF inhibitors in BRAF-positive tumors. We report a case of successful treatment of BRAFV600E immunopositive optic pathway PA in a child with dabrafenib.
Assuntos
Astrocitoma , Neoplasias Encefálicas , Adulto , Astrocitoma/diagnóstico por imagem , Astrocitoma/tratamento farmacológico , Astrocitoma/genética , Neoplasias Encefálicas/diagnóstico por imagem , Neoplasias Encefálicas/tratamento farmacológico , Neoplasias Encefálicas/genética , Criança , Humanos , Imidazóis/uso terapêutico , Mutação , Oximas/uso terapêutico , Proteínas Proto-Oncogênicas B-raf/genéticaRESUMO
A grid-connected photovoltaic (PV) system operates under fluctuated weather condition has been modeled and characterized based on specific test bed. A mathematical model of a small-scale PV system has been developed mainly for residential usage, and the potential results have been simulated. The proposed PV model based on three PV parameters, which are the photocurrent, IL, the reverse diode saturation current, Io, the ideality factor of diode, n. Accuracy of the proposed model and its parameters evaluated based on different benchmarks. The results showed that the proposed model fitting the experimental results with high accuracy compare to the other models, as well as the I-V characteristic curve. The results of this study can be considered valuable in terms of the installation of a grid-connected PV system in fluctuated climatic conditions.
Assuntos
Modelos Teóricos , Energia SolarRESUMO
BACKGROUND: Multi-factorial etiology exists in pathophysiology of neurodegenerative diseases. The imbalance of anti-oxidant enzymes and dopamine level leads to Parkinsonism. The objective of this study was to assess the protective effect of Spirulina fusiform alone and in combination with amantadine against Parkinsonism effect in 6-hydroxydopamine (6-OHDA) induced rat model. METHODS: S. fusiform was administered in different groups (500 mg/kg, once daily and twice daily) and a combination of spirulina (500 mg/kg, once daily) with amantadine (20 mg/kg once daily) for 30 days before and 14 days after a single injection of 6-OHDA into the dorsal striatum. Post lesion produced rotational behavior which was measured at two week intervals (37th and 44th day). Locomotors activity was also done at 44th and muscle coordination at 48th day. Dorsal striatum was isolated from rat brain for evaluating the antioxidant assays and dopamine content at 49th day. RESULTS: Both the body rotations (ipsilateral and contralateral) were found to have a statistically significant (p<0.001) decrease by 34.26 and 52% after treatment with spirulina (Twice a day) in spirulina treated lesioned group. A higher percentage of improvement was shown in the reduction of ipsilateral (57.34%) and contralateral (78.3%) rotations in combination of spirulina with amantadine treated lesioned group rather than spirulina alone treated lesioned groups when compared with positive control lesioned group. Body movements and locomotor activity were improved statistically (p<0.0001) significant in both treated lesioned groups (Combination of spirulina with amantadine and spirulina twice daily). Similar results were also seen in anti-oxidant levels which later on reached to the normal value. The levels of dopamine content had a statistically significant (p<0.0001) increase by 78.3% only in case of spirulina with amantadine treated lesioned group. CONCLUSION: Spirulina is a potent nutraceutical supplement all over the world, so my preclinical study may contribute to give an additional adjuvant drug therapy in aging related disorders (Neurodegenerative as well as diabetes associated neurodegenerative disorders).
Assuntos
Amantadina/farmacologia , Suplementos Nutricionais , Fármacos Neuroprotetores/farmacologia , Transtornos Parkinsonianos , Spirulina , Animais , Oxidopamina , Transtornos Parkinsonianos/induzido quimicamente , Transtornos Parkinsonianos/fisiopatologia , RatosRESUMO
BACKGROUND: Airway dendritic cells (DC) are critical mediators of lung inflammation in asthma, but the characteristics of DC in the airways of healthy children, and children with asthma, are currently unknown. OBJECTIVE: We sought to identify changes in DC subset distribution and activation profile in paediatric asthma using flow cytometry to analyse induced sputum samples obtained from healthy and asthmatic children. METHODS: Lung function and atopic status were determined by spirometry and skin prick testing. Induced sputum samples were analysed using 7-colour flow cytometry to identify airway DC populations (lineage(-) HLA-DR(+) sputum cells expressing either CD11c as conventional DC or CD123 as plasmacytoid DC). RESULTS: Sputum samples containing lower airway plugs were obtained from 10 healthy children and 8 children with asthma. Lineage(-) HLA-DR(+) DC were successfully identified in all samples, and DC comprised a significantly higher proportion of sputum cells in children with asthma compared with age-matched healthy controls (1.29% vs. 0.67%, P = 0.02). DC expression of the costimulatory marker CD86 was significantly reduced in asthmatic children (73.4% vs. 59.7%, P = 0.04). Sputum DC also included numerous CD1c(+) cells (mean 57% of the total DC population) and low frequencies of cells expressing the subset markers CD141 or CD123, although the proportions of these did not differ between groups. CONCLUSIONS: Airway DC can be identified and characterized non-invasively using flow cytometry to analyse paediatric sputum samples. Our data reveal that children with steroid-treated asthma exhibit increased frequency of airway DC with reduced expression of the costimulatory marker CD86, suggesting altered trafficking and/or maturation of these cells either due to asthma or steroid therapies.
Assuntos
Asma/imunologia , Células Dendríticas/imunologia , Administração por Inalação , Asma/diagnóstico , Asma/tratamento farmacológico , Asma/metabolismo , Antígeno B7-2/metabolismo , Antígeno CD11c/metabolismo , Estudos de Casos e Controles , Criança , Células Dendríticas/metabolismo , Eosinofilia/imunologia , Feminino , Humanos , Imunofenotipagem , Contagem de Leucócitos , Masculino , Fenótipo , Escarro/citologia , Escarro/imunologia , Esteroides/administração & dosagem , Esteroides/uso terapêuticoRESUMO
BACKGROUND: Cross-match practice for patients with femoral neck fractures continues to cause concern due to a failure of compliance to the existing protocols. To address this issue, a number of studies were conducted over a 3-year period. METHODS: First, the existing cross-match practice for patients admitted with femoral neck fractures was reviewed to demonstrate the deficiencies within the system. Second, the opinion of anaesthetic and orthopaedic trainees was assessed regarding blood requirements for different femoral neck fractures following surgery and the justification of their perceptions. RESULTS: A summation of the studies is reported which demonstrates the reasons for the poor compliance to previous protocols. CONCLUSIONS: A simple and effective protocol is provided that has helped reduce pre-operative cross-matching of femoral neck fractures from 71% to 16.7% when assessed 2 years after its introduction.
Assuntos
Tipagem e Reações Cruzadas Sanguíneas/métodos , Transfusão de Sangue/métodos , Fraturas do Colo Femoral/cirurgia , Protocolos Clínicos , Hemoglobinas/análise , HumanosRESUMO
Nicotinic acid and its related compounds are well known lipid lowering agents but the use of nicotinic acid in clinical practice is limited because of its side effects. To reduce the unwanted effects, new derivatives of nicotinic acid have been synthesized and tested in control and pathological animals for their antilipoproteinemic effects. Two newly synthesized derivatives of nicotinic acid i.e. 3-methoxy phenacyl nicotinium bromide (T1) and 2-methoxy phenacyl nicotinium bromide (T2) have been screened for their hypolipoproteinemic effects in white male rabbits. The compounds were administered in the doses of 30 mg/day and the results were compared with aspirin taken as the reference drug. The present work revealed that both of these synthesize compounds exhibited marked effects on plasma lipoproteins assuming that these compounds exerted their action by inhibiting hepatic production of very low density lipoprotins (VLDL), ultimately leading to reduction in low density lipoprotein. Clofibrate and aspirin are taken as standards to evaluate the potentials of these agents for their effects on lipid.
RESUMO
BACKGROUND: Grandmultiparity has been associated with complications for both mother and the fetus. OBJECTIVE: To evaluate if grandmultiparity is a risk factor in the presence of adequate antenatal care. SETTING: A tertiary care teaching hospital. METHODS: It was a retrospective study conducted in the department of Obstetrics & Gynecology at The Aga Khan University Hospital in Karachi. During this period 9253 women were delivered, out of these 143 booked grandmultiparas (GMP) served as cases. The outcome of these women was compared with 430 non-grandmultiparas (NGMP). Logistic regression model was used to adjust for potential confounders. RESULTS: Grandmultiparas had almost three times increased risk of having postpartum hemorrhage compared to NGMP group. Similarly, there were significantly low five-minute apgars in the GMPs compared to the NGMP group. Although the neonatal intensive care admissions were three times more in the GMPs but this did not reach statistical significance due to small number of cases in both groups. CONCLUSION: Our study indicates that grandmultiparity is a risk factor for pregnancy in this part of the world, even in the presence of reasonable antenatal care. This may be explained on the basis of the increased age of these women. Finally, we also recommend that an age-matched study needs to be undertaken in order to determine if age is an important determinant for risk factors in grandmultiparas.
Assuntos
Paridade , Complicações na Gravidez/etiologia , Adulto , Peso ao Nascer , Feminino , Humanos , Modelos Logísticos , Idade Materna , Hemorragia Pós-Parto/etiologia , Gravidez , Resultado da Gravidez , Prevalência , Estudos Retrospectivos , Fatores de RiscoRESUMO
Whitefly-transmitted geminiviruses (begomoviruses) have emerged as major constraints on food and fiber crops worldwide, and there are several examples of begomovirus mobilization in previously unknown host plants. Here we report on evidence that leaf curl disease of watermelon in Pakistan is caused by Tomato leaf curl virus-India (TLCV-India). Leaf curl disease of watermelon, characterized by leaf curling and mottling and stunted plant growth, was observed at several locations in the Punjab Province of Pakistan. Symptomatic and asymptomatic leaf samples were collected from three locations, and total DNA was isolated by the cetyltrimethylammoniumbromide method and resolved in agarose gel. A full-length clone of Cotton leaf curl virus DNA A was labeled with [32P]dCTP and used as a general probe in Southern hybridization. The probe detected characteristic geminivirus DNA forms in infected watermelon plants, whereas no signal was detected in asymptomatic plants. The association of a begomovirus was confirmed further by polymerase chain reaction (PCR) amplification with degenerate primers PAL1V and pAR1c (2). Samples were screened for infection by TLCV-India, because of symptom similarity. A full-length clone of DNA B of TLCV-India (1) was labeled with [32P]dCTP by random priming and was used as a specific probe in Southern hybridization. The probe detected geminivirus DNA forms, showing that the disease is associated with TLCV-India. Primers TLCV1 (GAGGTACCAAAACTTGTCGTTTTGATTCGG), in the virion-sense, and TLCV2 (GCCCATGGTTCTTTGCTCGGAGAACAAGAA), in the complementary-sense, were designed based on the sequence of DNA A of TLCV-India. These primers were used in PCR and amplified a product of the expected size from infected plants. Similarly, primers TLCVBC1 (GCGGATCCTTATTCCGTAATTATATCTGCA), in the virion-sense, and TLCV BC2 (CACCATGGCAATAGGAAATGATGGTATGGG), in the complementary-sense, were designed based on the sequence of DNA B of TLCV-India (1). These primers amplified a product of expected size when used in PCR. The results show that watermelon leaf curl disease in Pakistan is associated with TLCV-India. This the first report of detection of a begomovirus in watermelon in Pakistan and the first report of detection of TLCV-India on a plant other than tomato from Southeast Asia. References: (1) M. Padidam et al. J. Gen. Virol. 76:25, 1995. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993.
RESUMO
In the present study some herbal extracts have been tested for their antibacterial activity using seven different strains of Gram positive and Gram negative bacteria to measure the zone of inhibition. Extracts were found devoid of activity against all the microorganisms.
Assuntos
Falso Aneurisma/diagnóstico por imagem , Aneurisma da Aorta Abdominal/cirurgia , Complicações Pós-Operatórias/diagnóstico por imagem , Tomografia Computadorizada por Raios X , Falso Aneurisma/epidemiologia , Prótese Vascular , Humanos , Complicações Pós-Operatórias/epidemiologia , Fatores de TempoRESUMO
Intussusception is not a widely recognized complication of celiac disease and yet it is not rare. The authors report on 3 children with spontaneously resolving small bowel intussusception in association with celiac disease. Small bowel intussusception in a child with suspected celiac disease initially should be managed expectantly rather than by early surgical reduction. The finding of transient small bowel intussusception, either by contrast radiology or sonography, should prompt investigation for celiac disease.
Assuntos
Doença Celíaca/complicações , Intussuscepção/etiologia , Doença Celíaca/dietoterapia , Pré-Escolar , Feminino , Humanos , Lactente , Intussuscepção/diagnóstico por imagem , Masculino , UltrassonografiaRESUMO
Quinone antitumour agents with wide spectrum of activity have been extensively used in different forms of human cancers. Quinones have been isolated either from animals, microorganisms or plants. Extensive research on quinone compounds is going on to discover novel effective antitumour compound. We also discussed the mechanism of action, which have not been fully clarified. In this review we cover all the above-mentioned aspects to emphasize the importance of quinone moiety as antitumour agents.
RESUMO
Preliminary screening of herbal extracts employs the determination of their biological activity and the estimation of their therapeutic potential. This eliminates the unnecessary effort of fractionation and purification of constituents unimportant from the practice pharmacological point of view. It also gives a scientific basis to the herbs traditionally used in folk medicine. Thus, during the present investigation the spasmolytic effect of Anemone pulsatilla extract on isolated tissues of rabbit jejunum was evaluated. In addition the pharmacological screening of Anemone pulsatilla extract was also earned out.