Genetic insights into drug targets for sporadic Creutzfeldt-Jakob disease: Integrative multi-omics analysis.

OBJECTIVE: Sporadic Creutzfeldt-Jakob disease (sCJD) is a fatal rapidly progressive neurodegenerative disorder with no effective therapeutic interventions. We aimed to identify potential genetically-supported drug targets for sCJD by integrating multi-omics data. METHODS: Multi-omics-wide association studies, Mendelian randomization, and colocalization analyses were employed to explore potential therapeutic targets using expression, single-cell expression, DNA methylation, and protein quantitative trait locus data from blood and brain tissues. Outcome data was from a case-control genome-wide association study, which included 4110 sCJD patients and 13,569 controls. Further investigations encompassed druggability, potential side effects, and associated biological pathways of the identified targets. RESULTS: Integrative multi-omics analysis identified 23 potential therapeutic targets for sCJD, with five targets (STX6, XYLT2, PDIA4, FUCA2, KIAA1614) having higher levels of evidence. One target (XYLT2) shows promise for repurposing, two targets (XYLT2, PDIA4) are druggable, and three (STX6, KIAA1614, and FUCA2) targets represent potential future breakthrough points. The expression level of STX6 and XYLT2 in neurons and oligodendrocytes was closely associated with an increased risk of sCJD. Brain regions with high expression of STX6 or causal links to sCJD were often those areas commonly affected by sCJD. CONCLUSIONS: Our study identified five potential therapeutic targets for sCJD. Further investigations are warranted to elucidate the mechanisms underlying the new targets for developing disease therapies or initiating clinical trials.

Genetic and clinical landscape of Chinese frontotemporal dementia: dominance of TBK1 and OPTN mutations.

BACKGROUND: Our study aims to evaluate the genetic and phenotypic spectrum of Frontotemporal dementia (FTD) gene variant carriers in Chinese populations, investigate mutation frequencies, and assess the functional properties of TBK1 and OPTN variants. METHODS: Clinically diagnosed FTD patients underwent genetic analysis through exome sequencing, repeat-primed polymerase chain reaction, and Sanger sequencing. TBK1 and OPTN variants were biologically characterized in vitro using immunofluorescence, immunoprecipitation, and immunoblotting analysis. The frequencies of genes implicated in FTD in China were analyzed through a literature review and meta-analysis. RESULTS: Of the 261 Chinese FTD patients, 61 (23.4%) carried potential causative variants in FTD-related genes, including MAPT (n = 17), TBK1 (n = 7), OPTN (n = 6), GRN (n = 6), ANXA11 (n = 4), CHMP2B (n = 3), C9orf72 GGGGCC repeats (n = 2), CYLD (n = 2), PRNP (n = 2), SQSTM1 (n = 2), TARDBP (n = 2), VCP (n = 1), CCNF (n = 1), CHCHD10 (n = 1), SIGMAR1 (n = 1), CHCHD2 (n = 1), FUS (n = 1), TMEM106B (n = 1), and UBQLN2 (n = 1). 29 variants can be considered novel, including the MAPT p.D54N, p.E342K, p.R221P, p.T263I, TBK1 p.E696G, p.I37T, p.E232Q, p.S398F, p.T78A, p.Q150P, p.W259fs, OPTN p.R144G, p.F475V, GRN p.V473fs, p.C307fs, p.R101fs, CHMP2B p.K6N, p.R186Q, ANXA11 p.Q155*, CYLD p.T157I, SQSTM1 p.S403A, UBQLN2 p.P509H, CCNF p.S160N, CHCHD10 p.A8T, SIGMAR1 p.S117L, CHCHD2 p.P53fs, FUS p.S235G & p.S236G, and TMEM106B p.L144V variants. Patients with TBK1 and OPTN variants presented with heterogeneous clinical phenotypes. Functional analysis demonstrated that TBK1 I37T and E232Q mutants showed decreased autophosphorylation, and the OPTN phosphorylation was reduced by the TBK1 I37T mutant. The OPTN-TBK1 complex formation was enhanced by the TBK1 E696G mutant, while OPTN R144G and F475V mutants exhibited reduced recruitment to autophagosomes compared to the wild-type. The overall frequency of TBK1 and OPTN in Chinese FTD patients was 2.0% and 0.3%, respectively. CONCLUSIONS: Our study demonstrates the extensive genetic and phenotypic heterogeneity of Chinese FTD patients. TBK1 mutations are the second most frequent cause of clinical FTD after MAPT in the Chinese.

Causal effects of dietary composition on multiple sclerosis risk and severity: a Mendelian randomization study.

Objectives: Observational studies have found potential associations between dietary intake and multiple sclerosis (MS). However, these associations are inconsistent, and the causal relationship remains unclear. In this study, we aim to examine the causal relationship between genetically predicted dietary composition and the risk and severity of MS using two-sample Mendelian randomization. Method: Genetic instruments for 30 different dietary compositions were extracted from large-scale genome-wide association studies (GWAS), mainly from the UK Biobank dataset. The GWAS data for MS risk and severity were obtained from the International Multiple Sclerosis Genetics Consortium. The primary analysis employed either the inverse variance weighted method or the Wald ratio method to evaluate the causal association. Several sensitivity analyses were also performed. Results: Genetically predicted higher pork intake was causally associated with an increased risk of MS (odds ratio [OR] = 6.76; p = 0.005), while genetically driven higher cereal intake (OR = 0.43, p = 0.016), vitamin C supplement (OR < 0.01; p = 4.34 × 10-5), folic acid supplement (OR < 0.01; p = 4.91 × 10-71), and fish oil supplement (OR = 0.04; p = 0.017) were causally linked to a decreased risk of MS. In addition, genetically predicted higher alcoholic intake (OR = 1.17; p = 0.041) was causally associated with an increase in MS severity, while folic acid supplement (OR < 0.01; p = 0.015) was causally linked to a decrease in MS severity. Interpretation: This study found that increased consumption of cereal, vitamin C, folic acid, and fish oil, coupled with reduced pork and alcohol intake, may potentially decrease the risk and severity of MS. These findings inform the development of dietary-based strategies for MS prevention and treatment.

Vascular dysfunction in sporadic bvFTD: white matter hyperintensity and peripheral vascular biomarkers.

BACKGROUND: Vascular dysfunction was recently reported to be involved in the pathophysiological process of neurodegenerative diseases, but its role in sporadic behavioral variant frontotemporal dementia (bvFTD) remains unclear. The aim of this study was to systematically explore vascular dysfunction, including changes in white matter hyperintensities (WMHs) and peripheral vascular markers in bvFTD. METHODS: Thirty-two patients with bvFTD who with no vascular risk factors were enrolled in this cross-sectional study and assessed using positron emission tomography/magnetic resonance (PET/MRI) imaging, peripheral plasma vascular/inflammation markers, and neuropsychological examinations. Group differences were tested using Student's t-tests and Mann-Whitney U tests. A partial correlation analysis was implemented to explore the association between peripheral vascular markers, neuroimaging, and clinical measures. RESULTS: WMH was mainly distributed in anterior brain regions. All peripheral vascular factors including matrix metalloproteinases-1 (MMP-1), MMP-3, osteopontin, and pentraxin-3 were increased in the bvFTD group. WMH was associated with the peripheral vascular factor pentraxin-3. The plasma level of MMP-1 was negatively correlated with the gray matter metabolism of the frontal, temporal, insula, and basal ganglia brain regions. The WMHs in the frontal and limbic lobes were associated with plasma inflammation markers, disease severity, executive function, and behavior abnormality. Peripheral vascular markers were associated with the plasma inflammation markers. CONCLUSIONS: WMHs and abnormalities in peripheral vascular markers were found in patients with bvFTD. These were found to be associated with the disease-specific pattern of neurodegeneration, indicating that vascular dysfunction may be involved in the pathogenesis of bvFTD. This warrants further confirmation by postmortem autopsy. Targeting the vascular pathway might be a promising approach for potential therapy.

Okur-Chung neurodevelopmental syndrome: Implications for phenotype and genotype expansion.

BACKGROUND: Okur-Chung neurodevelopmental syndrome (OCNDS) is a rare autosomal dominant disorder caused by pathogenic variants in CSNK2A1. It is characterized by intellectual disability, developmental delay, and multisystemic abnormalities. METHODS: We performed the whole-exome sequencing for a patient in a Chinese family. The co-segregation study using the Sanger sequencing method was performed among family members. Reverse transcription and quantitative real-time polymerase chain reaction were carried out using total RNA from blood samples of the proband and wild-type control subjects. A review of patients with OCNDS harboring CSNK2A1 pathogenic variants was conducted through a comprehensive search of the PubMed database. RESULTS: We identified a novel CSNK2A1 frameshift variant p.Tyr323Leufs*16 in a Chinese family. The proband, a 31-year-old female, presented with abnormal eating habits, recurrent seizures, language impairment, and intellectual disability. Her mother exhibited postnatal hernias, splenomegaly, and a predisposition to infections, but showed no significant developmental impairments or intellectual disability. Genetic studies revealed the presence of this variant in CSNK2A1 in both the proband and her mother. Transcription analysis revealed this variant may lead to nonsense-mediated mRNA decay, suggesting haploinsufficiency as a potential disease mechanism. We reviewed 47 previously reported OCNDS cases and discovered that individuals carrying CSNK2A1 null variants may exhibit a diminished frequency of symptoms linked to language deficits, dysmorphic facial features, or intellectual disability, consequently presenting an overall milder phenotype when compared to those with missense variants. CONCLUSION: We report a novel frameshift variant, p.Tyr323Leufs*16, in an OCNDS family with a generally mild phenotype. This study may broaden the spectrum of clinical presentations associated with OCNDS and contribute novel insights into the genotype-phenotype correlation of this condition.

Atrophy network mapping of clinical subtypes and main symptoms in frontotemporal dementia.

Frontotemporal Dementia (FTD) is a disease of high heterogeneity, apathy and disinhibition present in all subtypes of FTD and imposes a significant burden on families/society. Traditional neuroimaging analysis has limitations in elucidating the network localization due to individual clinical and neuroanatomical variability. The study aims to identify the atrophy network map associated with different FTD clinical subtypes and determine the specific localization of the network for apathy and disinhibition. Eighty FTD patients [45 behavioral variant FTD (bvFTD) and 35 semantic variant progressive primary aphasia (svPPA)] and 58 healthy controls (HCs) at Xuanwu Hospital were enrolled as Dataset 1; 112 FTD patients including 50 bvFTD, 32 svPPA, and 30 non-fluent variant PPA (nfvPPA) cases, and 110 HCs from Frontotemporal Lobar Degeneration Neuroimaging Initiative (FTLDNI) dataset were included as Dataset 2. Initially, single-subject atrophy maps were defined by comparing cortical thickness in each FTD patient versus HCs. Next, the network of brain regions functionally connected to each FTD patient's location of atrophy was determined using seed-based functional connectivity in a large (n = 1000) normative connectome. Finally, we used atrophy network mapping to define clinical subtype-specific network (45 bvFTD, 35 svPPA and 58 HCs in Dataset 1; 50 bvFTD, 32 svPPA, 30 nfvPPA and 110 HCs in Dataset 2) and symptom-specific networks [combined dataset 1 and 2, apathy without depression Vs non-apathy without depression (80:26), disinhibition Vs non-disinhibition (88:68)]. We compare the result with matched symptom networks derived from patients with focal brain lesions or conjunction analysis. Through the analysis of two datasets, we identified heterogeneity in atrophy patterns among FTD patients. However, these atrophy patterns are connected to a common brain network. The primary regions affected by atrophy in FTD included the frontal and temporal lobes, particularly the anterior temporal lobe. bvFTD connects to frontal and temporal cortical areas, svPPA mainly impacts the anterior temporal region, and nfvPPA targets the inferior frontal gyrus and precentral cortex regions. The apathy-specific network was localized in the orbital frontal cortex and ventral striatum, while the disinhibition-specific network was localized in the bilateral orbital frontal gyrus and right temporal lobe. Apathy and disinhibition atrophy networks resemble known motivational and criminal lesion networks respectively. A significant correlation was found between the apathy/disinhibition scores and functional connectivity between atrophy maps and the peak of the networks. This study localizes the common network of clinical subtypes and main symptoms in FTD, guiding future FTD neuromodulation interventions.

Application of the mild behavioral impairment checklist in Chinese patients with the behavioral variant of frontotemporal dementia.

BACKGROUND: The mild behavioral impairment checklist (MBI-C) designed to capture neuropsychiatric symptoms in the whole spectrum of elder with or without dementia, have been verified in mild behavioral impairment, mild cognitive impairment and Alzheimer's Disease, but never used in the behavioral variant of frontotemporal dementia (bvFTD). METHODS: Fifty-two patients with bvFTD (mild, n = 30; moderate-severe, n = 22) and 82 community-dwelling elderly individuals (HCs) were enrolled. All subjects were assessed with a full neuropsychological scale including the MBI-C, Neuropsychiatric Inventory Questionnaire (NPI-Q), and Frontal Behavioral Inventory (FBI). Receiver operating characteristic curves were drawn to analyze the sensitivity and specificity of the MBI-C, NPI-Q, and FBI, and cutoff points were determined using the Youden index. RESULTS: The MBI-C and domain scores in all patients with bvFTD were significantly higher than those in HCs. The most common symptoms of bvFTD were apathy (82.7%) and impulse dyscontrol (80.8%). The MBI-C score was positively correlated with the NPI-Q, FBI, and Activities of Daily Living. For differentiating patients with both bvFTD and mild bvFTD from HCs, the optimal MBI-C cutoff point was 5.5 with a sensitivity of 100% and specificity of 82%, and its sensitivity was higher than that of the NPI-Q and FBI. CONCLUSION: The MBI-C is a sensitive tool for screening behavioral and psychological symptoms in patients with bvFTD, even in the early stages of the disease.

Octapeptide repeat alteration mutations of the prion protein gene in clinically diagnosed Alzheimer's disease and frontotemporal dementia.

Studies focusing on octapeptide repeat alteration mutations in PRNP in Alzheimer's disease (AD) and frontotemporal dementia (FTD) cohorts have been rare. We aim to screen sporadic AD and FTD patients with unknown etiology for the octapeptide repeat insertions and deletions in PRNP. Two hundred and six individuals were screened for alterations to the repeat region in the PRNP gene, including 146 sporadic AD and 60 sporadic FTD patients. Our study showed a 1.5% (3/206) occurrence of the octapeptide repeat alteration mutations in PRNP in a Chinese cohort of sporadic dementia. One late-onset FTD patient and one early-onset AD patient each had a two-octapeptide repeat deletion in PRNP, while one early-onset AD patient had a five-octapeptide repeat insertion mutation. PRNP octapeptide repeat alteration mutations are present in sporadic AD and FTD patients. The genetic investigation for PRNP octapeptide repeat alteration mutations in sporadic dementia patients should be carried out in future clinical studies.

Involvement of specific striatal subregion contributes to executive deficits in Alzheimer disease.

BACKGROUND: There is growing evidence that the striatum plays a central role in cognitive dysfunction. However, it remains unclear whether and how the striatum contributes specifically to executive deficits in Alzheimer disease (AD). We sought to elucidate aberrations in the striatal subregion associated with executive function and its metabolic connectivity with the cortical regions to investigate its role in the pathogenesis of executive deficits in patients with AD. METHODS: Patients with AD and healthy controls underwent a neuropsychological assessment battery, including assessment of executive function, and a hybrid positron emission tomography/magnetic resonance imaging (PET/MRI) scan. We performed voxel-wise analyses of cerebral metabolism between patients and controls, focusing on the executive subregion of the striatum according to the Oxford-GSK-Imanova Striatal Connectivity Atlas. We assessed the correlation between the [18F]-fluorodeoxyglucose standardized uptake value ratio of the striatal executive subregion and clinical variables, and we analyzed seed-based metabolic connectivity of the striatal executive subregion with the dorsolateral prefrontal cortex (DLPFC) using [18F]-fluorodeoxyglucose PET. RESULTS: We included 50 patients with AD and 33 controls in our analyses. The patterns of striatal hypometabolism in patients with AD were specific to executive and caudal motor subregions. Metabolic activity in the executive subregion of the striatum correlated negatively with the severity of executive dysfunction, as measured with the Trial-Making Test (TMT) part B and the difference score TMT B-A, and correlated positively with Digit Span (backward) and Verbal Fluency Test scales, particularly on the left side. Compared with controls, patients with AD showed reduced metabolic connectivity between striatal executive subregions and the dorsolateral prefrontal cortex (DLPFC). LIMITATIONS: Our study was limited by small sample sizes and cross-sectional findings. CONCLUSION: Our findings show that patients with AD have impairments in the executive subregion of the striatum, and these deficits may be associated with a disconnection between the executive striatum and DLPFC, providing valuable insight into the pathogenesis of this disease.

Progranulin Gene Mutations in Chinese Patients with Frontotemporal Dementia: A Case Report and Literature Review.

BACKGROUND: Progranulin (GRN) mutations in frontotemporal dementia (FTD) have been less frequently reported in China than in Western countries. OBJECTIVE: This study reports a novel GRN mutation and summarizes the genetic and clinical features of patients with GRN mutations in China. METHODS: Comprehensive clinical, genetic, and neuroimaging examinations were conducted on a 58-year-old female patient diagnosed with semantic variant primary progressive aphasia. A literature review was also conducted and clinical and genetic features of patients with GRN mutations in China were summarized. RESULTS: Neuroimaging revealed marked lateral atrophy and hypometabolism in the left frontal, temporal, and parietal lobes. The patient was negative for pathologic amyloid and tau deposition by positron emission tomography. A novel heterozygous 45-bp deletion (c.1414-14_1444delCCCTTCCCCGCCAGGCTGTGTGCTGCGAGGATCGCCAGCACTGCT) was detected by whole-exome sequencing of the patient's genomic DNA. Nonsense-mediated mRNA decay was presumed to be involved in the degradation of the mutant gene transcript. The mutation was deemed pathogenic according to American College of Medical Genetics and Genomics criteria. The patient had a reduced plasma GRN level. In the literature, there were reports of 13 Chinese patients - mostly female - with GRN mutations; the prevalence was 1.2% -2.6% and patients mostly had early disease onset. CONCLUSION: Our findings expand the mutation profile of GRN in China, which can aid the diagnosis and treatment of FTD.

Peripheral inflammation in behavioural variant frontotemporal dementia: associations with central degeneration and clinical measures.

BACKGROUND: Neuroinflammation plays a significant role in the progression of frontotemporal dementia (FTD). However, the association between peripheral inflammatory factors and brain neurodegeneration is poorly understood. We aimed to examine changes in peripheral inflammatory markers in patients with behavioural variant FTD (bvFTD) and explore the potential association between peripheral inflammation and brain structure, metabolism, and clinical parameters. METHODS: Thirty-nine bvFTD patients and 40 healthy controls were enrolled and underwent assessment of plasma inflammatory factors, positron emission tomography/magnetic resonance imaging, and neuropsychological assessments. Group differences were tested using Student's t test, Mann‒Whitney U test, or ANOVA. Partial correlation analysis and multivariable regression analysis were implemented using age and sex as covariates to explore the association between peripheral inflammatory markers, neuroimaging, and clinical measures. The false discovery rate was used to correct for the multiple correlation test. RESULTS: Plasma levels of six factors, including interleukin (IL)-2, IL-12p70, IL-17A, tumour necrosis superfamily member 13B (TNFSF/BAFF), TNFSF12 (TWEAK), and TNFRSF8 (sCD30), were increased in the bvFTD group. Five factors were significantly associated with central degeneration, including IL-2, IL-12p70, IL-17A, sCD30/TNFRSF8, and tumour necrosis factor (TNF)-α; the association between inflammation and brain atrophy was mainly distributed in frontal-limbic-striatal brain regions, whereas the association with brain metabolism was mainly in the frontal-temporal-limbic-striatal regions. BAFF/TNFSF13B, IL-4, IL-6, IL-17A and TNF-α were found to correlate with clinical measures. CONCLUSION: Peripheral inflammation disturbance in patients with bvFTD participates in disease-specific pathophysiological mechanisms, which could be a promising target for diagnosis, treatment, and monitoring therapeutic efficacy.

Altered metabolic connectivity within the limbic cortico-striato-thalamo-cortical circuit in presymptomatic and symptomatic behavioral variant frontotemporal dementia.

BACKGROUND: Behavioral variant frontotemporal dementia (bvFTD) is predominantly considered a dysfunction in cortico-cortical transmission, with limited direct investigation of cortical-subcortical transmission. Thus, we aimed to characterize the metabolic connectivity between areas of the limbic cortico-striato-thalamic-cortical (CSTC) circuit in presymptomatic and symptomatic bvFTD patients. METHODS: Thirty-three bvFTD patients and 33 unrelated healthy controls were recruited for this study. Additionally, six asymptomatic carriers of the MAPT P301L mutation were compared with 12 non-carriers who were all from the same family of bvFTD. Each participant underwent neuropsychological assessment, genetic testing, and a hybrid PET/MRI scan. Seed-based metabolic connectivity based on [18F]-fluorodeoxyglucose PET between the main components within the limbic CSTC circuit was explored according to the Oxford-GSK-Imanova Striatal Connectivity Atlas. RESULTS: BvFTD patients exhibited reduced metabolic connectivity between the relays in the limbic CSTC circuit, which included the frontal region (ventromedial prefrontal cortex, orbitofrontal cortex, rectus gyrus, and anterior cingulate cortex), the limbic striatum, and thalamus compared to controls. In the bvFTD patients, the involvement of the limbic CSTC circuit was associated with the severity of behavior disruption, as measured by the frontal behavior inventory, the disinhibition subscale, and the apathy subscale. Notably, asymptomatic MAPT carriers had weakened frontostriatal connectivity but enhanced striatothalamus and thalamofrontal connectivity within the limbic CSTC circuit compared with noncarriers. CONCLUSION: These findings suggested that aberrant metabolic connectivity within the limbic CSTC circuit is present in symptomatic and even asymptomatic stages of bvFTD. Thus, metabolic connectivity patterns could be used as a potential biomarker to detect the presymptomatic stage and track disease progression.

Clinical, Genetic, and Pathological Features of very Early Onset Frontotemporal Lobe Degeneration: A Systematic Review.

BACKGROUND: In most patients with frontotemporal lobe degeneration (FTLD), the degenerative process begins between the ages 45 and 65 years; onset younger than 45 years is relatively rare and considered very early onset FTLD (VEO-FTLD). OBJECTIVE: To delineate the clinical, genetic, and pathological features of VEO-FTLD. METHODS: A systematic literature review was carried out in PubMed and Embase from inception to September 2021. Patients diagnosed with definite FTLD with onset before age 45 years were included. Patients lacking detailed clinical data or both genetic and neuropathological data were excluded. Phenotypic, genotypic, and pathological data were extracted for further analyses. RESULTS: Data from 110 patients with VEO-FTLD, reported in a cumulative 70 publications, were included. Age of onset was 35.09 ± 7.04 (14-44) years. Sixty-seven patients were reported age at death of 42.12 ± 7.26 (24-58) years, with a disease course lasting 8.13 ± 4.69 (1-20) years. Behavioural variant frontotemporal dementia (104/110, 94.5%) was the most common clinical subtype, often manifesting as disinhibition (81.8%) and apathy (80.9%), and frequently accompanied by a cognitive deficit (90.9%) and parkinsonism (37.3%). Frequency of familial aggregation was high (familial vs. sporadic, 73/37, 66.4%); most patients carried MAPT gene mutations (72.9% in familial, 40% in sporadic), followed by C9 (18.8% in familial, 10% in sporadic), TARDBP (2.1% in familial), and VCP (2.1% in familial). The most common neuropathology subtype was tau (43.5%), followed by ubiquitin- positive (24.6%), FUS (20.3%), and TDP 43 (2.9%). CONCLUSION: VEO-FTLD may have unique clinical, genetic, and neuropathological markers and should be considered in young patients with psycho-behavioral symptoms.

The clinical and molecular spectrum of ZFYVE26-associated hereditary spastic paraplegia: SPG15.

In the field of hereditary spastic paraplegia (HSP), progress in molecular diagnostics needs to be translated into robust phenotyping studies to understand genetic and phenotypic heterogeneity and to support interventional trials. ZFYVE26-associated hereditary spastic paraplegia (HSP-ZFYVE26, SPG15) is a rare, early-onset complex HSP, characterized by progressive spasticity and a variety of other neurological symptoms. While prior reports, often in populations with high rates of consanguinity, have established a general phenotype, there is a lack of systematic investigations and a limited understanding of age-dependent manifestation of symptoms. Here we delineate the clinical, neuroimaging and molecular features of 44 individuals from 36 families, the largest cohort assembled to date. Median age at last follow-up was 23.8 years covering a wide age range (11-61 years). While symptom onset often occurred in early childhood [median: 24 months, interquartile range (IQR) = 24], a molecular diagnosis was reached at a median age of 18.8 years (IQR = 8), indicating significant diagnostic delay. We demonstrate that most patients present with motor and/or speech delay or learning disabilities. Importantly, these developmental symptoms preceded the onset of motor symptoms by several years. Progressive spasticity in the lower extremities, the hallmark feature of HSP-ZFYVE26, typically presents in adolescence and involves the distal lower limbs before progressing proximally. Spasticity in the upper extremities was seen in 64%. We found a high prevalence of extrapyramidal movement disorders including cerebellar ataxia (64%) and dystonia (11%). Parkinsonism (16%) was present in a subset and showed no sustained response to levodopa. Cognitive decline and neurogenic bladder dysfunction progressed over time in most patients. A systematic analysis of brain MRI features revealed a common diagnostic signature consisting of thinning of the anterior corpus callosum, signal changes of the anterior forceps and non-specific cortical and cerebellar atrophy. The molecular spectrum included 45 distinct variants, distributed across the protein structure without mutational hotspots. Spastic Paraplegia Rating Scale scores, SPATAX Disability Scores and the Four Stage Functional Mobility Score showed moderate strength in representing the proportion of variation between disease duration and motor dysfunction. Plasma neurofilament light chain levels were significantly elevated in all patients (Mann-Whitney U-test, P < 0.0001) and were correlated inversely with age (Spearman's rank correlation coefficient r = -0.65, P = 0.01). In summary, our systematic cross-sectional analysis of HSP-ZFYVE26 patients across a wide age-range, delineates core clinical, neuroimaging and molecular features and identifies markers of disease severity. These results raise awareness to this rare disease, facilitate an early diagnosis and create clinical trial readiness.

A novel truncating variant of SPAST associated with hereditary spastic paraplegia indicates a haploinsufficiency pathogenic mechanism.

Introduction: Hereditary spastic paraplegias (HSPs) are genetic neurodegenerative diseases. The most common form of pure HSP that is inherited in an autosomal dominant manner is spastic paraplegia type 4 (SPG4), which is caused by mutations in the SPAST gene. Different theories have been proposed as the mechanism underlying SPAST-HSP for different types of genetic mutations, including gain- and loss-of-function mechanisms. To better understand the mutation mechanisms, we performed genetic analysis and investigated a truncating SPAST variant that segregated with disease in one family. Objectives and methods: We described a pure HSP pedigree with family members across four generations. We performed genetic analysis and investigated a novel frameshift pathogenic variant (c.862_863dupAC, p. H289Lfs*27) in this family. We performed reverse transcription-polymerase chain reaction (RT-PCR), Sanger sequencing, and quantitative RT-PCR using total RNA from an Epstein-Barr virus-induced lymphoblastoid cell line produced from the proband. We also performed Western blotting on cell lysates to investigate if the protein expression of spastin is affected by this variant. Results: This variant (c.862_863dupAC, p. H289Lfs*27) co-segregated with pure HSP in this family and is not registered in any public database. Measurement of SPAST transcripts in lymphoblasts from the proband demonstrated a reduction of SPAST transcript levels through likely nonsense-mediated mRNA decay. Immunoblot analyses demonstrated a reduction of spastin protein expression levels in lymphoblasts. Conclusion: We report an SPG4 family with a novel heterozygous frameshift variant p.H289Lfs*27 in SPAST. Our study implies haploinsufficiency as the pathogenic mechanism for this variant and expands the known mutation spectrum of SPAST.

Involvement of striatal motoric subregions in familial frontotemporal dementia with parkinsonism harboring the C9orf72 repeat expansions.

The chromosome 9 open reading frame 72 (C9ORF72) has been proposed as the causative gene of frontotemporal dementia with parkinsonism (FTDP), but its pathophysiological mechanism of parkinsonism is poorly understood. To explore the roles of striatal motor subdivisions in the pathogenesis of parkinsonism resulting from C9ORF72 repeat expansions in the FTDP, two patients with FTDP from one pedigree and seventeen healthy controls were enrolled. The participants received clinical interviews, physical examinations, genetic testing, [18F]-fluorodeoxyglucose PET/MRI, and [18F]-dihydrotetrabenazine PET/CT. Voxel-wise and region of interest analysis were conducted with respect to gray matter volume, metabolism, and dopamine transport function between patients and controls, focusing on the motor part of the striatum according to the Oxford-GSK-Imanova Striatal Connectivity Atlas. Patient 1 presented with parkinsonism as the initial symptom, while patient 2 exhibited behavior disturbance as the first symptom, followed by parkinsonism within one year. Both patients had the hexanucleotide expansion detected in C9ORF72(>52 repeats). Gray matter volume atrophy, hypometabolism and dopamine dysfunction were observed in the motor areas of the striatum. Of the two patients, marked glucose hypometabolism within the striatal motor subregion was observed in patient 1, with corresponding gray matter atrophy. In addition, presynaptic dopaminergic integrity of patient 2 was deteriorated in the motor subregions which was consistent with gray matter atrophy. These findings imply that parkinsonism in FTDP may be associated with the degeneration and dopaminergic dysfunction of the striatal motor subregion, which might be attributed to C9orf72 repeat expansions.

Extremely Early-Onset Frontotemporal Dementia: A Case Report and Literature Review.

BACKGROUND: In most cases, the onset of frontotemporal dementia (FTD) occurs between the ages of 45 and 65 years. However, some patients experience an extremely early disease onset. OBJECTIVE: To investigate the clinical, genetic, and pathological features of extremely early-onset FTD. METHODS: We conducted a comprehensive clinical, genetic, and neuropathological analysis of a 25-year-old patient experiencing the onset of behavioral variant frontotemporal dementia (bvFTD). In addition, we conducted a literature review and summarized the clinical, genetic, and pathological features of patients with FTD with onset age≤25 years. RESULTS: The patient was diagnosed with bvFTD; however, there was no family history of FTD, no positive genetic test results and no deposition of TDP43, tau, ubiquitin, and synuclein in the brain. Literature screening identified 18 patients with onset age ≤25 years with FTD. The youngest patient was 14 years of age. Most patients (8/14) had a positive family history. The most common clinical phenotype was the behavioral variant (12/14). Genetic results were reported for 11 patients; the most common pathogenic gene was MAPT (10/12), with four cases of G389 R, two cases of P301 S, one case of G335 S, one case of G335A, one case of G335 V, and one case of L315 R. Pathological results were reported for 13 patients; the most common pathological subtype was tau (8/13). CONCLUSION: FTD can start at an extremely early age. The most common phenotype of extremely early onset FTD was the behavioral variant, the most common pathogenic gene was MAPT, and the most common neuropathological type was tau.

Amino Acid Substitution within Seven-Octapeptide Repeat Insertions in the Prion Protein Gene Associated with Short-Term Course.

The majority of seven-octapeptide repeat insertion (7-OPRI) carriers exhibit relatively early onset and a slowly progressive course. We have presented three cases of 7-OPRI, including two that are rapidly progressing, and compared the clinical and ancillary characteristics of the short-term and long-term disease course, as well as factors that influence disease course. The clinical and ancillary features of three new 7-OPRI patients in a Chinese pedigree were analyzed. Global data on 7-OPRI cases were then collected by reviewing the literature, and the cases were grouped according to clinical duration as per the WHO sCJD criteria, with a two-year cut-off. A Chinese pedigree has a glycine-to-glutamate substitution within the 7-OPRI insertion, which enhances the hydrophilicity of the prion protein. Two cases in this pedigree had a short disease course (consistent with the typical clinical and ancillary features of sCJD). In addition, the members of this pedigree had a later onset (p < 0.001) and shorter disease course (p < 0.001) compared to previously reported 7-OPRI cases with 129 cis-M and a similar age of onset and disease course to that of cases with 129 cis-V. The 7-OPRI cases with a shorter clinical course (n = 4) had a later onset (p = 0.021), higher rate of hyperintensity on MRI (p = 0.029) and higher frequency of 129 cis-V (p = 0.066) compared to those with a longer clinical course (n = 13). The clinical presentation of 7-OPRI is significantly heterogeneous. Codon 129 cis-V and amino acid substitution within repeat insertions are possible contributors to the short-term disease course of 7-OPRI.

Ubap1 knock-in mice reproduced the phenotype of SPG80.

SPG80 is a neurodegenerative disorder characterized by a pure type of juvenile-onset hereditary spastic paraplegia and is caused by a heterozygous mutation of the UBAP1 (ubiquitin-associated protein 1) gene. UBAP1 is one of the subunits of the endosomal sorting complex required for transport I and plays a role in endosome sorting by binding to ubiquitin-tagged proteins. In this study, we generated novel Ubap1+/E176Efx23 knock-in mice, in which the SOUBA domain of Ubap1 was completely deleted with the UMA domain being intact, as an animal model of SPG80. The knock-in mice with this heterozygous Ubap1 truncated mutation appeared normal at birth, but they developed progressive hind limb dysfunction several months later. Molecular pathologically, loss of neurons in the spinal cord and accumulation of ubiquitinated proteins were observed in Ubap1+/E176Efx23 knock-in mice. In addition, changes in the distributions of Rab5 and Rab7 in the spinal cord suggest that this mutation in Ubap1 disturbs endosome-mediated vesicular trafficking. This is the first report of a mouse model that reproduces the phenotype of SPG80. Our knock-in mice may provide a clue for understanding the molecular pathogenesis underlying UBAP1-related HSP and screening of therapeutic agents.