Evaluation of the Combined Effect of Heterodera glycines and Macrophomina phaseolina on Soybean Yield in Naturally Infested Fields with Spatial Regression Analysis and in Greenhouse Studies.

Heterodera glycines, the soybean cyst nematode, and Macrophomina phaseolina, causal agent of charcoal rot, are economically important soybean pathogens. The impact and effect of these pathogens on soybean yield in coinfested fields in the Midwest production region is not known. Both pathogens are soilborne, with spatially aggregated distribution and effects. Spatial regression analysis, therefore, is an appropriate method to account for the spatial dependency in either the dependent variable or regression error term from data produced in fields naturally infested with H. glycines and M. phaseolina. The objectives of this study were twofold: to evaluate the combined effect of H. glycines and M. phaseolina on soybean yield in naturally infested commercial fields with ordinary least squares and spatial regression models; and to evaluate, under environmentally controlled conditions, the combined effect of H. glycines and M. phaseolina through nematode reproduction and plant tissue fungal colonization. Six trials were conducted in fields naturally infested with H. glycines and M. phaseolina in Ohio. Systematic-grid sampling was used to determine the population densities of H. glycines and M. phaseolina, and soybean yield estimates. Though not used in any statistical analysis, M. phaseolina colony forming units from plant tissue, charcoal rot severity, and H. glycines type were also recorded and summarized. In two greenhouse experiments, treatments consisted of H. glycines alone, M. phaseolina alone, and coinfestation of soybean with both pathogens. Moran's I test indicated that the yield from five fields was spatially correlated (P < 0.05) and aggregated. In these fields, to account for spatial dependence, spatial regression models were fitted to the data. Spatial regression analyses revealed a significant interaction effect between H. glycines and M. phaseolina on soybean yield for fields with high initial population densities of both pathogens. In the greenhouse experiments, H. glycines reproduction was significantly (P < 0.05) reduced in the presence of M. phaseolina; however, soybean tissue fungal colonization was not affected by the presence of H. glycines. The direct mechanisms by which H. glycines and M. phaseolina interact were not demonstrated in this study. Future studies must be conducted in the field and greenhouse to better understand this interaction effect.

First Report of the Stubby-Root Nematode (Paratrichodorus allius) From a Corn Field in Ohio.

Stubby-root nematodes (family Trichoridae) are an economically important group of ectoparasites that feed on roots, vector tobraviruses, and cause substantial crop loss (1,2,3). In June 2013, 48 soil samples were submitted to the Nematology Laboratory at Ohio State University for nematode analysis from a field planted to corn in Wood County, Ohio. The soil texture was sandy and the field was previously planted to wheat and soybean in 2011 and 2012, respectively. Nematodes were extracted from 100 cm3 soil by decanting and sieving followed by sucrose centrifugal flotation. Phytoparasitic nematodes were identified and counted based on morphological traits to genus at 40× to 63× magnification. Nematode genera parasitic to corn recovered from these samples included Helicotylenchus, Hoplolaimus, Paratrichodorus, Pratylenchus, and Tylenchorhynchus. Stubby-root nematodes (Paratrichodorus sp.) were detected in more than 60% of the samples with a maximum count of 52 per 100 cm3 soil. Individual stubby-root nematodes were hand-picked and identified to species under a compound light microscope as Paratrichodorus allius (Jensen, 1963) Siddiqi, 1974 according to morphological and morphometric characteristics (1). Females (n = 14) were observed with the intestine not anteriorly overlapping the esophagus, posterior subventral esophageal glands overlapping the intestine, caudal pores, absence of spermatheca, and vaginal sclerotization reduced in lateral view. Body length ranged from 475.8 to 840.5 µm (mean = 652.2 µm), and onchiostylet length ranged from 37.7 to 47.4 µm (mean = 42.9 µm). DNA was extracted from single adult females (n = 4) and the 18S rRNA region was amplified with 18S (TTGATTACGTCCCTGCCCTTT) and 26S (TTTCACTCGCCGTTACTAAGG) primers (4). PCR products were purified and sequenced. The sequence was deposited in GenBank (Accession No. KF887974) and was compared with previously deposited sequences by means of BLAST search. The comparison revealed a sequence similarity of 98 to 99% with both P. allius and P. teres (AM269895, AM087124, AJ439572, FJ040484, AJ439575, and AM087125). P. allius and P. teres can be difficult to discriminate using both morphological characteristics and molecular sequencing (3). Therefore, a universal primer (BL18: 5' CCCGTCGMTACTACCGATT 3') and species-specific primers designed to produce PCR products of 432 bp (PAR2: 5'-CCGTTCAAACGCGTATATGATC-3') and 677 bp (PTR4: 5'-CCTGACAAGC'IWGCACTAGC-3') were used for P. allius and P. teres, respectively (3). DNA from individuals used for sequencing was used in PCR reactions with each species-specific primer. DNA samples yielded PCR products of 432 bp with the P. allius-specific primer set and had no reaction with the P. teres-specific primer set. Molecular results and morphological observations confirmed the presence of P. allius in the samples. P. allius is a polyphagous migratory ectoparasite and a vector for Tobacco rattle virus (TRV). The known distribution of P. allius has previously been limited to the Pacific Northwest, where it was originally described as an important pathogen in potato production (2,3). Corn and wheat have been reported as suitable hosts; although they are not susceptible to TRV, crop loss may result from direct damage to roots (2,3). Nematode management recommendations for corn and wheat will depend on the distribution of this nematode. To our knowledge, this is the first report of P. allius in Ohio. References: (1) W. Decreamer. Rev. Nematol. 3:81, 1980. (2) H. Mojtahedi and G. S. Santo. Am. J. Potato Res. 76:273, 1999. (3) E. Riga et al. Am. J. Potato Res. 84:2, 2007. (4) T. C. Vrain et al. Fundam. Appl. Nematol. 15:563, 1992.

First Report of Lesion Nematode (Pratylenchus vulnus) on Boxwood in Ohio.

Boxwood (Buxus sempervirens L. and other species) is a popular evergreen shrub used in landscaping. In January 2012, three nursery-grown plants of cv. Green Gem boxwood were submitted from Warren County, Ohio to the C. Wayne Ellet Plant and Pest Diagnostic Clinic at The Ohio State University, an Ohio Plant Diagnostic Network laboratory. The plants, established for 4 years, exhibited orange to bronze discoloration of the foliage; foliage was not desiccated and dieback was not evident although stunting was present. Plant root symptoms ranged from nearly complete necrosis to distinct black lesions on living roots. A root scraping showed nematodes present in the lesions. Nematodes were extracted from root and soil subsamples with a Baermann funnel apparatus for 48 h (3). A high number of lesion nematodes (Pratylenchus sp.) were observed from both soil and root samples. Individual nematodes were handpicked and identified under a compound light microscope as Pratylenchus vulnus Allen & Jensen, 1951 according to morphologic and morphometric characteristics (2). Males and females were observed with stylets having rounded knobs, labial regions continuous with the body contour, and three to four lip annuli. The lateral field contained four incisures, with the two inner incisures closer to each other than to the outer ones. The esophagus overlapped the intestine ventrally. Female (n = 12) body length ranged from 410.3 to 654.5 µm (mean 583.0 µm), stylet length from 15.0 to 17.8 µm (mean 16.8 µm), tail length from 23.2 to 37.5 µm (mean 29.2 µm), vulva position from 78.9 to 85.6% (mean 81.7%), dorsal esophageal outlet (DGO) from 2.6 to 3.5 µm (mean 3.1 µm), and with functional oblong spermathecae. De Man ratios were as follows: a = 25.3 to 33.3 (mean 28.4), b = 4.1 to 7.6 (mean 6.0), c = 16.1 to 23.5 (mean 20.1), and c' = 1.8 to 2.6 (mean 2.1). Male (n = 16) body length ranged from 478.0 to 589.0 µm (mean 537.9 µm), stylet length from 15.0 to 17.2 µm (mean 16.2 µm), tail length from 22.7 to 28.1 µm (mean 25.5 µm), spicule from 15.0 to 17.5 µm (mean 16.4 µm), gubernaculum from 3.5 to 4.7 µm (mean 4.0 µm), and DGO from 2.6 to 3.7 µm (mean 3.1 µm). De Man ratios were as follows: a = 26.4 to 36.3 (mean 30.5), b = 5.0 to 7.9 (mean 5.8), c = 19.1 to 23.0 (mean 21.1), and c' = 1.6 to 2.4 (mean 2.0). DNA was extracted from single adult females and the D2-D3 expansion region of the 28S rRNA gene was amplified using forward primer ACAAGTACCGTGAGGGAAAGTTG and reverse primer TCGGAAGGAACCAGCTACTA (4). The PCR product was purified and sequenced. The sequence was deposited in GenBank (Accession No. JQ692308) and was compared with sequences previously deposited in GenBank by means of BLAST search. The comparison revealed a sequence similarity of 98 to 99% with P. vulnus (e.g., GenBank Accession Nos. HM469437.1, EU130886.1, and JQ003994.1). P. vulnus is a known pathogen of boxwood (1). To our knowledge, this is the first report of P. vulnus in Ohio. References: (1) K. R. Barker. Plant Dis. Rep. 58:991, 1974. (2) P. Castillo and N. Vovlas. Pratylenchus (Nematoda: Pratylenchidae): Diagnosis, Biology, Pathogenicity and Management. Koninklijke Brill NV, Leiden, the Netherlands, 2007. (3) D. J. Hooper. In: Laboratory Methods for Work with Plant and Soil Nematodes. J. F. Southey, ed. Reference book 402. Ministry of Agriculture, Fisheries and Food, London, 1986. (4) G. C. Tenente et al. Nematropica 34:1, 2004.

First Confirmed Report of Sugar Beet Cyst Nematode, Heterodera schachtii, in North Dakota.

Sugar beet (Beta vulgaris L.) and canola (Brassica napus L.) are major crops in North Dakota, with sugar beet production primarily in the eastern part of the state in the Red River Valley and canola production across the northern half of the state. Both crops are hosts of sugar beet cyst nematode (SBCN), Heterodera schachtii Schmidt. In April 2011, soil samples were collected from four sugar beet fields belonging to three growers who believed the fields were infested with SBCN. The fields were located in a 65-km2 area in the Yellowstone Valley of western North Dakota. Cysts were extracted by sieving and Heterodera-like cysts with eggs were observed in all four soil samples. Population densities in the four fields ranged from 100 to 1,750 eggs/100 cm3 soil. Sugar beet seedlings (cv. M832224) were grown in a potting mix for 6 weeks in the greenhouse and then transferred to conetainers (type D40; volume 656 ml) containing autoclaved river sand. Conetainers were placed in sand in plastic pots immersed in a water bath at 27°C. Three plants were each infested with 800 eggs from field No. 2. After 55 days of incubation, the average number of females was 115 per plant. A similar experiment was conducted with canola cvs. Hyclass 940, Caliber 30, and Westar, which were inoculated with 500 eggs each from field No. 2. After 53 days of incubation, there was an average of 39, 20, and 30 females for each respective cultivar. Flask-shaped cysts (n = 26) from canola roots were light to dark brown; the vulval cone was ambifinestrate with dark brown, molar-shaped bullae positioned underneath the vulval bridge. Body length (excluding neck) ranged from 600 to 850 µm (mean 701.2 µm); body width, 350 to 580 µm (mean 469.2 µm); and length/width ratio, 1.2 to 1.8 (mean 1.5). Second-stage juvenile (J2) (n = 21) body length ranged from 400 to 485 µm (mean 437.1 µm); stylet length was 25 µm (no variation) with forwardly directed knobs; conical tail with rounded tip ranged from 37.5 to 55.0 µm long (mean 46.6 µm) with hyaline region from 20.0 to 32.5 µm (mean 27.3 µm); and lateral field presented four incisures. These morphometrics were used to identify H. schachtii according to Subbotin et al. (4). Confirmation of identification was by amplification and sequencing of a 28S rDNA gene fragment (1) from individual females (GenBank Accession No. JQ040526), which was 100% identical to H. schachtii 28S rDNA sequence (GenBank Accession No. GU475088). To our knowledge, this is the first confirmed report of H. schachtii in North Dakota. A 1958 report of SBCN in North Dakota (2) was not subsequently confirmed (3). Because there is extensive canola production across the northern part of the state bordering western and eastern sugar beet- production areas, canola may serve as a bridge for movement of SBCN from west to east. SBCN is a potential threat to these two important crops. References: (1) A. Amiri et al. Eur. J. Plant Pathol. 108:497, 2002. (2) F. Caveness. J. Sugar Beet Res. 10:544, 1958. (3) P. Donald and R. Hosford. Plant Dis. 64:45, 1980. (4) S. A. Subbotin et al. Systematics of Cyst Nematodes (Nematoda: Heteroderinae). Nematology Monographs and Perspectives. Vol. 8B. Brill, The Netherlands. 2010.

Genomic DNA sequence comparison between two inbred soybean cyst nematode biotypes facilitated by massively parallel 454 micro-bead sequencing.

Heterodera glycines, the soybean cyst nematode (SCN), is a damaging agricultural pest that could be effectively managed if critical phenotypes, such as virulence and host range could be understood. While SCN is amenable to genetic analysis, lack of DNA sequence data prevents the use of such methods to study this pathogen. Fortunately, new methods of DNA sequencing that produced large amounts of data and permit whole genome comparative analyses have become available. In this study, 400 million bases of genomic DNA sequence were collected from two inbred biotypes of SCN using 454 micro-bead DNA sequencing. Comparisons to a BAC, sequenced by Sanger sequencing, showed that the micro-bead sequences could identify low and high copy number regions within the BAC. Potential single nucleotide polymorphisms (SNPs) between the two SCN biotypes were identified by comparing the two sets of sequences. Selected resequencing revealed that up to 84% of the SNPs were correct. We conclude that the quality of the micro-bead sequence data was sufficient for de novo SNP identification and should be applicable to organisms with similar genome sizes and complexities. The SNPs identified will be an important starting point in associating phenotypes with specific regions of the SCN genome.

Correlation of Female Indices From Virulence Assays on Inbred Lines and Field Populations of Heterodera glycines.

A lack of diversity and durability of resistant soybean varieties complicates management of the soybean cyst nematode (SCN), Heterodera glycines, exemplified by the current overdependence on the PI 88788 source of resistance. Of interest is the effect of adaptation of a SCN population to a source of resistance on its subsequent ability to develop on others. Female indices (FI) from virulence assays (race, HG Type and SCN Type tests) for SCN field populations and inbred lines were analyzed. Female indices on PI 88788, PI 209332 and PI 548316 were highly correlated, as were those of PI 548402, PI 90763, PI 89772 and PI 438489B. Previous studies on resistant SCN-infected soybean roots indicated that the cellular resistance response was similar within these two groups of soybean genotypes. In field populations, highly significant correlations were also found between FI on PI 88788 and PI 548402 and those on PI 89772 and PI 437654. In inbred lines, FI on PI 437654 were correlated with PI 90763 and PI 438489B. To avoid further adaptation, rotation of cultivars with resistance from these groups should be carefully monitored, including those from the most promising source of resistance, PI 437654, such as CystX. In a separate test, 10 soybean varieties developed from CystX were tested against HG Type 0, HG Type 2.5.7 and HG Type 1-7. Female development occurred in all tests but one. Although identification and deployment of unique resistance is needed, management strategies to prevent and detect adaptation should be emphasized.

A model plant pathogen from the kingdom Animalia: Heterodera glycines, the soybean cyst nematode.

The soybean cyst nematode, Heterodera glycines, adversely affects the production of soybean, Glycine max, in many areas of the world, particularly in the United States, where it is the most economically important soybean pathogen. Despite the availability of hundreds of H. glycines-resistant soybean cultivars, the nematode continues to be a major limiting factor in soybean production. The use of nonhost rotation and resistance are the primary means of reducing losses caused by the nematode, but each of these options has disadvantages. As a subject for study of nematode parasitism and virulence, H. glycines provides a useful model despite its obligately parasitic nature. Its obligately sexual reproduction and ready adaptation to resistant cultivars, formerly referred to as "race shift," presents an excellent opportunity for the study of virulence in nematodes. Recent advances in H. glycines genomics have helped identify putative nematode parasitism genes, which, in turn, will aid in the understanding of nematode pathogenicity and virulence and may provide new targets for engineering nematode resistance.

Interactions Between the Soybean Cyst Nematode and Fusarium solani f. sp. glycines Based on Greenhouse Factorial Experiments.

ABSTRACT The soybean cyst nematode, Heterodera glycines, and the fungus that causes sudden death syndrome (SDS) of soybean, Fusarium solani f. sp. glycines, frequently co-infest soybean (Glycine max) fields. The interactions between H. glycines and F. solani f. sp. glycines were investigated in factorial greenhouse experiments with different inoculum levels of both organisms on a soybean cultivar susceptible to both pathogens. Measured responses included root and shoot dry weights, H. glycines reproduction, area under the SDS disease progress curve, and fungal colonization of roots. Both H. glycines and F. solani f. sp. glycines reduced the growth of soybeans. Reproduction of H. glycines was suppressed by high inoculum levels but not by low levels of F. solani f. sp. glycines. The infection of soybean roots by H. glycines did not affect root colonization by the fungus, as determined by real-time polymerase chain reaction. Although both pathogens reduced the growth of soybeans, H. glycines did not increase SDS foliar symptoms, and statistical interactions between the two pathogens were seldom significant.

Assessing Heterodera glycines-Resistant and Susceptible Cultivar Yield Response.

The soybean cyst nematode Heterodera glycines (SCN) is of major economic importance and widely distributed throughout soybean production regions of the United States where different maturity groups with the same sources of SCN resistance are grown. The objective of this study was to assess SCN-resistant and -susceptible soybean yield responses in infested soils across the north-central region. In 1994 and 1995, eight SCN-resistant and eight SCN-susceptible public soybean cultivars representing maturity groups (MG) I to IV were planted in 63 fields, either infested or noninfested, in 10 states in the north-central United States. Soil samples were taken to determine initial SCN population density and race, and soil classification. Data were grouped for analysis by adaptation based on MG zones. Soybean yields were 658 to 3,840 kg/ha across the sites. Soybean cyst nematode-resistant cultivars yielded better at SCN-infested sites but lost this superiority to susceptible soybean cultivars at noninfested sites. Interactions were observed among initial SCN population density, cultivar, and location. This study showed that no region-wide predictive equations could be developed for yield loss based on initial nematode populations in the soil and that yield loss due to SCN in our region was greatly confounded by other stress factors, which included temperature and moisture extremes.

A genetic linkage map of the soybean cyst nematode Heterodera glycines.

A genetic linkage map of the soybean cyst nematode (SCN) Heterodera glycines was constructed using a population of F2 individuals obtained from matings between two highly inbred SCN lines, TN16 and TN20. The AFLP fingerprinting technique was used to genotype 63 F2 progeny with two restriction enzyme combinations (EcoRI/MseI and PstI/TaqI) and 38 primer combinations. The same F2 population was also genotyped for Hg-cm-1 (H. glycines chorismate mutase-1), a putative virulence gene, using real-time quantitative PCR. Some of the markers were found to be distributed non-randomly. Even so, of the 230 markers analyzed, 131 could be mapped onto ten linkage groups at a minimum LOD of 3.0, for a total map distance of 539 cM. The Hg-cm-1 locus mapped to linkage group III together with 16 other markers. The size of the H. glycines genome was estimated to be in the range of 630-743 cM, indicating that the current map represents 73-86% of the genome, with a marker density of one per 4.5 cM, and a physical/genetic distance ratio of between 124 kb/cM and 147 kb/cM. This genetic map will be of great assistance in mapping H. glycines markers to genes of interest, such as nematode virulence genes and genes that control aspects of nematode parasitism.

The Effect of Resistant Soybean on Male and Female Development and Adult Sex Ratios of Heterodera glycines.

To determine whether currently used sources of resistance (soybean Plant Introductions [PI] 548402, 88788, 90763, 437654, 209332, 89772, and 548316) influence sex ratios in H. glycines, four inbred lines of the nematode characterized by zero or high numbers of females on resistant soybean were used to observe the number of adult males produced. Nematodes were allowed to infect soybean roots for 5 days in pasteurized sand. Infected plants were washed and transferred to hydroponic culture tubes. Males were collected every 2 to 3 days up to 30 days after infestation (DAI), and females were collected at 30 DAI. Resistance that suppressed adult females also altered adult male numbers. On PI 548402, 90763, and 437654, male numbers were low and close to zero, whereas on PI 88788, male numbers were higher (alpha = 0.05). In a separate experiment, the same PIs were infected by an inbred line that tested as an HG Type 0 (i.e., the numbers of females that developed on each PI were less than 10% of the number that developed on the standard susceptible soybean cultivar Lee). In this experiment, male numbers were similar to female numbers on PI 548402, 90763, 437654, and 89772, whereas male numbers on PI 88788, 209332, and 548316 were higher than those of females (alpha = 0.05). In all experiments, the total number of adults that developed to maturity relative to the number of second-stage juveniles that initially penetrated the root was less on resistant than on susceptible soybean (P

Heterodera glycines Infectivity and Egg Viability Following Nonhost Crops and During Overwintering.

The most effective management program for soybean cyst nematode, Heterodera glycines, is a crop rotation that uses nonhost crops and resistant soybean cultivars. However, little is known about the effects of rotation crops and overwintering on H. glycines biology. These experiments were initiated to determine the effects of seven alternative crops on H. glycines' ability to infect and mature on subsequent soybean crops, and to assess the viability of eggs during the overwintering months. Rotation studies were conducted for 2 years in each of two naturally infested fields, and overwintering tests were conducted in three consecutive growing seasons in one naturally infested field. Rotation crop and fallow treatments did not have a consistent effect on the ability of H. glycines to infect soybean or mature. Soybean yields were often higher following fallow or a nonhost crop than following soybean, although not usually significantly so. Heterodera glycines egg viability did not differ (P < 0.05) between overwintering months at 0-to-10 or 10-to-20-cm soil depths. These results suggest that H. glycines' ability to infect a subsequent soybean crop and develop to maturity is not diminished by nonhost crops or during the winter months.

Detection and Quantification of Fusarium solani f. sp. glycines in Soybean Roots with Real-Time Quantitative Polymerase Chain Reaction.

Fusarium solani f. sp. glycines is the causal organism of soybean sudden death syndrome (SDS). This organism is difficult to detect and quantify because it is a slow-growing fungus with variable phenotypic characteristics. Reliable and fast procedures are important for detection of this soybean pathogen. Protocols were optimized for extraction of DNA from pure fungal cultures and fresh or dry roots. A new procedure to test polymerase chain reaction (PCR) inhibitors in DNA extracts was developed. Novel real-time quantitative PCR (QPCR) assays were developed for both absolute and relative quantification of F. solani f. sp. glycines. The fungus was quantified based on detection of the mitochondrial small-subunit rRNA gene, and the host plant based on detection of the cyclophilin gene of the host plant. DNA of F. solani f. sp. glycines was detected in soybean plants both with and without SDS foliar symptoms to contents as low as 9.0 × 10-5 ng in the absolute QPCR assays. This is the first report of relative QPCR using the comparative threshold cycle (Ct) method to quantify the DNA of a plant pathogen relative to its host DNA. The relative QPCR assay is reliable if care is taken to avoid reaction inhibition and it may be used to further elucidate the fungus-host interaction in the development of SDS or screen for resistance to the fungus.

Distribution and Virulence Phenotypes of Heterodera glycines in Missouri.

The soybean cyst nematode, Heterodera glycines, is the most economically important pathogen of soybean in Missouri. Knowledge of the nematode's distribution and ability to adapt to resistant varieties is important for determining crop losses and establishing research priorities. No previous surveys of Missouri have provided reliable population density and phenotypic diversity data; therefore, we conducted a random survey to obtain both. Two samples from each of 200 fields were collected; 392 samples were processed for extractions of cysts and eggs. Two hundred and forty seven (63%) of the samples had detectable cyst nematode populations, which ranged from 15 to 149,700 eggs per 250 cm3 of soil. The lowest average population densities were observed in the east-central region of Missouri (2,260 eggs per 250 cm3 of soil), and the highest were observed in the northeast (9,238 eggs per 250 cm3 of soil), but among the eight regions sampled, mean population densities did not differ significantly. These population densities were potentially responsible for losses worth over $58 million in 1999 in Missouri. Race tests were conducted on populations from 183 samples. In order of frequency, races 3, 1, and 2 accounted for 86% of H. glycines populations. Nearly 60% of the populations were virulent (able to produce females) on plant introduction (PI) 88788, which is the source of resistance for most H. glycines-resistant cultivars. More than a third of the populations were virulent on cv. Peking, another common resistance source. Very few populations were virulent on PI 90763 or PI 437654, suggesting that these sources of resistance should be exploited more frequently.

Soybean Cyst Nematode Reduces Soybean Yield Without Causing Obvious Aboveground Symptoms.

Field experiments were conducted at locations in northern and southern Illinois, central Iowa, and central Missouri from 1997 to 1999 to investigate the effects of Heterodera glycines on soybean growth, development, and yield. A wide range of infestation levels was present at all locations. Two locally adapted cultivars, one resistant to H. glycines, were grown at each location. Cultivars were planted in alternating four-row strips with 76 cm between rows. For each cultivar, 20 1-m-long single-row plots were sampled every 2 weeks starting 4 weeks after planting. Infection by H. glycines reduced plant height and leaf and stem weight on the resistant cultivars in the first 12 weeks after planting, and delayed pod and seed development 12 to 14 weeks after planting. Biomass accumulation was not reduced on the susceptible cultivars until 10 weeks after planting; reduction in pod and seed development occurred throughout the reproductive stages. Susceptible cultivars produced significantly lower yields than resistant cultivars, but the yield reductions were not accompanied by visually detectable symptoms.

Is Change in Electrical Potential or pH a Hatching Signal for Heterodera glycines?

ABSTRACT This study explored the possibilities that changes in the egg shell/lipid layer electrical potential or pH communicate external hatching conditions to the Heterodera glycines second-stage juvenile (J2) within the mature egg and that electrophysiology could measure effects of chemicals on emergence. Potentials were measured following application of the emergence inducers (ZnSO(4) and ZnCl(2)), ions that do not affect emergence, or synthetic emergence inhibitors. Results were compared with pH measurements and emergence bioassays. Healthy appearing eggs had negative resting potentials. Application of ZnSO(4) caused a smooth depolarization. However, eggs containing J2 and immature eggs depolarized to a similar degree when ZnSO(4) was added. In addition, ZnSO(4), synthetic emergence inhibitors, and CaCl(2) caused similar depolarization, and some depolarization was measured in dye-permeable eggs and empty shells. Results suggest that change in cation surface charge contributed to depolarization and that Cl penetrated the egg shell/lipid layer without causing potential changes. In bioassays, zinc consistently stimulated emergence to a greater degree than H(2)O, other cations, or buffers, and counteracted emergence inhibitors. Zinc-caused emergence stimulation was independent of pH. In summary, it is concluded that depolarization and pH are not emergence signals and electrophysiology is unlikely to measure effectiveness of emergence stimulators or inhibitors.

A Revised Classification Scheme for Genetically Diverse Populations of Heterodera glycines.

Heterodera glycines, the soybean cyst nematode, is a major yield-limiting pathogen in most soybean production areas worldwide. Field populations of H. glycines exhibit diversity in their ability to develop on resistant soybean cultivars. Since 1970, this diversity has been characterized by a bioassay used to assign a race classification to a population. The value of the race scheme is reflected in the number and quality of resistant soybean cultivars that have been developed and released by soybean breeders and nematologists working in concert. However, the race scheme also has been misapplied as a means of studying H. glycines genotypes, in part due to the use of the term "race." For fungal and bacterial pathogen species, "race" can theoretically be applied to individuals of a population, thus allowing inference of individual genotypes. Application of a race designation to an individual egg or second-stage juvenile (J2) of H. glycines is not possible because a single J2 cannot be tested on multiple hosts. For other nematode species, "race" is defined by host ranges involving different plant species, whereas the H. glycines race test involves a set of lines of the same plant species. Nonetheless, because H. glycines populations vary in genetic diversity, and this variation has implications for management strategies, a mechanism is needed for documenting and discussing population differences. The HG Type scheme described herein avoids the implication of genetic uniformity or predictability in contrast to the way the race scheme has been used.

Lack of Predictable Race Shift in Heterodera glycines-Infested Field Plots.

Soybean cultivars with different sources of resistance to Heterodera glycines were grown at three locations initially infested with races 2, 3, and 6 in order to investigate H. glycines race shift in field populations. Each spring and fall, soil samples were taken from each plot and race tests were conducted to evaluate effects of cultivar and time of sampling. Field experiments were paired field plots rotated annually with corn since 1991. Cultivars included at the northern and central Missouri sites were Williams 82 (susceptible to H. glycines), Linford (PI 88788 source of resistance), MFA 9043 (Peking) replaced by Morsoy 9345 (Peking and PI 88788) from 1995 to 1997, and Jackson II (Peking + PI 88788) replaced by Asgrow 3431 (Peking and PI 88788) in 1996-97. Cultivars at the southern Missouri site were Essex or Hutcheson (susceptible to H. glycines), Forrest (Peking), Hartwig (PI 437654), and Rhodes (PI 88788 + Peking). In 1995, race tests were performed at four temperature regimes to determine temperature effects on race designations. Race shifts were not predictable based on the source of resistance of the soybean cultivar planted. Variability in female numbers on Lee 74 among tests caused changes in female indices (FI). Furthermore, race designations were influenced by the time of sampling and temperature at which the race tests were conducted. The variability of H. glycines populations in both field and greenhouse situations diminishes the value of race test results when making cultivar recommendations.