RESUMO
BACKGROUND: The recently identified Puccinia graminis f. sp. tritici (Pgt) race TTKSK (Ug99) poses a severe threat to global wheat production because of its broad virulence on several widely deployed resistance genes. Additional virulences have been detected in the Ug99 group of races, and the spread of this race group has been documented across wheat growing regions in Africa, the Middle East (Yemen), and West Asia (Iran). Other broadly virulent Pgt races, such as TRTTF and TKTTF, present further difficulties in maintaining abundant genetic resistance for their effective use in wheat breeding against this destructive fungal disease of wheat. In an effort to identify loci conferring resistance to these races, a genome-wide association study was carried out on a panel of 250 spring wheat breeding lines from the International Maize and Wheat Improvement Center (CIMMYT), six wheat breeding programs in the United States and three wheat breeding programs in Canada. RESULTS: The lines included in this study were grouped into two major clusters, based on the results of principal component analysis using 23,976 SNP markers. Upon screening for adult plant resistance (APR) to Ug99 during 2013 and 2014 in artificial stem rust screening nurseries at Njoro, Kenya and at Debre Zeit, Ethiopia, several wheat lines were found to exhibit APR. The lines were also screened for resistance at the seedling stage against races TTKSK, TRTTF, and TKTTF at USDA-ARS Cereal Disease Laboratory in St. Paul, Minnesota; and only 9 of the 250 lines displayed seedling resistance to all the races. Using a mixed linear model, 27 SNP markers associated with APR against Ug99 were detected, including markers linked with the known APR gene Sr2. Using the same model, 23, 86, and 111 SNP markers associated with seedling resistance against races TTKSK, TRTTF, and TKTTF were identified, respectively. These included markers linked to the genes Sr8a and Sr11 providing seedling resistance to races TRTTF and TKTTF, respectively. We also identified putatively novel Sr resistance genes on chromosomes 3B, 4D, 5A, 5B, 6A, 7A, and 7B. CONCLUSION: Our results demonstrate that the North American wheat breeding lines have several resistance loci that provide APR and seedling resistance to highly virulent Pgt races. Using the resistant lines and the SNP markers identified in this study, marker-assisted resistance breeding can assist in development of varieties with elevated levels of resistance to virulent stem rust races including TTKSK.
Assuntos
Basidiomycota/fisiologia , Cruzamento , Mapeamento Cromossômico/métodos , Resistência à Doença/genética , Loci Gênicos , Doenças das Plantas/microbiologia , Sementes/genética , Triticum/genética , Frequência do Gene/genética , Desequilíbrio de Ligação/genética , Fenótipo , Doenças das Plantas/genética , Caules de Planta/microbiologia , Polimorfismo de Nucleotídeo Único/genética , Análise de Componente Principal , Estações do Ano , Plântula/genética , Triticum/microbiologiaRESUMO
Wheat landraces provide a source of genetic variability for breeding. The emergence and spread of highly virulent races of the stem rust pathogen (Ug99 race group of Puccinia graminis f. sp. tritici) threaten wheat production globally. Spring wheat landraces were screened for resistance in eight field seasons at the Kenya Agricultural Research Institute, Njoro, where the Ug99 race group has become endemic. Accessions showing resistance in one season were retested and screened with molecular markers associated with resistance genes Sr2, Sr24, Sr36, and Lr34/Yr18; two height-reducing genes; and a photoperiod insensitivity allele. Of 2,509 accessions tested, 278 were categorized as resistant based on results from at least two seasons. Of these resistant accessions, 32 were positive for one or more markers for Sr2, Sr36, Rht-B1b, or Rht-D1b, indicating that they do not fit the definition of "landrace" because these genes were likely introduced via modern breeding practices. Thus, 246 resistant "landrace" accessions were identified. Of countries with more than five tested accessions, Afghanistan, Iran, Portugal, Ethiopia, Uzbekistan, Greece, Tajikistan, Bosnia and Herzegovina, and Serbia had at least 10% of tested accessions that were resistant to the Ug99 race group. Future research will characterize the resistance to determine its novelty and incorporate novel genes into improved lines.
RESUMO
Since the mid-1980s, rice cultivation has expanded rapidly in Burundi to reach approximately 50,000 ha in 2011. In 2007, leaf mottling, reduced tillering, and stunting symptoms were observed on rice at Gatumba near Bujumbura, causing small patches in less than 10% of the fields. Rice yellow mottle virus (RYMV, genus Sobemovirus), which has seriously threatened rice cultivation in Africa (1) and was recently described in the neighboring Rwanda (3), was suspected to be involved because of similar symptoms. To identify the pathogen that caused the disease in Burundi, a survey was performed in the major rice-producing regions of Burundi and Rwanda. Six locations in Burundi and four in Rwanda were investigated in April and October 2011. Disease incidence in the fields was estimated to be 15 ± 5%. Symptomatic leaves of 24 cultivated rice plants were collected and tested by double antibody sandwich-ELISA with polyclonal antibodies raised against the RYMV isolate Mg1 (2). All tested samples reacted positively. Four isolates were inoculated on susceptible Oryza sativa cultivar IR64 (2). The typical symptoms of RYMV were reproduced 7 days after inoculation, whereas the noninoculated controls remained healthy. Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from 12 samples. The RYMV coat protein gene was amplified by RT-PCR with primers 5'CGCTCAACATCCTTTTCAGGGTAG3' and 5'CAAAGATGGCCAGGAA3' (3). The sequences were deposited in GenBank (Accession Nos. HE654712 to HE654723). To characterize the isolates, the sequences of the tested samples were compared in a phylogenic tree including a set of 45 sequences of isolates from Rwanda, Uganda, western Kenya, and northern Tanzania (2,3). Six isolates from western Burundi, namely Bu1, Bu2, Bu4, Bu7, Bu10, and Bu13 (Accession Nos. HE654712 to HE654716 and HE654718), and the isolate Rw208 (HE654720) from southwestern Rwanda, belonged to strain S4-lm previously reported near Lakes Malawi and Tanganyika. They fell within the group gathering isolates from the western Bugarama plain of Rwanda (3). The isolates Bu16 (HE654719) and Bu17 (HE654717) from Mishiha in eastern Burundi belonged to strain S4-lv previously reported around Lake Victoria. However, they did not cluster with isolates from the eastern and southern provinces of Rwanda. They were genetically more closely related to isolates of strain S4-lv from northern Tanzania. Overall, the phylogeography of RYMV in Burundi and Rwanda region was similar. In the western plain of the two countries, the isolates belonged to the S4-lm lineage, whereas at the east of the two countries at midland altitude, they belonged to the S4-lv lineage. The presence of RYMV in Burundi should be considered in the future integrative pest management strategies for rice cultivation in the country. References: (1) D. Fargette et al. Annu. Rev. Phytopathol. 44:235, 2006. (2) Z. L. Kanyeka et al. Afr. Crop Sci. J. 15:201, 2007. (3) I. Ndikumana et al. New Dis. Rep. 23:18, 2011.
RESUMO
Wheat stem rust (Puccinia graminis f. sp. tritici) race TTKSK (Ug99), with virulence to the majority of the world's wheat (Triticum aestivum) cultivars, has spread from Uganda throughout eastern Africa, Yemen, and Iran. The identification and spread of variants of race TTKSK with virulence to additional stem rust resistance genes has reminded breeders and pathologists of the danger of deploying major resistance genes alone. In order to protect wheat from this rapidly spreading and adapting pathogen, multiple resistance genes are needed, preferably from improved germplasm. Preliminary screening of over 700 spring wheat breeding lines and cultivars developed at least 20 years ago identified 88 accessions with field resistance to Ug99. We included these resistant accessions in the stem rust screening nursery in Njoro, Kenya for two additional seasons. The accessions were also screened with a bulk of North American isolates of P. graminis f. sp. tritici in the field in St. Paul, MN. In order to further characterize the resistance in these accessions, we obtained seedling phenotypes for 10 races of P. graminis f. sp. tritici, including two races from the race TTKSK complex. This phenotyping led to the identification of accessions with either adult-plant or all-stage resistance to race TTKSK, and often North American races of P. graminis f. sp. tritici as well. These Ug99 resistant accessions can be obtained by breeders and introgressed into current breeding germplasm.
RESUMO
The stem rust resistance gene Sr36 confers a near-immune resistance reaction to many races of Puccinia graminis f. sp. tritici and is highly effective against race TTKSK (syn. Ug99), which possesses unusually broad virulence combinations. Because this gene is widely used in United States soft winter wheat germplasm and cultivars, it has been considered to be an important source of resistance to TTKSK. In 2007, moderately susceptible infection responses were observed on wheat lines and cultivars carrying Sr36 in a field screening nursery for stem rust at Njoro, Kenya. We derived 18 single-pustule isolates from stem rust samples collected from the 2007 Njoro nursery. The isolates were evaluated for virulence on 20 North American stem rust differential lines and on wheat lines and cultivars carrying Sr36, Sr31+Sr36, and Sr24+Sr31. Of the 18 isolates, 10 produced infection types 3+ to 4 on line W2691SrTt-1 (monogenic for Sr36) and other lines that carry Sr36 and belonged to a new virulence phenotype that was not detected in previous years. These isolates were identified as race TTTSK. The remaining eight isolates were identified as races TTKSK (five isolates) and TTKST (three isolates), with avirulence and virulence, respectively, to Sr24. Thirteen simple sequence repeat (SSR) markers were used to examine the genetic relationships among the three races in the TTKS lineage. All isolates in the lineage shared an identical SSR genotype and were clearly different from North American races. In all, 16 wheat cultivars and 60 elite breeding lines, postulated to possess Sr36, were susceptible to race TTTSK. The occurrence of race TTTSK with combined virulence on Sr31 and Sr36 has further broadened the virulence spectrum of the TTKS lineage and rendered an important source of resistance ineffective.
RESUMO
Stem rust, caused by Puccinia graminis f. sp. tritici, historically was one of the most destructive diseases of wheat and barley. The disease has been under effective control worldwide through the widespread use of host resistance. A number of stem rust resistance genes in wheat have been characterized for their reactions to specific races of P. graminis f. sp. tritici. Adult plant responses to race TTKS (also known as Ug99) of monogenic lines for Sr genes, a direct measurement of the effectiveness for a given gene, have not been investigated to any extent. This report summarizes adult plant infection responses and seedling infection types for monogenic lines of designated Sr genes challenged with race TTKS. High infection types at the seedling stage and susceptible infection responses in adult plants were observed on monogenic lines carrying Sr5, 6, 7a, 7b, 8a, 8b, 9a, 9b, 9d, 9g, 10, 11, 12, 15, 16, 17, 18, 19, 20, 23, 30, 31, 34, 38, and Wld-1. Monogenic lines of resistance genes Sr13, 22, 24, 25, 26, 27, 28, 32, 33, 35, 36, 37, 39, 40, 44, Tmp, and Tt-3 were effective against TTKS both at the seedling and adult plant stages. The low infection types to race TTKS observed for these resistance genes corresponded to the expected low infections of these genes to other incompatible races of P. graminis f. sp. tritici. The level of resistance conferred by these genes at the adult plant stage varied between highly resistant to moderately susceptible. The results from this study were inconclusive for determining the effectiveness of resistance genes Sr9e, 14, 21, and 29 against race TTKS. The understanding of the effectiveness of individual Sr genes against race TTKS will facilitate the utilization of these genes in breeding for stem rust resistance in wheat.