Motor imagery helps updating internal models during microgravity exposure.

Skilled movements result from a mixture of feedforward and feedback mechanisms conceptualized by internal models. These mechanisms subserve both motor execution and motor imagery. Current research suggests that imagery allows updating feedforward mechanisms, leading to better performance in familiar contexts. Does this still hold in radically new contexts? Here, we test this ability by asking participants to imagine swinging arm movements around shoulder in normal gravity condition and in microgravity in which studies showed that movements slow down. We timed several cycles of actual and imagined arm pendular movements in three groups of subjects during parabolic flight campaign. The first, control, group remained on the ground. The second group was exposed to microgravity but did not imagine movements inflight. The third group was exposed to microgravity and imagined movements inflight. All groups performed and imagined the movements before and after the flight. We predicted that a mere exposure to microgravity would induce changes in imagined movement duration. We found this held true for the group who imagined the movements, suggesting an update of internal representations of gravity. However, we did not find a similar effect in the group exposed to microgravity despite the fact that the participants lived the same gravitational variations as the first group. Overall, these results suggest that motor imagery contributes to update internal representations of the considered movement in unfamiliar environments, while a mere exposure proved to be insufficient.NEW & NOTEWORTHY Gravity strongly affects the way movements are performed. How internal models process this information to adapt behavior to novel contexts is still unknown. The microgravity environment itself does not provide enough information to optimally adjust the period of natural arm swinging movements to microgravity. However, motor imagery of the task while immersed in microgravity was sufficient to update internal models. These results show that actually executing a task is not necessary to update graviception.

Citrus juice fermented with Lactobacillus plantarum YIT 0132 alleviates symptoms of perennial allergic rhinitis in a double-blind, placebo-controlled trial.

This study aimed to examine whether citrus juice fermented with Lactobacillus plantarum YIT 0132 (LP0132), which was pasteurised after fermentation, could alleviate the symptoms of perennial allergic rhinitis in a double-blind, placebo-controlled, parallel-group trial. Subjects with perennial allergic rhinitis consumed LP0132-fermented juice (n=17) or unfermented citrus juice (placebo; n=16) once a day for 8 weeks. During the pre-intervention and intervention periods, the subjects recorded nasal symptoms (number of sneezing attacks, number of nose-blowing incidents, and stuffy nose score). The primary endpoint, nasal symptoms score (NSS), was scored from 0 to 4 according to the 'Practical Guideline for the Management of Allergic Rhinitis in Japan 2009' using a combination of the three nasal symptom items. Blood samples were collected at pre-intervention and at 8 weeks after commencing the intervention. There were several significant improvements not only in the LP0132 group but also in the placebo group because of potential anti-allergic effects of citrus. Compared with the placebo group, the LP0132 group showed a significant reduction in the NSS and stuffy nose score during the intervention period. Also, the LP0132 group, but not the placebo group, showed significant attenuation of type 2 helper T cells (Th2 cells)/helper T cells, serum total immunoglobulin E (IgE), and eosinophil cationic protein (ECP), and showed significant augmentation of type 1 helper T cells (Th1 cells)/Th2 cells at 8 weeks of intervention compared with baseline. It is suggested that daily intake of fermented citrus juice containing heat-killed LP0132 has beneficial effects on symptoms of perennial allergic rhinitis, and these benefits may be associated with the attenuation of Th2 cells, total IgE, and ECP via the immunomodulating activities of LP0132.

Improvement of efficiency and temperature control of induction heating vapor source on electron cyclotron resonance ion source.

An electron cyclotron resonance ion source (ECRIS) is used to generate multicharged ions for many kinds of the fields. We have developed an evaporator by using induction heating method that can generate pure vapor from solid state materials in ECRIS. We develop the new matching and protecting circuit by which we can precisely control the temperature of the induction heating evaporator. We can control the temperature within ±15 °C around 1400 °C under the operation pressure about 10(-4) Pa. We are able to use this evaporator for experiment of synthesizing process to need pure vapor under enough low pressure, e.g., experiment of generation of endohedral Fe-fullerene at the ECRIS.

Multiscale modeling of nanowire-based Schottky-barrier field-effect transistors for sensor applications.

We present a theoretical framework for the calculation of charge transport through nanowire-based Schottky-barrier field-effect transistors that is conceptually simple but still captures the relevant physical mechanisms of the transport process. Our approach combines two approaches on different length scales: (1) the finite element method is used to model realistic device geometries and to calculate the electrostatic potential across the Schottky barrier by solving the Poisson equation, and (2) the Landauer-Büttiker approach combined with the method of non-equilibrium Green's functions is employed to calculate the charge transport through the device. Our model correctly reproduces typical I-V characteristics of field-effect transistors, and the dependence of the saturated drain current on the gate field and the device geometry are in good agreement with experiments. Our approach is suitable for one-dimensional Schottky-barrier field-effect transistors of arbitrary device geometry and it is intended to be a simulation platform for the development of nanowire-based sensors.

First Report of Tomato chlorotic spot virus Infecting Spilanthes oleracea in Brazil.

Spilanthes oleracea L., popularly known as toothache plant, belongs to the family Asteraceae and is a South American native plant. Fresh leaves can be eaten for their medicinal properties or used by the cosmetics industry for their spilol contents. Plants showing leaf deformation that were collected in a field in São Paulo State, Brazil in March 2005 were suspected to be infected by a virus. Electron microscopy of leaf dip preparations of symptomatic plants revealed pleiomorphic particles typical of tospoviruses. Extracts from these plants prepared with 0.01 M sodium phosphate buffer, pH 7.0, containing 1% sodium sulfite were mechanically inoculated to indicator plants. Chenopodium amaranticolor and Gomphrena globosa were symptomless. Necrotic local lesions were observed on C. quinoa. Necrotic local lesions followed by a systemic necrosis that caused the death of the plants were observed on Datura stramonium, Nicotiana glutinosa, and N. tabacum 'TNN' and 'Turkish'. Concentric rings followed by systemic necrosis and plant death were induced on N. rustica, N. tabacum 'Havana 425', N. clevelandii, Physalis floridana, Capsicum annum 'Magda', and Solanum lycopersicum 'Santa Clara'. Total RNA was extracted (1) from infected S. oleracea and N. rustica plants for reverse transcription-PCR amplification with tospovirus specific primers BR60 (5' CCCGGATCCTGCAGAGCAATTGTGTCA 3') and BR65 (5' ATCAAGCCTTCTGAAAGTCAT 3') (2), which amplified an approximate 440-bp fragment covering part of the nucleocapsid protein gene. This fragment was sequenced (EMBL Accession No. AM887766) and showed 99% nt sequence identity with Tomato chlorotic spot virus (TCSV) (GenBank Accession No. AF521102), a tospovirus species (3). To our knowledge, this is the first report of a tospovirus infecting S. oleracea in Brazil and indicates that this plant might constitute a reservoir of TCSV or other tospoviruses that could also infect tomato and pepper plants. References: (1) Y. D. Bertheau et al. DNA amplification by polymerase chain reaction (PCR) 1998 in: Methods for the Detection and Quantification of Erwinia carotovora subsp. atroseptica on Potatoes. M. C. N. Perombelon and J. M. van der Wolf, eds. Scott. Crop Res. Inst. Occas. Publ. Dundee, Scotland, 1998. (2) M. Eiras et al. Fitopatol. Bras. 26:170, 2001. (3) F. Lovato et al. Virus Genes 29:321, 2004.

Effect of Bifidobacterium bifidum fermented milk on Helicobacter pylori and serum pepsinogen levels in humans.

Helicobacter pylori infection is an important risk factor for gastric diseases. Some probiotics are useful for suppressing H. pylori infection. Bifidobacterium bifidum YIT 4007 can improve the experimental gastric injury in rats and the disease stages on the gastric mucosa in peptic ulcer patients. We evaluated the fermented milk using a clone (BF-1) having the stronger ability to survive in the product than this parent strain to clarify the in vitro suppressive effect of BF-1 on H. pylori and the in vivo efficacy of BF-1 fermented milk on H. pylori and gastric health. In the mixed culture assay of BF-1 and H. pylori, the number of pathogens was decreased such that it was not detected after 48 h in the Brucella broth with a decrease in pH values. In the cell culture experiment with human gastric cells, the H. pylori infection-induced IL-8 secretion was suppressed by the preincubation of BF-1. In a human study of 12-wk ingestion (BF-1 group, n = 40; placebo group, n = 39) with a randomized double-blind placebo-control design, the H. pylori urease activity and gastric situation were evaluated using a urea breath test (UBT) and the serum pepsinogen (PG) levels as biomarkers for inflammation or atrophy, respectively. In the H. pylori-positive subjects, the difference (DeltaUBT) of the UBT value from the baseline value in the BF-1 group (n = 34) was lower than that in the placebo group (n = 35) at 8 wk. The baseline UBT values showed a negative correlation with DeltaUBT values at 8 and 12 wk in the BF-1 group but not in the placebo. In the PG-positive subjects classified by the PG test method, the BF-1 group was lower in DeltaUBT values than the placebo group at 8 and 12 wk. In the active gastritis class by PG levels, the BF-1 group was lower in their DeltaUBT values than the placebo at 8 and 12 wk. The PG I levels in the BF-1 group were lower than the placebo at 12 wk. The PG II levels in the BF-1 group did not change during the ingestion period, but the placebo was increased. The PG I/II ratios slightly decreased from baseline at 12 and 20 wk in the BF-1 and placebo groups. These patterns were also observed in the H. pylori-positive subjects. The improving rates of upper gastrointestinal symptomatic subjects and total symptom numbers in the BF-1 group were higher than those in the placebo. These results indicate that BF-1 fermented milk may affect H. pylori infection or its activity, gastric mucosal situation, and the emergence of upper gastrointestinal symptoms.

Stretch reflex excitability of the anti-gravity ankle extensor muscle in elderly humans.

AIM: To examine whether the stretch reflex excitability of the soleus muscle changes with age, stretch reflexes at rest (REST) and during weak voluntary contractions (ACT) were elicited in 18 older and 14 younger subjects. METHOD: The amplitude of the stretch reflex responses and gain, defined as the gradient of the regression line for the relation between stretch reflex responses against the angular velocity of the applied perturbation, were evaluated in each short-latency (M1) and two long-latency components (M2 and M3). RESULTS: It was found that in the older group, both the amplitude and gain of the M1 component did not change from the REST to the ACT conditions, whereas in the younger group both variables significantly increased from the REST to ACT conditions. The latency of the M1 component was significantly shorter under the REST condition (older vs. younger: 51.8 +/- 7.37 vs. 55.1 +/- 8.69 ms), while no group differences were found in those variables under the ACT condition, suggesting that the muscle-tendon complexes of SOL muscles of the older subjects were less elastic and had less slack, probably due to age-related histochemical alterations. Further, the Hoffman reflex (H-reflex), elicited during the REST condition in 10 older and 11 younger subjects showed no significant differences, suggesting that the soleus motoneuron response to the Ia input was comparable between the two subject groups. CONCLUSION: The histochemical alterations occurring with the ageing process might augment the short-latency stretch reflex in the SOL muscle without enhancement of motoneuronal excitability, and this effect might be masked when the muscle is voluntarily activated.

Somatosensory graviception inhibits the soleus H-reflexin standing man - an underwater experiment-.

H-reflexes were elicited in the soleus muscle in subjects standing on a force platform in a water tank, under different loading conditions at the ankle joint. The joint loading was altered by changing the combination of buoys and weights attached to lower limb segments, while the total body mass was kept the same. The results revealed that as the joint load was reduced the H-reflex was significantly enhanced as compared to that under the control condition, while it decreased as the joint load was increased, despite the same background EMG activity level. It was demonstrated that the augmented load information from the lower limb joints has an inhibitory effect on the soleus H-reflex, suggesting that this might be one of underlying neural mechanisms responsible for the suppression of H-reflex during human upright standing.

Reciprocal angular acceleration of the ankle and hip joints during quiet standing in humans.

Human quiet standing is often modeled as a single inverted pendulum rotating around the ankle joint, under the assumption that movement around the hip joint is quite small. However, several recent studies have shown that movement around the hip joint can play a significant role in the efficient maintenance of the center of body mass (COM) above the support area. The aim of this study was to investigate how coordination between the hip and ankle joints is controlled during human quiet standing. Subjects stood quietly for 30 s with their eyes either opened (EO) or closed (EC), and we measured subtle angular displacements around the ankle (thetaa) and hip (thetah) joints using three highly sensitive CCD laser displacement sensors. Reliable data were obtained for both angular displacement and angular velocity (the first derivative of the angular displacement). Further, measurement error was not predominant, even among the angular acceleration data, which were obtained by taking the second derivative of the angular displacement. The angular displacement, velocity, and acceleration of the hip were found to be significantly greater (P<0.001) than those of the ankle, confirming that hip-joint motion cannot be ignored, even during quiet standing. We also found that a consistent reciprocal relationship exists between the angular accelerations of the hip and ankle joints, namely positive or negative angular acceleration of ankle joint is compensated for by oppositely directed angular acceleration of the hip joint. Principal component analysis revealed that this relationship can be expressed as: thetah=gammathetaa with gamma=-3.15+/-1.24 and gamma=-3.12+/-1.46 (mean +/-SD) for EO and EC, respectively, where theta is the angular acceleration. There was no significant difference in the values of y for EO and EC, and these values were in agreement with the theoretical value calculated assuming the acceleration of COM was zero. On the other hand, such a consistent relationship was never observed for angular displacement itself. These results suggest that the angular motions around the hip and ankle joints are not to keep the COM at a constant position, but rather to minimize acceleration of the COM.

Functional stochastic resonance in the human brain: noise induced sensitization of baroreflex system.

We demonstrate experimentally that noise can enhance the homeostatic function in the human blood pressure regulatory system. The results show that the compensatory heart rate response to the weak periodic signal introduced at the venous blood pressure receptor is optimized by adding noise to the arterial blood pressure receptor. We conclude that this functional stochastic resonance most likely results from the interaction of noise with signal in the brain stem, where the neuronal inputs from these two different receptors first join together.

Mechanism of stochastic resonance enhancement in neuronal models driven by 1/f noise.

Noise can assist neurons in the detection of weak signals via a mechanism known as stochastic resonance (SR). In a previous study [Phys. Lett. A 243, 281 (1998)], we showed that when colored noise with 1/f(beta) spectrum is added to the FitzHugh-Nagumo (FHN) neuronal model, the optimal noise variance for SR could be minimized with beta approximately 1. In this study, we investigate analytically how the noise color (beta) affects the SR profile in a linearized version of the FHN model. We demonstrate that the aforementioned effect of 1/f noise is related to the dynamical characteristics of the model neuron, i.e., the refractory period, the low-pass filtering effect of the membrane capacitance, and the high-pass filtering effect of the recovery variable.

Gravity-dependent modulation of Ia afferent in human.

Recent work has shown that the H-reflex excitability of the human soleus motoneurones is modulated in reduced gravity and accompanied by a corresponding change in electromyographic (EMG) activity during space flight mission or different gravitational load. Spinal reflexes are often viewed as stereotyped motor patterns with limited scope for modification. However, recent evidence suggests that even short-latency, largely monosynaptic reflexes show a high degree of modulation during simple human motor activities such as walking and standing, and that the pattern of modulation can be specifically altered for the different functional requirements of each activity. Capady and Stein have demonstrated that H-reflex amplitude of the soleus increases progressively during the stance phase and reaches its peak amplitude late in the stance phase during walking. However, during running, the H-reflex is found to be significantly smaller than during walking, suggestion a modified spinal reflex gain for the different functional requirements of the motor behaviors. It is well documented that gravitational loads on the human body, spinal cords are much higher during standing in the water than standing in land. Little is known about the occurrence and influence of neural modulation in spinal cord during different gravitational load, which was not induced by posture but by voluntary background activity. The purpose of the present study was consequently to investigate how to effect is controlled H-reflex modulated during reduced gravity standing in a water in normal subjects.

Supraspinal effects on the fractal correlation in human H-reflex.

In our previous study, 1/f beta-type power spectrum with the spectral exponent beta significantly greater than zero was found in the variability of soleus H-reflex amplitudes. This result indicated that the H-reflex variability was time-correlated owing to fractal characteristics. Furthermore, it was also suggested that the fractal characteristics were generated at the spinal level. The purpose of the present study was to investigate whether the fractal nature of the H-reflex variability was influenced by the loss of supraspinal input. Six healthy normal subjects and seven patients with spinal cord injury participated in this study. Soleus H-reflexes were evoked every 1 s from both legs simultaneously (stimulation intensity: motor threshold) and 1050 successive amplitudes of the H-reflex were recorded. The H-reflex sequence evoked from each leg was analyzed by "coarse graining spectral analysis" to calculate the spectral exponent beta. The value of beta was used to evaluate the level of time-correlation (fractal correlation). Cross-spectral analysis was used to evaluate the degree of synchronization between the H-reflex sequences evoked from both legs. The beta values for normal subjects (0.84 +/- 0.33, left leg; 0.88 +/- 0.34. right leg) were significantly greater (P < 0.001) than those for patients (0.31 +/- 0.18, left leg; 0.32 +/- 0.14, right leg), suggesting that the H-reflex sequences for normal subjects were more time-correlated than for patients. In the frequency range less than 0.2 Hz, the coherence of both legs was high (0.41 +/- 0.14) for normal subjects as compared to 0.20 +/- 0.12 for patients (P < 0.005). In this frequency range, the phase was almost 0 rad for normal subjects, indicating that the H-reflex variabilities of both legs were synchronized. These results suggested that (1) the strong fractal correlation observed in the H-reflex sequences for normal subjects was associated with supraspinal input, and (2) such supraspinal input had equal influence on the reflex arcs of the soleus of both legs.

Fractal correlation in human H-reflex.

The amplitude of the H-reflex has been known to have considerable variability even if the intensity of the stimulation is held constant. However, previous studies largely ignored the time-dependent profile of this variability. Recent mathematical analyses have shown that some seemingly irregular biological signals have fractal properties. A fractal time series is characterized by the property of self-similarity (self-affinity), and has long-range time correlation. The aim of this study was to investigate the question of whether the fluctuation of H-reflex was fractal with strong time-correlation. Soleus H-reflexes were evoked in five healthy subjects at two levels of stimulation intensity [1.2 MT (motor threshold) and 0.9 MT] every 1 s and 1050 successive amplitudes of H-wave and M-wave were recorded twice. The sequences of the H-wave and the M-wave amplitudes were analyzed by "coarse graining spectral analysis" to calculate the percentage of random fractal components in the sequences (%Fractal) and the spectral exponent beta. The %Fractal values of both sequences were above 90% [H-wave: 93.3 +/- 2.3% (1.2 MT), 91.6 +/- 3.1% (0.9 MT); M-wave: 94.3 +/- 3.3%; mean +/- SD]. Nonflat power spectra of the fractal components were observed for the H-wave sequences regardless of the stimulation intensity [beta = 0.75 +/- 0.26 (1.2 MT), 0.80 +/- 0.39 (0.9 MT)], indicating that the sequences were strongly time correlated. On the other hand, the M-wave sequences had a flatter spectrum (beta = 0.26 +/- 0.14) which was close to uncorrelated white noise. These results indicated that: (1) the fractal correlation found in the H-wave sequences was caused neither by the conduction through nerve fibers nor by the transmission at the neuromuscular junction, because the M-wave sequence had a significantly weaker time correlation, and (2) antidromic impulses in a motor nerve induced by the stimulation made a minor contribution to the generation of fractal correlation in the H-wave sequences, because it was preserved when the stimulation intensity was below MT. It was suggested that the fractal correlation in human H-reflex was generated at the synaptic connections to alpha-motoneurons in the spinal cord.

Specific tension of elbow flexor and extensor muscles based on magnetic resonance imaging.

Series cross-section images of the upper extremity were obtained for four men by magnetic resonance imaging (MRI) and anatomical cross-sectional areas (ACSA) of elbow flexor muscles [biceps brachii (BIC), brachialis (BRA), brachioradialis (BRD)] and extensor muscles [triceps brachii (TRI)] were measured. Physiological cross-sectional area (PCSA) was calculated from the muscle volume and muscle fibre length, the former from the series ACSA and the latter from the muscle length multiplied by previously reported fibre/muscle length ratios. Elbow flexion/extension torque was measured using an isokinetic dynamometer and the force at the tendons was calculated from the torque and moment arms of muscles measured by MRI. Maximal ACSA of TRI was comparable to that of total flexors, while PCSA of TRI was greater by 1.9 times. Within flexors, BRA had the greatest contribution to torque (47%), followed by BIC (34%) and BRD (19%). Specific tension related to the estimated velocity of muscle fibres were similar for elbow flexors and extensors, suggesting that the capacity of tension development is analogous between two muscle groups.

Reliability of measurement of oxygen uptake by a portable telemetric system.

The purpose of the present study was to check the reliability of measurements of oxygen uptake (VO2) using a newly developed portable telemetry system. This system (K2) consisted of a face mask, a flow meter, a gas analyser with a transmitter, and a receiver. The total mass for the subject to carry was about 850 g. Three experiments were carried out, firstly to check the reliability and reproducibility of the flow meter and the K2 gas analyser, secondly to check the accuracy of K2 by comparing it with the Douglas bag method (DB), and thirdly to apply K2 to sports activities. In the first experiment, the flow meter was highly accurate up to 180 l.min-1 with good reproducibility. The measurement error of the gas analyser was less than 2%. In the second experiment, there was no significant difference in the calculated ventilation between K2 and DB. The VO2 showed no significant difference between K2 and DB with some exceptions. In the third experiment, we succeeded in the measurement of VO2 during rowing on water. The measurement of VO2 during running and playing soccer was also possible. It would seem that the present system could well be a powerful tool in the field measurement of VO2 during various sports activities.