Bactericera cockerelli Picorna-like Virus and Three New Viruses Found Circulating in Populations of Potato/Tomato Psyllids (Bactericera cockerelli).

An investigation of viruses circulating in populations of field and laboratory potato/tomato psyllids (Bactericera cockerelli) was conducted using high-throughput sequencing (HTS) technology and conventional RT-PCR. Three new viruses were discovered: one from the family Tymoviridae and two from the family Solemoviridae. A tymo-like virus sequence represented a nearly complete 6843 nt genome of a virus named Bactericera cockerelli tymo-like virus (BcTLV) that spanned five open reading frames (ORFs) which encoded RNA-dependent RNA polymerase (RdRP), helicase, protease, methyltransferase, and a capsid protein. Phylogenetic analyses placed the RdRP of BcTLV inside a divergent lineage of the viruses from the family Tymoviridae found in insect and plant hosts in a sister clade to the genera Tymovirus, Marafivirus, and Maculavirus. Four solemo-like virus sequences were identified in the HTS outputs, representing two new viruses. One virus found only in field-collected psyllids and named Bactericera cockerelli solemo-like virus 1 (BcSLV-1) had a 5479 nt genome which spanned four ORFs encoding protease and RdRP. Three solemo-like sequences displayed 87.4-99.7% nucleotide sequence identity among themselves, representing variants or strains of the same virus named Bactericera cockerelli solemo-like virus 2 (BcSLV-2). The genome of BcSLV-2 spanned only two ORFs that encoded a protease and an RdRP. Phylogenetic analysis placed the RdRPs of BcSLV-1 and BcSLV-2 in two separate lineages as sister clades to viruses from the genus Sobemovirus found in plant hosts. All three new psyllid viruses were found circulating in psyllids collected from potato fields in southern Idaho along with a previously identified Bactericera cockerelli picorna-like virus. Any possible role of the three viruses in controlling populations of the field psyllids remains to be elucidated.

Occurrence of grapevine yellow speckle viroid 2 and Australian grapevine viroid in Idaho grapevines.

Grapevine yellow speckle viroid 2 (GYSVd-2; Pospiviroidae, Apscaviroid) causes yellow speckle disease in grapevine (Koltunow et al. 1989) and was found in Australia, Iran, Italy, China, and Nigeria (Koltunow et al. 1989; Habili 2017; Zongoma et al. 2018). In the U.S., GYSVd-2 was found in the State of Washington (Vitis vinifera L. cv. Merlot; Alabi et al., 2012). Australian grapevine viroid (AGVd; Pospiviroidae, Apscaviroid) was reported in Australia, Italy, China, Tunisia, Iran, and in the U.S. wine grapes (V. vinifera) (Habili 2017). In the U.S., AGVd was reported from California (Al Rwahnih et al. 2009), from Washington State (V. vinifera cv. Syrah; GU327604), and from the State of New York (an unknown cv. of V. vinifera; KY081960). In Idaho, two other viroids, hop stunt viroid (HSVd; Pospiviroidae, Hostuviroid) and grapevine yellow speckle viroid 1 (GYSVd-1; Pospiviroidae, Apscaviroid), common in grapevines were previously found in wine grapes (Thompson et al. 2019) but neither GYSVd-2 nor AGVd were identified in the same high-throughput sequencing (HTS) outputs. In September 2020, 16 leaf and petiole samples were collected from six vineyards in Canyon and Nez Perce counties of Idaho, representing six different wine grape cultivars and an unknown table grape cultivar, and subjected to HTS analysis. One of the samples was from a table grape plant at the edge of a declining 'Chardonnay' wine grape block that was grown next to a wine tasting room deck for aesthetic, ornamental purposes; the table grape and 'Chardonnay' plants were own-rooted and planted in 1981. Ribodepleted total RNAs prepared from these samples, as described previously, were subjected to a HTS analysis on a NovaSeq platform (Dahan et al. 2023), producing 15,095,042 to 31,500,611 250-bp paired-end reads per sample. Raw reads were adapter and quality cleaned and mapped against the V. vinifera, reference genome. Unmapped paired-end reads were assembled, and contigs were analyzed using BLASTn and DIAMOND (Buchfink et al. 2021) programs. Fifteen samples were found infected with HSVd and with GYSVd-1, while one was infected with GYSVd-2 and AGVd; in particular, the table grape plant (arbitrarily designated RBTG) was found infected with all four viroid species. The HTS-derived, 490-nt GYSVd-2-specific contig from the table grape sample represented ∼1.35 genome of the Idaho isolate of GYSVd-2 (GYSVd-2-RBTG) and was 100% identical to the GYSVd-2 sequence JQ686716 from Iran. The HTS-derived, 488-nt AGVd-specific contig represented ∼1.32 genome of the Idaho isolate of AGVd (AGVd-RBTG) and was 100% identical to the AGVd sequence KF876037 from Iran. To validate the HTS data and confirm the presence of the four viroids in the original 16 samples, all of them were subjected to RT-PCR using the viroid-specific primers described by Gambino et al. (2014); all 16 samples were found positive for HSVd and GYSVd-1, and one found positive for AGVd. The RBTG sample was confirmed to be infected with HSVd, GYSVd-1, and AGVd by RT-PCR. GYSVd-2 sequence was not amplified, although primers designed by Gambino et al. (2014) matched the HTS-derived GYSVd-2-RBTG sequence; this may be related to a lower concentration of this viroid in the sample and to properties of the primers. The sampled table grape plant was asymptomatic; all four viroids were apparently not associated with any visible abnormalities in this table grape plant, consistent with the findings that viroids found in grapevines typically do not seem to be associated with visible diseases (Habili 2017).

Grapevine Endophyte Endornavirus and Two New Endornaviruses Found Associated with Grapevines (Vitis vinifera L.) in Idaho, USA.

Five virus genomes, ranging between 12.0 and 12.3 kb in length and identified as endornaviruses, were discovered through a high-throughput sequencing (HTS) analysis of the total RNA samples extracted from two wine grape cultivars collected in the State of Idaho. One was found in a declining Chardonnay vine and was determined to be a local isolate of grapevine endophyte endornavirus (GEEV), and four others represented two novel endornaviruses named grapevine endornavirus 1 (GEV1) and grapevine endornavirus 2 (GEV2). All three virus genomes span a large, single open reading frame encoding polyproteins with easily identifiable helicase (HEL) and RNA-dependent RNA polymerase (RdRP) domains, while the GEV2 polyprotein also contains a glycosyltransferase domain. The GEV1 genome found in an asymptomatic Cabernet franc vine was related to, but distinct from, GEEV: the 5'-proximal, 4.7 kb segment of the GEV1 genome had a 72% identical nucleotide sequence to that of GEEV, while the rest of the genome displayed no significant similarity to the GEEV nucleotide sequence. Nevertheless, the amino acid sequence of the RdRP domain of GEV1 exhibited the closest affinity to the RdRP of GEEV. GEV2 was found in declining Chardonnay and asymptomatic Cabernet franc vines as three genetic variants exhibiting a 91.9-99.8% nucleotide sequence identity among each other; its RdRP had the closest affinity to the Shahe endorna-like virus 1 found in termites. In phylogenetic analyses, the RdRP and HEL domains of the GEV1 and GEV2 polyproteins were placed in two separate clades inside the large lineage of alphaendornaviruses, showing an affinity to GEEV and Phaseolus vulgaris endornavirus 1, respectively.

Genome Sequences of Two Grapevine Rupestris Stem Pitting-Associated Virus Variants from Vitis vinifera cv. Riesling in Idaho, USA.

We report the genome sequences of two genetic variants of grapevine rupestris stem pitting-associated virus (GRSPaV) from Idaho, USA. The coding-complete, positive-strand RNA genome of 8,700 nucleotides contains six open reading frames characteristic of foveaviruses. The two Idaho genetic variants belong to GRSPaV phylogroup 1.

A Novel Rhabdovirus Associated with the Idaho Population of Potato Cyst Nematode Globodera pallida.

Globodera pallida, a potato cyst nematode (PCN), is a quarantine endoparasitic pest of potato (Solanum tuberosum) in the US due to its effects on yield and quality of potato tubers. A new rhabdovirus, named potato cyst nematode rhabdovirus (PcRV), was revealed and characterized in the G. pallida populations collected in Idaho through use of high-throughput sequencing (HTS) and RT-PCR and found to be most closely related to soybean cyst nematode rhabdovirus (ScRV). PcRV has a 13,604 bp long, single-stranded RNA genome encoding five open reading frames, including four rhabdovirus-specific genes, N, P, G, and L, and one unknown gene. PcRV was found present in eggs, invasive second-stage juveniles, and parasitic females of G. pallida, implying a vertical transmission mode. RT-PCR and partial sequencing of PcRV in laboratory-reared G. pallida populations maintained over five years suggested that the virus is highly persistent and genetically stable. Two other Globodera spp. reproducing on potato and reported in the US, G. rostochiensis and G. ellingtonae, tested negative for PcRV presence. To the best of our knowledge, PcRV is the first virus experimentally found infecting G. pallida. Based on their similar genome organizations, the phylogeny of their RNA-dependent RNA polymerase domains (L gene), and relatively high identity levels in their protein products, PcRV and ScRV are proposed to form a new genus, provisionally named "Gammanemrhavirus", within the family Rhabdoviridae.

Occurrence of grapevine-associated tymo-like virus in wine grapes in the United States.

Grapevine-associated tymo-like virus (GaTLV) was reported to infect several grapevine cultivars in France (Hily et al. 2018). Recently, GaTLV-specific reads were identified among high-throughput sequencing (HTS) outputs from a pooled sample of grapevines in Tennessee, but the virus presence in individual plants was not confirmed by the RT-PCR testing with specific primers (Hu et al. 2021). In Idaho, several viruses infect wine grapes, such as grapevine leafroll-associated virus 3 (GLRaV-3; Mekuria et al. 2009; Thompson et al. 2019a), grapevine fleck virus (Kanuya et al. 2012), grapevine red blotch virus (Thompson et al. 2019b), and grapevine rupestris vein feathering virus (Dahan et al. 2021), while GaTLV status was not tested for previously. In September 2020 leaf and petiole samples of six different cultivars were collected from six vineyards in Canyon and Nez Perce counties of Idaho, for a total of 16 samples. Most of the samples were selected based on symptoms of vine decline, grapevine leafroll disease (GLD), or other abnormalities. Ribodepleted total RNAs prepared from these samples as described previously (Thompson et al. 2019a) were subjected to a HTS analysis on a NovaSeq platform, producing between 15,095,042 and 31,500,611 250-bp paired-end reads per sample. Raw reads were adapter and quality cleaned and mapped against the Vitis vinifera L., reference genome. Unmapped paired-end reads were assembled, and contigs were analyzed using BLASTn and DIAMOND (Buchfink et al. 2021) programs. Three of the samples, two collected from own-rooted Chardonnay vines planted in 1981, and one from an own-rooted, 20-yr old Cabernet franc vine, yielded large, 6,005 to 6,024-nt contigs exhibiting 99.0% identity to the sequence of the GaTLV (MH383239) described in France (Hily et al. 2018). Conceivably, these 6,005 to 6,024-nt sequences represented nearly complete genomes of the Idaho isolates of GaTLV; they were designated GaTLV-ID1 to -ID3 and deposited in the GenBank database under the accession numbers ON853767-ON853769. Two specific primer pairs, GaT1_2009F (5'-GGCTGAGTTAAAGGACGAGAA-3') and GaT1_2648R (5'-CGCCACGCCAAGCCAATAATGCT - 3'), and GaT2_5499F (5' - GCCAGAGTTTTCGGAGGCAAA - 3') and GaT2_5905R (5'-CGCGGAAAAACAATTCAGCAA-3') amplifying 662-bp and 427-bp products, respectively, were used to test for GaTLV presence in these 2020 samples, and also in additional 18 samples collected in September 2021 from nine grapevine cultivars in three vineyards of Canyon County, Idaho. Twelve GaTLV-positive samples, out of the 34 total, were identified in five out of the seven tested vineyards located in Canyon and Nez Perce counties of Idaho (Supplementary Fig. S1), in Chardonnay (nine positives), Gewürztraminer (one positive), Cabernet franc (one positive), and an unknown cultivar (one positive). The two RT-PCR products were Sanger sequenced for ten GaTLV-positives and displayed 100% identity to the HTS-derived GaTLV-ID genomic sequences at the targeted regions. The exact role of GaTLV in the development of the symptoms of decline in Chardonnay or in GLD symptoms in Cabernet franc vines is not clear at the moment. These same Chardonnay and Gewürztraminer samples contained other GLD-associated viruses, such as GLRaV-3 (Dahan et al. 2021), while the GaTLV-positive Cabernet franc had only common viroids, hop stunt viroid and grapevine yellow speckle viroid 1, not normally associated with GLD symptoms in wine grapes (Di Serio et al. 2017). To the best of our knowledge, this is the first report of GaTLV in Idaho, and, given the lack of RT-PCR amplifications of GaTLV sequences reported by Hu et al. (2021), also the first confirmed report of GaTLV presence in wine grapes in the United States.

A Novel Flavi-like Virus in Alfalfa (Medicago sativa L.) Crops along the Snake River Valley.

Alfalfa is an important perennial forage crop in Idaho supporting dairy and cattle industries that is typically grown in the same field for as many as 4 years. Alfalfa stands of different ages were subjected to screening for viruses using high-throughput sequencing and RT-PCR. The two most common viruses found were alfalfa mosaic virus and bean leafroll virus, along with Medicago sativa amalgavirus, two alphapartitiviruses, and one deltapartitivirus. Additionally, a new flavi-like virus with an unusual genome organization was discovered, dubbed Snake River alfalfa virus (SRAV). The 11,745 nt, positive-sense (+) RNA genome of SRAV encodes a single 3835 aa polyprotein with only two identifiable conserved domains, an RNA-dependent RNA polymerase (RdRP) and a predicted serine protease. Notably, unlike all +RNA virus genomes in the similar size range, the SRAV polyprotein contained no predicted helicase domain. In the RdRP phylogeny, SRAV was placed inside the flavi-like lineage as a sister clade to a branch consisting of hepaci-, and pegiviruses. To the best of our knowledge, SRAV is the first flavi-like virus identified in a plant host. Although commonly detected in alfalfa crops in southern Idaho, SRAV sequences were also amplified from thrips feeding in alfalfa stands in the area, suggesting a possible role of Frankliniella occidentalis in virus transmission.

Prevalence of Recombinant Strains of Potato Virus Y in Seed Potato Planted in Idaho and Washington States Between 2011 and 2021.

Potato virus Y (PVY) has emerged as the main reason for potato seed lot rejections, seriously affecting seed potato production in the United States throughout the past 20 years. The dynamics of PVY strain abundance and composition in various potato growing areas of the United States has not been well documented or understood up to now. The objective of this study was to find out the prevalence of PVY strains in potato fields in the Pacific Northwest (PNW), including seed potato production systems in the State of Idaho and commercial potato fields in the Columbia Basin of Washington State between 2011 and 2021. Based on the testing of >10,000 foliar samples during Idaho seed certification winter grow-out evaluations of seed potato lots and seed lot trials in Washington State, a dramatic shift in the PVY strain composition was revealed in the PNW between 2011 and 2016. During this time period, the prevalence of the ordinary, PVYO strain in seed potato dropped 8- to 10-fold, concomitantly with the rise of recombinant strains PVYN-Wi and PVYNTNa, which together accounted for 98% of all PVY positives by 2021. In Idaho seed potato, PVYNTNa strain associated with the potato tuber necrotic ringspot disease (PTNRD) was found to increase threefold between 2011 and 2019, accounting for 24% of all PVY positives in 2019. Mild foliar symptoms induced by recombinant PVY strains may be partially responsible for the proliferation of PVYN-Wi and PVYNTNa in potato crops. A spike of another PTNRD-associated recombinant, PVY-NE11, was recorded in the PNW between 2012 and 2016, but after reaching a 7 to 10% level in 2012 to 2013 this recombinant disappeared from the PNW potato by 2019. Whole genome sequence analysis of the PVY-NE11 suggested this recombinant was introduced in the United States at least three times. The data on PVY strain abundance in the PNW potato crops suggest that virus management strategies must consider the current dominance of the two recombinant PVY strains, PVYN-Wi and PVYNTNa.

First report of Coleus blumei viroid 1 in commercial Coleus blumei in the United States.

Coleus scutellarioides (syn. Coleus blumei) is a widely grown evergreen ornamental plant valued for its highly decorative variegated leaves. Six viroids, named Coleus blumei viroid 1 to 6 (CbVd-1 to -6) have been identified in coleus plants in many countries of the world (Nie and Singh 2017), including Canada (Smith et al. 2018). However there have been no reports of Coleus blumei viroids occurring in the U.S.A. (Nie and Singh 2017). In April 2021, leaf tissue samples from 27 cultivars of C. blumei, one plant of each, were submitted to the University of Idaho laboratory from a commercial nursery located in Oregon to screen for the presence of viroids. The sampled plants were selected randomly and no symptoms were apparent in any of the samples. Total nucleic acids were extracted from each sample (Dellaporta et al. 1983) and used in reverse-transcription (RT)-PCR tests (Jiang et al. 2011) for the CbVd-1 and CbVd-5 with the universal primer pair CbVds-P1/P2, which amplifies the complete genome of all members in the genus Coleviroid (Jiang et al. 2011), and two additional primer pairs, CbVd1-F1/R1 and CbVd5-F1/R1, specific for CbVd-1 and CbVd-5, respectively (Smith et al. 2018). Five C. blumei plants (cvs Fire Mountain, Lovebird, Smokey Rose, Marrakesh, and Nutmeg) were positive for a coleviroid based on the observation of the single 250-nt band in the RT-PCR test with CbVds-P1/P2 primers. Two of these CbVd-1 positive plants (cvs Lovebird and Nutmeg) were also positive for CbVd-1 based on the presence of a single 150-nt band in the RT-PCR assay with CbVd1-F1/R1 primers. One plant (cv Jigsaw) was positive for CbVd-1, i.e. showing the 150-nt band in RT-PCR with CbVd1-F1/R1 primers, but did not show the ca. 250-bp band in RT-PCR with primers CbVds-P1/P2. None of the tested plants were positive for CbVd-5, either with the specific, or universal primers. All coleviroid- and CbVd-1-specific PCR products were sequenced directly using the Sanger methodology, and revealed whole genomes for five isolates of CbVd-1 from Oregon, U.S.A. The genomes of the five CbVd-1 isolates displayed 96.9-100% identity among each other and 96.0-100% identity to the CbVd-1 sequences available in GenBank. Because the sequences from cvs Lovebird, Marrakesh, and Nutmeg, were found 100% identical, one sequence was deposited in GenBank (MZ326145). Two other sequences, from cvs Fire Mountain and Smokey Rose, were deposited in the GenBank under accession numbers MZ326144 and MZ326146, respectively. To the best of our knowledge, this is the first report of CbVd-1 in the United States.

A New Strain of Bean Common Mosaic Virus From Lima Bean (Phaseolus lunatus): Biological and Molecular Characterization.

Lima bean (Phaseolus lunatus) is a popular cultivated legume vegetable grown in the United States for dry bean or canned bean production. In 2017, two symptomatic P. lunatus plants exhibiting mosaic, vein banding, and growth retardation were collected in a public garden in Honolulu, HI. Both samples contained bean common mosaic virus (BCMV), and the two BCMV isolates were subjected to biological characterization on a panel of 11 differential cultivars of common bean (P. vulgaris), and to molecular characterization through whole genome sequencing. Both samples contained nearly identical BCMV sequences, named BCMV-A1, which, in turn, were 93% identical to the peanut stripe virus strain of BCMV. BCMV-A1 induced an unusually severe systemic necrosis in cultivar 'Dubbele Witte', and pronounced necrotic or chlorotic reaction in inoculated leaves of five other bean differentials. BCMV-A1 was able to partially overcome resistance alleles bc-1 and bc-2 expressed singly in common bean, inducing no systemic symptoms. Phylogenetic analysis of the BCMV-A1 sequence, and distinct biological reactions in common bean differentials suggested that BCMV-A1 represented a new lima bean strain of BCMV. In 2017, two BCMV isolates were collected in Idaho from common bean, and based on partial genome sequences were found 99% identical to the BCMV-A1 sequence. The data suggest that the lima bean strain of BCMV may have a wider circulation, including common bean as a host. This new strain of BCMV may thus pose a significant threat to common bean production.

Recessive Resistance to Bean common mosaic virus Conferred by the bc-1 and bc-2 Genes in Common Bean (Phaseolus vulgaris) Affects Long-Distance Movement of the Virus.

Recessive resistance to Bean common mosaic virus (BCMV) in common bean (Phaseolus vulgaris) is governed by four genes that include one strain-nonspecific helper gene bc-u, and three strain-specific genes bc-1, bc-2, and bc-3. The bc-3 gene was identified as an eIF4E translation initiation factor gene mediating resistance through disruption of the interaction between this protein and the VPg protein of the virus. The mode of action of bc-1 and bc-2 in expression of BCMV resistance is unknown, although bc-1 gene was found to affect systemic spread of a related potyvirus, Bean common mosaic necrosis virus. To investigate the possible role of both bc-1 and bc-2 genes in replication, cell-to-cell, and long-distance movement of BCMV in P. vulgaris, we tested virus spread of eight BCMV isolates representing pathogroups I, IV, VI, VII, and VIII in a set of bean differentials expressing different combinations of six resistance alleles including bc-u, bc-1, bc-12, bc-2, bc-22, and bc-3. All studied BCMV isolates were able to replicate and spread in inoculated leaves of bean cultivars harboring bc-u, bc-1, bc-12, bc-2, and bc-22 alleles and their combinations, while no BCMV replication was found in inoculated leaves of cultivar IVT7214 carrying the bc-u, bc-2, and bc-3 genes, except for isolate 1755a, which was capable of overcoming the resistance conferred by bc-2 and bc-3. In contrast, the systemic spread of all BCMV isolates from pathogroups I, IV, VI, VII, and VIII was impaired in common bean cultivars carrying bc-1, bc-12, bc-2, and bc-22 alleles. The data suggest that bc-1 and bc-2 recessive resistance genes have no effect on the replication and cell-to-cell movement of BCMV, but affect systemic spread of BCMV in common bean. The BCMV resistance conferred by bc-1 and bc-2 and affecting systemic spread was found only partially effective when these two genes were expressed singly. The efficiency of the restriction of the systemic spread of the virus was greatly enhanced when the alleles of bc-1 and bc-2 genes were combined together.