RESUMO
Cytosine-rich DNA regions can form four-stranded structures based on hemi-protonated C.C+ pairs, called i-motifs (iMs). Using CD, UV absorption, NMR spectroscopy, and DSC calorimetry, we show that model (CnT3)3Cn (Cn) sequences adopt iM under neutral or slightly alkaline conditions for n > 3. However, the iMs are formed with long-lasting kinetics under these conditions and melt with significant hysteresis. Sequences with n > 6 melt in two or more separate steps, indicating the presence of different iM species, the proportion of which is dependent on temperature and incubation time. At ambient temperature, kinetically favored iMs of low stability are formed, most likely consisting of short C.C+ blocks. These species act as kinetic traps and prevent the assembly of thermodynamically favored, fully C.C+ paired iMs. A higher temperature is necessary to unfold the kinetic forms and enable their substitution by a slowly developing thermodynamic structure. This complicated kinetic partitioning process considerably slows down iM folding, making it much slower than the timeframes of biological reactions and, therefore, unlikely to have any biological relevance. Our data suggest kinetically driven iM species as more likely to be biologically relevant than thermodynamically most stable iM forms.
Assuntos
DNA , Conformação de Ácido Nucleico , Cinética , Motivos de Nucleotídeos , DNA/genética , DNA/química , Concentração de Íons de HidrogênioRESUMO
Guanine quadruplexes (G4s) are noncanonical forms of nucleic acids that are frequently found in genomes. The stability of G4s depends, among other factors, on the number of G-tetrads. Three- or four-tetrad G4s and antiparallel two-tetrad G4s have been characterized experimentally; however, the existence of an intramolecular (i. e., not dimeric or multimeric) two-tetrad parallel-stranded DNA G4 has never been experimentally observed. Many sequences compatible with two-tetrad G4 can be found in important genomic regions, such as promoters, for which parallel G4s predominate. Using experimental and theoretical approaches, the propensity of the model sequence AATGGGTGGGTTTGGGTGGGTAA to form an intramolecular parallel-stranded G4 upon increasing the number of GGG-to-GG substitutions has been studied. Deletion of a single G leads to the formation of intramolecular G4s with a stacked G-triad, whose topology depends on the location of the deletion. Removal of another guanine from another G-tract leads to di- or multimeric G4s. Further deletions mostly prevent the formation of any stable G4. Thus, a solitary two-tetrad parallel DNA G4 is not thermodynamically stable and requires additional interactions through capping residues. However, transiently populated metastable two-tetrad species can associate to form stable dimers, the dynamic formation of which might play additional delicate roles in gene regulation. These findings provide essential information for bioinformatics studies searching for potential G4s in genomes.
Assuntos
Quadruplex G , Sequência de Bases , DNA/genética , Guanina , Regiões Promotoras GenéticasRESUMO
Circular Dichroic (CD) spectroscopy is one of the most frequently used methods for guanine quadruplex studies and in general for studies of conformational properties of nucleic acids. The reason is its high sensitivity to even slight changes in mutual orientation of absorbing bases of DNA. CD can reveal formation of particular structural DNA arrangements and can be used to search for the conditions stabilizing the structures, to follow the transitions between various structural states, to explore kinetics of their appearance, to determine thermodynamic parameters, and also to detect formation of higher order structures. CD spectroscopy is an important complementary technique to NMR spectroscopy and X-ray diffraction in quadruplex studies due to its sensitivity, easy manipulation of studied samples, and relative inexpensiveness. In this part, we present the protocol for the use of CD spectroscopy in the study of guanine quadruplexes, together with practical advice and cautions about various, particularly interpretation, difficulties.
Assuntos
DNA/química , Quadruplex G , Dicroísmo Circular , Espectroscopia de Ressonância Magnética , Conformação de Ácido Nucleico , Difração de Raios XRESUMO
The formation of intercalated motifs (iMs) - secondary DNA structures based on hemiprotonated C.C+ pairs in suitable cytosine-rich DNA sequences, is reflected by typical changes in CD and UV absorption spectra. By means of spectroscopic methods, electrophoresis, chemical modifications and other procedures, we characterized iM formation and stability in sequences with different cytosine block lengths interrupted by various numbers and types of nucleotides. Particular attention was paid to the formation of iMs at pH conditions close to neutral. We identified the optimal conditions and minimal requirements for iM formation in DNA sequences, and addressed gaps and inaccurate data interpretations in existing studies to specify principles of iM formation and modes of their folding.
Assuntos
DNA/química , Conformação de Ácido Nucleico , Motivos de Nucleotídeos , Pareamento de Bases , Sequência de Bases , Citosina/química , Citosina/metabolismo , DNA/metabolismo , Concentração de Íons de Hidrogênio , Cinética , TermodinâmicaRESUMO
The catalytic activity of a heme-based oxygen sensor phosphodiesterase from Escherichia coli (EcDOS) towards cyclic diGMP is regulated by the redox state of the heme iron complex in the enzyme's sensing domain and the association of external ligands with the iron center. Specifically, the Fe(II) complex is more active towards cyclic diGMP than the Fe(III) complex, and its activity is further enhanced by O2 or CO binding. In order to determine how the redox state and coordination of the heme iron atom regulate the catalytic activity of EcDOS, we investigated the flexibility of its isolated N-terminal heme-binding domain (EcDOS-heme) by monitoring its spectral properties at various hydrostatic pressures. The most active form of the heme-containing domain, i.e. the Fe(II)-CO complex, was found to be the least flexible. Conversely, the oxidized Fe(III) forms of EcDOS-heme and its mutants had relatively high flexibilities, which appeared to be linked to the low catalytic activity of the corresponding intact enzymes. These findings corroborate the suggestion, made on the basis of crystallographic data, that there is an inverse relationship between the flexibility of the heme-containing domain of EcDOS and its catalytic activity. The Fe(II)-CO form of the heme domain of a second heme-based oxygen sensor, diguanylate cyclase (YddV), was also found to be quite rigid. Interestingly, the incorporation of a water molecule into the heme complex of YddV caused by mutation of the Leu65 residue reduced the flexibility of this heme domain. Conversely, mutation of the Tyr43 residue increased its flexibility.
Assuntos
Proteínas de Escherichia coli/química , Escherichia coli/química , Diester Fosfórico Hidrolases/química , Fósforo-Oxigênio Liases/química , Catálise , Pressão Hidrostática , Oxirredução , Estrutura Terciária de Proteína , Espectrofotometria UltravioletaRESUMO
DNA concentration has been recently suggested to be the reason why different arrangements are revealed for K(+)-stabilized human telomere quadruplexes by experimental methods requiring DNA concentrations differing by orders of magnitude. As Raman spectroscopy can be applied to DNA samples ranging from those accessible by absorption and CD spectroscopies up to extremely concentrated solutions, gels and even crystals; it has been used here to clarify polymorphism of a core human telomeric sequence G(3)(TTAG(3))(3) in the presence of K(+) and Na(+) ions throughout wide range of DNA concentrations. We demonstrate that the K(+)-structure of G(3)(TTAG(3))(3) at low DNA concentration is close to the antiparallel fold of Na(+)-stabilized quadruplex. On the increase of G(3)(TTAG(3))(3) concentration, a gradual transition from antiparallel to intramolecular parallel arrangement was observed, but only for thermodynamically equilibrated K(+)-stabilized samples. The transition is synergically supported by increased K(+) concentration. However, even for extremely high G(3)(TTAG(3))(3) and K(+) concentrations, an intramolecular antiparallel quadruplex is spontaneously formed from desalted non-quadruplex single-strand after addition of K(+) ions. Thermal destabilization or long dwell time are necessary to induce interquadruplex transition. On the contrary, Na(+)-stabilized G(3)(TTAG(3))(3) retains its antiparallel folding regardless of the extremely high DNA and/or Na(+) concentrations, thermal destabilization or annealing.