Recombinant variants of cotton leaf curl Multan virus is associated with the breakdown of leaf curl resistance in cotton in northwestern India.

Cotton leaf curl disease (CLCuD), caused by a begomovirus species complex, is a major constraint to cotton (Gossypium hirsutum) production in northwestern India. During 2006 to 2010, a surveillance was conducted to monitor the spread of CLCuD in Haryana and Rajasthan. Six different field symptoms, upward curling, downward curling, enation, vein thickening, severe curling and mild curling were documented. Six isolates associated with these symptom types were tested positive in PCR to cotton leaf curl Rajasthan virus. The isolates were successfully transmitted through whitefly (Bemisia tabaci) at the rate up to 73.3% to the resistant cotton cultivar, RS2013. All these six isolates were further characterised based on the complete nucleotide sequences of the viral genome and the associated betasatellites. These virus isolates shared highest sequence identity (86-99%) with the cotton leaf curl Multan virus (CLCuMuV) and the associated betasatellites also shared highest sequence identity (78-92%) with cotton leaf curl Multan betasatellite (CLCuMuB). Based on the sequence identity and phylogenetic analysis of the viral genome and betasatellite, these isolates were identified as variants of CLCuMuV. Recombination analysis revealed significant recombination events in these isolates with the other cotton infecting begomoviruses. The isolate, Mo-Raj-2 has been identified as a resistant breaking strain having a major recombination in the coding regions of both viral genome and betasatellite. The natural occurrence of disease symptoms, transmission of the virus isolates through whitefly and complete genome analysis of the virus revealed the association of recombinant variant of CLCuMuV with the breakdown of resistance in cotton in Rajasthan and Haryana, the major cotton belt of India.

Three decades of managing Tomato spotted wilt virus in peanut in southeastern United States.

Southeastern states namely Georgia, Florida, and Alabama produce two-thirds of the peanuts in the United States. Thrips-transmitted Tomato spotted wilt virus (TSWV), which causes spotted wilt disease, has been a major impediment to peanut production for the past three decades. The cultivars grown in the 1980s were extremely susceptible to TSWV. Early yield losses extended to tens of millions of dollars each year (up to 100% loss in many fields). This situation led to the creation of an interdisciplinary team known as "SWAT: Spotted Wilt Action Team". Initial efforts focused on risk mitigation using a combination of chemical and cultural management practices along with a strong investment in breeding programs. Beginning in the mid 1990s, cultivars with field resistance were developed and integrated with cultural and chemical management options. A Risk Mitigation Index (Peanut Rx) was made available to growers to assess risks, and provide options for mitigating risks such as planting field resistant cultivars with in-furrow insecticides, planting after peak thrips incidence, planting in twin rows, and increasing seeding rates. These efforts helped curtail losses due to spotted wilt. The Peanut Rx continues to be refined every year based on new research findings. Breeding efforts, predominantly in Georgia and Florida, continue to develop cultivars with incremental field resistance. The present-day cultivars (third-generation TSWV-resistant cultivars released after 2010) possess substantially greater field resistance than second-generation (cultivars released from 2000 to 2010) and first-generation (cultivars released from 1994 to 2000) TSWV resistant cultivars. Despite increased field resistance, these cultivars are not immune to TSWV and succumb under high thrips and TSWV pressure. Therefore, field resistant cultivars cannot serve as a 'stand-alone' option and have to be integrated with other management options. The mechanism of resistance is also unknown in field resistant cultivars. Recent research in our laboratory evaluated field resistant cultivars against thrips and TSWV. Results revealed that some resistant cultivars suppressed thrips feeding and development, and they accumulated fewer viral copies than susceptible cultivars. Transcriptomes developed with the aid of Next Generation Sequencing revealed differential gene expression patterns following TSWV infection in susceptible than field resistant cultivars. Results revealed that the upregulation of transcripts pertaining to constitutive and induced plant defense proteins in TSWV resistant cultivars was more robust over susceptible cultivars. On the flipside, the long-term effects of using such resistant cultivars on TSWV were assessed by virus population genetics studies. Initial results suggest lack of positive selection pressure on TSWV, and that the sustainable use of resistant cultivars is not threatened. Follow up research is being conducted. Improvements in TSWV management have enhanced sustainability and contributed to increased yields from <2800kg/ha before 1995 to ∼5000kg/ha in 2015.

Characterization and comparative analysis of promoters from three plant pararetroviruses associated with Dahlia (Dahlia variabilis).

Two distinct caulimoviruses, Dahlia mosaic virus (DMV) and Dahlia common mosaic virus (DCMV), and an endogenous plant pararetroviral sequence (DvEPRS, formerly known as DMV-D10) were reported from dahlia (Dahlia spp). Promoter elements from these dahlia-associated pararetroviruses were identified and characterized. The TATA box, the CAAT box, the transcription start site, the polyadenylation signal, and regulation factors, characteristic of caulimovirus promoters, were present in each of these promoter regions. Each of the promoter regions was separately cloned into a binary vector containing ß-glucuronidase (GUS) reporter gene and delivered into Agrobacterium tumefaciens by electroporation followed by agroinfiltration into Nicotiana benthamiana. The activity of the 35S promoter homologs was determined by transient expression of the GUS gene both in qualitative and quantitative assays. The length of the promoter regions in DMV, DCMV, and DvEPRS corresponded to 438, 439, and 259 bp, respectively. Quantitative GUS assays showed that the promoters from DMV and DCMV resulted in higher levels of gene expression compared to that of DvEPRS in N. benthamiana leaf tissue. Significant differences were observed among the three promoters (p < 0.001). Qualitative GUS assays were consistent with quantitative GUS results. This study provides important information on new promoters for prospect applications as novel promoters for their potential use in foreign gene expression in plants.

The first complete genome sequences of two distinct European tomato spotted wilt virus isolates.

Tomato spotted wilt virus (TSWV) represents a major constraint to the production of important vegetable and ornamental crops in several countries around the world, including those in Europe. In spite of their economic importance, European TSWV isolates have only been partially characterized, and a complete genome sequence has not been determined yet. In this study, we completed the whole genome sequence of two distinct TSWV isolates from Italy, p105 and p202/3WT. The sequences of the L and M segments of p105 and of the L segment of p202/3WT were determined using a combined approach of RT-PCR and small RNA (sRNAs) contig assembly. Phylogenetic analysis based on RNA-dependent RNA polymerase and GN/GC protein sequences grouped the two isolates in two different clades, showing that different evolutive lineages are present among Italian TSWV isolates. Analysis of possible recombination/reassortment events among our isolates and other available full-length genome TSWV sequences showed a likely reassortment event involving the L segment.

Complete genomic characterization of a potato mop-top virus isolate from the United States.

Potato mop-top virus (PMTV; family Virgaviridae) was reported recently in the Pacific Northwestern USA. To better understand the genetic diversity of this virus, the complete genome of an isolate from Washington State (WA), USA, was characterized. Sequence comparisons of the WA isolate with other known sequences revealed that the RNA-Rep-encoded RdRp protein and the RNA-CP-encoded coat protein displayed >99 % amino acid sequence identity to those of two Nordic (RdRp) and several European and North American isolates (CP), respectively. The RNA-TGB-encoded TGB 1 and TGB 3 protein sequences had >99 % amino acid sequence identity to the corresponding proteins of Czech and Danish isolates, whereas the TGB 2 protein is identical to those of Colombian isolates. Phylogenetic analysis of the viral genes of the WA isolate reflected the close relationship between WA and European isolates. RFLP analysis of corresponding DNA of RNA TGB and RNA CP revealed that the WA isolate has the RNA TGB-II and RNA CP-B types, which are prevalent in Europe and other parts of world. This is the first report of the complete genome characterization of PMTV from the Americas.

Molecular characterization of domestic and exotic potato virus S isolates and a global analysis of genomic sequences.

Five potato virus S (PVS) isolates from the USA and three isolates from Chile were characterized based on biological and molecular properties to delineate these PVS isolates into either ordinary (PVS(O)) or Andean (PVS(A)) strains. Five isolates - 41956, Cosimar, Galaxy, ND2492-2R, and Q1 - were considered ordinary strains, as they induced local lesions on the inoculated leaves of Chenopodium quinoa, whereas the remaining three (FL206-1D, Q3, and Q5) failed to induce symptoms. Considerable variability of symptom expression and severity was observed among these isolates when tested on additional indicator plants and potato cv. Defender. Additionally, all eight isolates were characterized by determining the nucleotide sequences of their coat protein (CP) genes. Based on their biological and genetic properties, the 41956, Cosimar, Galaxy, ND2492-2R, and Q1 isolates were identified as PVS(O). PVS-FL206-1D and the two Chilean isolates (PVS-Q3 and PVS-Q5) could not be identified based on phenotype alone; however, based on sequence comparisons, PVS-FL206-1D was identified as PVS(O), while Q3 and Q5 clustered with known PVS(A) strains. C. quinoa may not be a reliable indicator for distinguishing PVS strains. Sequences of the CP gene should be used as an additional criterion for delineating PVS strains. A global genetic analysis of known PVS sequences from GenBank was carried out to investigate nucleotide substitution, population selection, and genetic recombination and to assess the genetic diversity and evolution of PVS. A higher degree of nucleotide diversity (π value) of the CP gene compared to that of the 11K gene suggested greater variation in the CP gene. When comparing PVS(A) and PVS(O) strains, a higher π value was found for PVS(A). Statistical tests of the neutrality hypothesis indicated a negative selection pressure on both the CP and 11K proteins of PVS(O), whereas a balancing selection pressure was found on PVS(A).

Expression of endogenous para-retroviral genes and molecular analysis of the integration events in its plant host Dahlia variabilis.

The dahlia (Dahlia variabilis) genome contains an endogenous pararetrovirus sequence (EPRS) tentatively designated as DvEPRS. The DvEPRS shares genome structure and organization that is typical of members of the Caulimovirus genus. Studies were carried out to better understand the nature of this integration and to determine the gene expression of this DvEPRS. Genomic Southern hybridization showed multiple and random integration events of the DvEPRS in the dahlia genome. To investigate the presence of DvEPRS transcripts, RT-PCR was done on DNase-treated total RNA from DvEPRS-infected dahlia plants. Results showed the expression of open reading frames I, V, and VI. Direct PCR from sap extracts produced more intense DNA amplicons of Dahlia mosaic virus and Dahlia common mosaic virus which are believed to exist as typical episomal caulimoviruses, whereas significantly less intense amplicon was seen in case of DvEPRS in comparison with internal transcribed spacer region of dahlias amplicon. The DvEPRS in wild and cultivated species of Dahlia offer a model system to study the molecular events underlying the ecology, evolution and spread of DvEPRS within natural and managed ecosystems and the factors affecting integration of these EPRS in the plant genome.

Comparative analysis of endogenous plant pararetroviruses in cultivated and wild Dahlia spp.

Two distinct caulimoviruses, Dahlia mosaic virus (DMV) and Dahlia common mosaic virus, and an endogenous plant pararetroviral sequence (DvEPRS) were reported in Dahlia spp. DvEPRS, previously referred to as DMV-D10, was originally identified in the US from the cultivated Dahlia variabilis, and has also been found in New Zealand, Lithuania and Egypt, as well as in wild dahlia species growing in their natural habitats in Mexico. Sequence analysis of three new EPRSs from cultivated dahlias from Lithuania [D10-LT; 7,159 nucleotide level (nt)], New Zealand (D10-NZ, 7,156 nt), and the wild species, Dahlia rupicola, from Mexico (D10-DR, 7,133 nt) is reported in this study. The three EPRSs have the structure and organization typical of a caulimovirus species and showed identities among various open reading frames (ORFs) ranging between 71 and 97 % at the nt when compared to those or the known DvEPRS from the US. Examination of a dataset of seven full-length EPRSs obtained to date from cultivated and wild Dahlia spp. provided clues into genetic diversity of these EPRSs from diverse sources of dahlia. Phylogenetic analyses, mutation frequencies, potential recombination events, selection, and fitness were evaluated as evolutionary evidences for genetic variation. Assessment of all ORFs using phylogenomic and population genetics approaches suggests a wide genetic diversity of EPRSs occurring in dahlias. Phylogenetic analyses show that the EPRSs from various sources form one clade indicating a lack of clustering by geographical origin. Grouping of various EPRSs into two host taxa (cultivated vs. wild) shows little divergence with respect to their origin. Population genetic parameters demonstrate negative selection for all ORFs, with the reverse transcriptase region more variable than other ORFs. Recombination events were found which provide evolutionary evidence for genetic diversity among dahlia-associated EPRSs. This study contributes to an increased understanding of molecular population genetics and evolutionary pathways of these reverse transcribing viral elements.

First Report of Iris yellow spot virus Infecting Onion in Pakistan.

Onion (Allium cepa L.) is an important vegetable crop in Pakistan. According to the Food and Agricultural Organization (FAO), Pakistan is the world's fifth largest onion producer. The area and production is 127.8 thousand hectares and 1.7 million tons, respectively, with a yield of 13.8 tons per hectare during 2012. The agro-ecological diversity in the country enables onion production almost year round. Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus), transmitted principally by Thrips tabaci, is an economically important viral pathogen of bulb and seed onion crops in many onion-growing areas of the world (1,3). In Asia, IYSV has been reported in India and Sri Lanka (2,4). During March to May 2012, as part of a survey for tospoviruses in vegetables, symptoms suspected to be caused by IYSV were observed on bulb and seed onions grown in farmers' fields in Faisalabad, Nankana, Sheikhupura, and Sialkot districts of Punjab. Symptoms consisted of spindle-shaped, straw colored, irregular chlorotic lesions with occasional green islands on the leaves. Approximately 60% of the fields surveyed had about 30% of the plants with these symptoms. The presence of the virus was confirmed with an IYSV-specific ELISA kit (Bioreba). IYSV infection was verified by RT-PCR with primers IYSV-F (TAAAACAAACATTCAAACAA) and IYSV-R (CTCTTAAACACATTTAACAAGCA) as forward and reverse primers, respectively. Amplicons of approximately 1,100 bp were obtained from the symptomatic samples, but not from healthy and water controls. The amplicons were cloned and sequenced. The IYSV-Pakistan isolates (GenBank Accession Nos. KF171103, KF171104, and KF171105) had the highest nucleotide sequence identity of 99% with the corresponding region of an IYSV isolate from Chile (DQ150107). To our knowledge, this is the first report of IYSV infecting onion in Pakistan. The relatively widespread occurrence of IYSV underscores the need for systematic surveys to assess its incidence and impact on onion bulb and seed crops so that appropriate management tactics can be developed. References: (1) D. H. Gent et al. Plant Dis. 88:446, 2004. (2) B. Mandal et al. Plant Dis. 94:468, 2012. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) K. S. Ravi et al. Plant Pathol. 55:288, 2006.

First Report of Iris yellow spot virus Infecting Green Onion in Indonesia.

Green onion (Allium fistulosum L.) is an important vegetable crop for small-holder farmers for domestic consumption in Indonesia. Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) transmitted by Thrips tabaci is an economically important viral pathogen of bulb and seed onion crops in many onion-growing areas of the world (1,3). In Asia, IYSV has been reported in India and Sri Lanka (2,4). In April 2013, symptoms suspected to be caused by IYSV were observed on a 1-month-old green onion crop grown for their leaves in a farmer's field in Cipendawa, Pacet, Cianjur District, West Java. Symptoms consisted of elliptical to spindle-shaped, straw colored, irregular, chlorotic lesions with occasional green islands on the leaves. Approximately 25% of the field had plants with these symptoms. The presence of the virus was confirmed with an IYSV-specific Agdia Flash kit. IYSV infection was confirmed by RT-PCR with primers specific to the nucleoprotein (N) gene of IYSV. Primers 465c: 5'-AGCAAAGTGAGAGGACCACC-3' and IYSV-239f: 5' TGAGCCCCAATCAAGACG3' (3) were used as forward and reverse primers, respectively, using total nucleic acids eluted from FTA cards that were previously coated with freshly prepared sap extracts from field samples. Amplicons of approximately 240 bp were obtained from four symptomatic plants tested but not from healthy and water controls. The amplicons were cloned and sequenced. Consensus sequence was derived from three clones. Comparison with IYSV N gene sequences available in GenBank showed sequence identity of 95 to 99% confirming the identity of the virus as IYSV. To our knowledge, this is the first report of IYSV infecting onion in Indonesia. The finding in Java underscores the need for conducting surveys in Java as well as other onion-growing regions of Indonesia to gain a better understanding of its incidence, distribution, and potential impact. References: (1) D. H. Gent et al. Plant Dis. 88:446, 2004. (2) B. Mandal et al. Plant Dis. 96:468, 2012. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) K. S. Ravi et al. Plant Pathol. 55:288, 2006.

First Report of Tomato yellow ring virus (Tospovirus, Bunyaviridae) Infecting Tomato in Kenya.

Tomato (Lycoperscion esculentum) is one of the most popular vegetables and a major source of nutrition and income for smallholders in Africa. Thrips-transmitted tospoviruses are among the economically important pathogens of tomatoes that cause significant crop losses worldwide (3). In surveys for Tomato spotted wilt virus (TSWV) in the major tomato production areas of Kenya between March 2010 and January 2012, tomato fruits with chlorotic ring spots on fruits with stem and leaf necrosis were observed frequently. The symptoms were more evident in the dry seasons and disease incidence ranged from 28 to 42%. The pathogen did not react with antiserum specific to TSWV (Agdia Biofords, Ervy, France) in double-antibody sandwich (DAS)-ELISA. Furthermore, the pathogen did not react with antiserum specific to Capsicum chlorosis virus (CaCV), Chrysanthemum stem necrosis virus (CSNV), Groundnut ring spot virus (GRSV), Impatiens necrotic spot virus (INSV), Iris yellow spot virus (IYSV), and Watermelon silver mottle virus (WSMoV) (Agdia Biofords and DSMZ, Germany) in DAS-ELISA, but reacted positively to antiserum specific to Tomato yellow fruit ring virus (TYFRV) (DSMZ, AS0526). The nucleocapsid (N) gene specific primers (TFfor: 5'-ACTCATTAAAATGCATCGTTCT-3' and TFrev: 5'-CTAAGTAAACACCATGGCTACC-3' as forward and reverse primers, respectively) were designed by choosing six conserved regions of the N gene sequences of known TYFRV and Tomato yellow ring virus (TYRV) sequences available from GenBank. Using these primers, TYRV infection of tomatoes collected from Loitokitok, Kenya (2.73°S, 37.51°E) was confirmed by reverse transcription (RT)-PCR. PCR products of approximately 912-bp were obtained from six out of 11 symptomatic tomato samples tested, but not from healthy and water controls. Amplicons were gel-purified using QuickClean II Gel Extraction Kit (GenScript, UK) and sequenced using TFfor and TFrev primers. A consensus sequence was generated using Geneious Pro 5.5.6 Software (Biomatters Ltd., Auckland, NZ). The BLAST revealed that the N-gene sequence of the Kenyan tomato isolate (GenBank Accession No. JQ955615) had sequence identity with the Cineraria isolate (98.5%) (Accession No. DQ788693.1) and the Anemone isolate (98.1%) (Accession No. DQ788694.1) of TYRV (4) from Fars Province, Iran; an Alstroemeria isolate (98.4%) (Accession No. HQ154130.1) and two tomato isolates (98.3%) (Accession Nos. HQ154131.1 and AY686718.1) of TYRV from northern Khorasan Province, Iran, and a tomato isolate (98.1%) (Accession No. AJ493270.1) of TYFRV from Varamin, Iran. The Kenyan tomato isolate differed from a TYFRV potato isolate (87.5%) from Iran (Accession No. EU126931.1) (1), a TYRV potato isolate (87.5%) from Iran (Accession No. JF836812.1); a soybean isolate of TYRV (87.4%) from Iran (Accession No. DQ462163.1) (2), and showed significant divergence from that of Polygonum ringspot virus from Italy (81%) (Accession No. EF445397.1). To our knowledge, this is the first report of TYRV infecting tomatoes in Kenya. Further surveys and monitoring of TYRV incidence and distribution in the region, vector competence of thrips species, and impact on the crop yield are in progress. References: (1) A. R. Golnaraghi et al. Plant Dis. 92:1280, 2008. (2) A. Hassani-Mehraban et al. Arch. Virol. 152:85, 2007. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) R. Rasoulpour and K. Izadpanah, Austral. Plant Pathol. 36:285, 2007.

Molecular characterization of allium virus X, a new potexvirus in the family Alphaflexiviridae, infecting ornamental allium.

ABTRACT: A new potexvirus affecting ornamental allium spp in the Netherlands was identified and characterized at the molecular level. The virus had a single-stranded RNA genome of 7100 bp (excluding the 18 bp poly A tail). The genome organization was found to be typical of members of the genus Potexvirus and consisted of five open reading frames (ORF). Nucleotide and amino acid sequence comparisons with those of known potexvirus members showed that this virus is related to Hosta virus X and Hydrangea ringspot virus. Sequence similarities and phylogenetic relationships suggested that the allium virus is a new and distinct species in the genus Potexvirus and the name, Allium virus X (AlVX) is proposed.

Genomic characterization of pararetroviral sequences in wild Dahlia spp. in natural habitats.

The genome structure and organization of endogenous caulimovirus sequences from dahlia (Dahlia spp), dahlia mosaic virus (DMV)-D10 from three wild species, D. coccinea (D10-DC), D. sherffii (D10-DS) and D. tenuicaulis (D10-DT), were determined and compared to those from cultivated species of dahlia, D. variabilis (DvEPRS). The complete ca. 7-kb dsDNA genomes of D10-DC, D10-DS, and D10-DT had a structure and organization typical of a caulimovirus and shared 89.3 to 96.6% amino acid sequence identity in various open reading frames (ORF) when compared to DvEPRS. The absence of the aphid transmission factor and the truncated coat protein fused with the reverse transcriptase ORF were common among these DMV-D10 isolates from wild Dahlia species.

First Report of Iris yellow spot virus Infecting Onion in Kenya and Uganda.

Onion (Allium cepa L.) is one of the key vegetables produced by small-holder farmers for the domestic markets in Sub-Saharan Africa. Biotic factors, including infestation by thrips pests such as Thrips tabaci Lindeman, can inflict as much as 60% yield loss. Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) transmitted by T. tabaci is an economically important viral pathogen of bulb and seed onion crops in many onion-growing areas of the world (2,4). In Africa, IYSV has been reported in Reunion (1) and South Africa (3). In September 2009, symptoms suspected to be caused by IYSV were observed on onions and leeks cultivated in Nairobi, Kenya. Symptoms consisted of spindle-shaped, straw-colored, irregular chlorotic lesions with occasional green islands on the leaves. The presence of the virus was confirmed with IYSV-specific Agdia Flash kits (Agdia Inc., Elkart, IN). Subsequently, surveys were undertaken in small-holder farms in onion production areas of Makueni (January 2010) and Mwea (August 2010) in Kenya and Kasese (January 2010) and Rwimi (January 2010) in Uganda. The incidence of disease in these locations ranged between 27 and 72%. Onion leaves showing symptoms of IYSV infection collected from both locations tested positive for the virus by double-antibody sandwich-ELISA with IYSV-specific antiserum (Agdia Inc). IYSV infection was confirmed by reverse transcription-PCR with primers IYSV-465c: 5'-AGCAAAGTGAGAGGACCACC-3' and IYSV-239f: 5'-TGAGCCCCAATCAAGACG3' (3) as forward and reverse primers, respectively. Amplicons of approximately 240 bp were obtained from all symptomatic test samples but not from healthy and water controls. The amplicons were cloned and sequenced from each of the sampled regions. Consensus sequence for each isolate was derived from at least three clones. The IYSV-Kenya isolate (GenBank Accession No. HQ711616) had the highest nucleotide sequence identity of 97% with the corresponding region of IYSV isolates from Sri Lanka (GenBank Accession No. GU901211), followed by the isolates from India (GenBank Accession Nos. EU310287 and EU310290). The IYSV-Uganda isolate (GenBank Accession No. HQ711615) showed the highest nucleotide sequence identity of 95% with the corresponding region of IYSV isolates from Sri Lanka (GenBank Accession No. GU901211) and India (95% with GenBank Accession Nos. EU310274 and EU310297). To our knowledge, this is the first report of IYSV infecting onion in Kenya and Uganda. Further surveys and monitoring of IYSV incidence and distribution in the region, along with its impact on the yield, are under investigation. References: (1) L. J. du Toit et al. Plant Dis. 91:1203, 2007. (2) D. H. Gent et al. Plant Dis. 88:446, 2004. (3) H. R. Pappu et al. Plant Dis 92:588, 2008. (4) H. R. Pappu et al. Virus Res. 141:219, 2009.

Susceptibility of Onion Relatives (Allium spp.) to Iris yellow spot virus.

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) is becoming an increasingly important constraint to the production of bulb and seed onions (Allium cepa L.) in many onion-growing regions of the continental United States and the world (4). During an evaluation of onion germplasm for susceptibility to IYSV, six other Allium species (A. altaicum, A. galanthum, A. roylei, A. schoenoprasum, A. tuberosum, and A. vavilovii) were also evaluated under natural field conditions. In July 2010, symptoms suggestive of IYSV infection (straw-colored necrotic lesions) were observed on leaves of these Allium spp. in experimental plots in Las Cruces, NM. IYSV was detected in symptomatic leaves of A. altaicum, A. vavilovii, A. tuberosum, A. schoenoprasum and A. roylei with a commercially available ELISA kit (Agdia Inc., Elkhart, IN). IYSV infection was confirmed by reverse transcription (RT)-PCR with forward and complementary primers 5'-CTCTTAAACACATTTAACAAGCAC-3' and 5'-TAAAACAAACATTCAAACAA-3' flanking the nucleocapsid (N) gene encoded by the small RNA of IYSV as previously described (1,3). Amplicons, approximately 1.1 kb long, were obtained from all symptomatic Allium spp. samples but not from healthy samples or water controls. Sequencing of selected amplicons confirmed IYSV infection. The highest nucleotide identity of 98% was shared with IYSV isolates from Japan (GenBank Accession No. AB180921). A. altaicum, A. vavilovii, and A. pskemense were previously reported from Washington to be susceptible to IYSV (2). Current findings expand the list of Allium spp. that are susceptible to IYSV and underscores the need for continued screening of other members of the genus to find sources of resistance to IYSV. References: (1) H. R. Pappu et al. Arch. Virol. 151:1015, 2006. (2) H. R. Pappu et al. Plant Dis. 90:378, 2006. (3) H. R. Pappu et al. Plant Dis. 92:588, 2008. (4) H. R. Pappu et al. Virus Res. 141:219, 2009.

Molecular characterization of pea enation mosaic virus and bean leafroll virus from the Pacific Northwest, USA.

The family Luteoviridae consists of eight viruses assigned to three different genera, Luteovirus, Polerovirus and Enamovirus. The complete genomic sequences of pea enation mosaic virus (genus Enamovirus) and bean leafroll virus (genus Luteovirus) from the Pacific Northwest, USA, were determined. Annotation, sequence comparisons, and phylogenetic analysis of selected genes together with those of known polero- and enamoviruses were conducted.

Identification and molecular characterization of a new potyvirus infecting Triteleia species.

Plants of Triteleia hyacinthina, Triteleia ixioides Starlight, and Triteleia laxa Corina with severe mosaic and yellow vein-banding were found to be infected with a potyvirus. The 3'-terminal region of the virus was amplified by RT-PCR from total RNA using a potyvirus-specific degenerate primer (poty5P: 5' GGN AAY AAY AGY GGN CAR CC 3') and an oligo-dTprimer. The sequence generated included the 3'-NIb protein coding region (680 nucleotides), the entire coat protein coding region (840 nucleotides), and 3'-untranslated region (UTR) (253 nucleotides). Amino acid identity of the whole CP between the triteleia virus and potyvirus member ranged from 54% Apium virus Y (ApVY) to 67% Auraujia mosaic virus (ArjMV) and Twisted-stalk chlorotic streak virus (TSCSV) and the core ranged from 59% (ApVY) to 75% (ArjMV). The 3-UTR showed no significant homology with other known potyviruses. Phylogenetic relationships suggest this triteleia virus is a new member of the Potyvirus genus and the name of "Triteleia mosaic virus" (TriMV) is proposed. This is the first report of a potyvirus infecting triteleia.

First Report of Iris yellow spot virus in Onion in Hawaii.

Onion (Allium spp.) production in Hawaii is mostly comprised of green onion and the locally prized sweet bulb onions (Allium cepa L.) that include short- and medium-day cultivars. Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) is an important constraint to bulb and seed onion production in many onion-growing regions of the continental United States and the world (3). In June 2010, straw-colored, diamond-shaped lesions with occasional green islands were observed on leaves of sweet onion 'Linda Vista' in an insecticide trial on Maui for onion thrips (Thrips tabaci) control. Collapse and lodging occurred when lesions on leaves were severe. Seven bulbs with green leaves exhibiting lesions were collected from this onion field in the Pulehu Region of the lower Kula District on Maui. Leaf samples that included a lesion or were within 1 cm of a lesion were found to be positive in indirect ELISA with IYSV-specific polyclonal antisera (2). A405nm readings after 1 h ranged from 0.263 to 2.067 for positive samples and 0.055 to 0.073 for healthy onion controls. Four samples that were prepared from leaf tissue several centimeters away from a lesion tested negative in ELISA. Such uneven virus distribution in the plants has been previously reported (4). In July 2010, symptomatic sweet onion from a commercial farm in upper Kula, Maui at the 1,060 to 1,220 m (3,500 to 4,000 foot) elevation tested positive for IYSV by ELISA. Green onion samples collected from a commercial farm in Omaopio, Maui, located approximately 0.8 km (0.5 mile) north of Pulehu, have tested negative, suggesting distribution may be limited at this time. RNA was isolated from leaf tissue from the seven 'Linda Vista' sweet onions collected from the Maui insecticide trial. Reverse transcription (RT)-PCR with forward and complementary primers 5'-CTCTTAAACACATTTAACAAGCAC-3' and 5'-TAAAACAAACATTCAAACAA-3' flanking the nucleocapsid (N) gene encoded by the small RNA of IYSV was conducted as previously described (1). Amplicons approximately 1.1 kb long were obtained from all seven symptomatic onion samples but not from healthy samples or water controls. Sequencing of selected amplicons confirmed IYSV infection. Three sequence variants (GenBank Accession Nos. HM776014-HM776016) were identified from two RT-PCR reactions. Phylogenetic analyses of the three sequence variants with the neighbor-joining procedure available through NCBI-BLASTn Tree View showed that the highest nucleotide identities of 97 to 98% were shared with IYSV isolates from New Zealand (EU477515), Nevada (FJ713699), and northern California (FJ713700). Phylogenetic analyses with the N-gene showed the sequences from Hawaii are most closely related to isolates from the western United States, Texas, and New Zealand. To date, to our knowledge, IYSV has not been detected on the islands of Kauai, Oahu, Molokai, or Hawaii. The distribution and economic consequences of this disease to Hawaii's onion production are under investigation. References: (1) H. R. Pappu et al. Arch Virol. 151:1015, 2006. (2) H. R. Pappu et al. Plant Dis. 92:588, 2008. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) T. N. Smith et al. Plant Dis. 90:729, 2006.