Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 43
Filtrar
Mais filtros










Intervalo de ano de publicação
1.
Chem Sci ; 15(24): 9096-9103, 2024 Jun 19.
Artigo em Inglês | MEDLINE | ID: mdl-38903237

RESUMO

We report a crystal structure at atomic resolution (0.9 Å) of a ruthenium complex bound to a consecutive DNA double mismatch, which results in a TA basepair with flipped out thymine, together with the formation of an adenine bulge. The structure shows a form of metalloinsertion interaction of the Λ-[Ru(phen)2phi]2+ (phi = 9,10-phenanthrenediimine) complex at the bulge site. The metal complex interacts with the DNA via the major groove, where specific interactions between the adenines of the DNA and the phen ligands of the complex are formed. One Δ-[Ru(phen)2phi]2+ complex interacts via the minor groove, which shows sandwiching of its phi ligand between the phi ligands of the other two ruthenium complexes, and no interaction of its phen ligands with DNA. To our knowledge, this binding model represents a new form of metalloinsertion in showing major rather than minor groove insertion.

2.
Nat Commun ; 15(1): 3284, 2024 Apr 16.
Artigo em Inglês | MEDLINE | ID: mdl-38627386

RESUMO

The rapid evolution of SARS-CoV-2 is driven in part by a need to evade the antibody response in the face of high levels of immunity. Here, we isolate spike (S) binding monoclonal antibodies (mAbs) from vaccinees who suffered vaccine break-through infections with Omicron sub lineages BA.4 or BA.5. Twenty eight potent antibodies are isolated and characterised functionally, and in some cases structurally. Since the emergence of BA.4/5, SARS-CoV-2 has continued to accrue mutations in the S protein, to understand this we characterize neutralization of a large panel of variants and demonstrate a steady attrition of neutralization by the panel of BA.4/5 mAbs culminating in total loss of function with recent XBB.1.5.70 variants containing the so-called 'FLip' mutations at positions 455 and 456. Interestingly, activity of some mAbs is regained on the recently reported variant BA.2.86.


Assuntos
Anticorpos Monoclonais , Complicações Pós-Operatórias , Humanos , Mutação , SARS-CoV-2/genética , Anticorpos Neutralizantes , Anticorpos Antivirais
3.
Angew Chem Int Ed Engl ; 63(13): e202318863, 2024 Mar 22.
Artigo em Inglês | MEDLINE | ID: mdl-38271265

RESUMO

The grooves of DNA provide recognition sites for many nucleic acid binding proteins and anticancer drugs such as the covalently binding cisplatin. Here we report a crystal structure showing, for the first time, groove selectivity by an intercalating ruthenium complex. The complex Λ-[Ru(phen)2 phi]2+ , where phi=9,10-phenanthrenediimine, is bound to the DNA decamer duplex d(CCGGTACCGG)2 . The structure shows that the metal complex is symmetrically bound in the major groove at the central TA/TA step, and asymmetrically bound in the minor groove at the adjacent GG/CC steps. A third type of binding links the strands, in which each terminal cytosine base stacks with one phen ligand. The overall binding stoichiometry is four Ru complexes per duplex. Complementary biophysical measurements confirm the binding preference for the Λ-enantiomer and show a high affinity for TA/TA steps and, more generally, TA-rich sequences. A striking enantiospecific elevation of melting temperatures is found for oligonucleotides which include the TATA box sequence.


Assuntos
Complexos de Coordenação , Compostos Organometálicos , Rutênio , Compostos Organometálicos/química , DNA/química , Oligonucleotídeos/química , Complexos de Coordenação/química , Temperatura , Rutênio/química
4.
Elife ; 122023 03 07.
Artigo em Inglês | MEDLINE | ID: mdl-36881464

RESUMO

Much of our current understanding of how small-molecule ligands interact with proteins stems from X-ray crystal structures determined at cryogenic (cryo) temperature. For proteins alone, room-temperature (RT) crystallography can reveal previously hidden, biologically relevant alternate conformations. However, less is understood about how RT crystallography may impact the conformational landscapes of protein-ligand complexes. Previously, we showed that small-molecule fragments cluster in putative allosteric sites using a cryo crystallographic screen of the therapeutic target PTP1B (Keedy et al., 2018). Here, we have performed two RT crystallographic screens of PTP1B using many of the same fragments, representing the largest RT crystallographic screens of a diverse library of ligands to date, and enabling a direct interrogation of the effect of data collection temperature on protein-ligand interactions. We show that at RT, fewer ligands bind, and often more weakly - but with a variety of temperature-dependent differences, including unique binding poses, changes in solvation, new binding sites, and distinct protein allosteric conformational responses. Overall, this work suggests that the vast body of existing cryo-temperature protein-ligand structures may provide an incomplete picture, and highlights the potential of RT crystallography to help complete this picture by revealing distinct conformational modes of protein-ligand systems. Our results may inspire future use of RT crystallography to interrogate the roles of protein-ligand conformational ensembles in biological function.


Assuntos
Cristalografia , Proteína Tirosina Fosfatase não Receptora Tipo 1 , Sítio Alostérico , Sítios de Ligação , Ligantes , Temperatura , Proteína Tirosina Fosfatase não Receptora Tipo 1/química
5.
Cell Rep ; 42(4): 112271, 2023 04 25.
Artigo em Inglês | MEDLINE | ID: mdl-36995936

RESUMO

In November 2021, Omicron BA.1, containing a raft of new spike mutations, emerged and quickly spread globally. Intense selection pressure to escape the antibody response produced by vaccines or severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection then led to a rapid succession of Omicron sub-lineages with waves of BA.2 and then BA.4/5 infection. Recently, many variants have emerged such as BQ.1 and XBB, which carry up to 8 additional receptor-binding domain (RBD) amino acid substitutions compared with BA.2. We describe a panel of 25 potent monoclonal antibodies (mAbs) generated from vaccinees suffering BA.2 breakthrough infections. Epitope mapping shows potent mAb binding shifting to 3 clusters, 2 corresponding to early-pandemic binding hotspots. The RBD mutations in recent variants map close to these binding sites and knock out or severely knock down neutralization activity of all but 1 potent mAb. This recent mAb escape corresponds with large falls in neutralization titer of vaccine or BA.1, BA.2, or BA.4/5 immune serum.


Assuntos
Formação de Anticorpos , COVID-19 , Humanos , SARS-CoV-2 , Substituição de Aminoácidos , Anticorpos Monoclonais , Anticorpos Antivirais , Anticorpos Neutralizantes
6.
Cell Rep ; 42(1): 111903, 2023 01 31.
Artigo em Inglês | MEDLINE | ID: mdl-36586406

RESUMO

Variants of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) have caused successive global waves of infection. These variants, with multiple mutations in the spike protein, are thought to facilitate escape from natural and vaccine-induced immunity and often increase in affinity for ACE2. The latest variant to cause concern is BA.2.75, identified in India where it is now the dominant strain, with evidence of wider dissemination. BA.2.75 is derived from BA.2 and contains four additional mutations in the receptor-binding domain (RBD). Here, we perform an antigenic and biophysical characterization of BA.2.75, revealing an interesting balance between humoral evasion and ACE2 receptor affinity. ACE2 affinity for BA.2.75 is increased 9-fold compared with BA.2; there is also evidence of escape of BA.2.75 from immune serum, particularly that induced by Delta infection, which may explain the rapid spread in India, where where there is a high background of Delta infection. ACE2 affinity appears to be prioritized over greater escape.


Assuntos
COVID-19 , Hepatite D , Humanos , Enzima de Conversão de Angiotensina 2 , SARS-CoV-2 , Anticorpos
7.
Cell ; 185(12): 2116-2131.e18, 2022 06 09.
Artigo em Inglês | MEDLINE | ID: mdl-35662412

RESUMO

Highly transmissible Omicron variants of SARS-CoV-2 currently dominate globally. Here, we compare neutralization of Omicron BA.1, BA.1.1, and BA.2. BA.2 RBD has slightly higher ACE2 affinity than BA.1 and slightly reduced neutralization by vaccine serum, possibly associated with its increased transmissibility. Neutralization differences between sub-lineages for mAbs (including therapeutics) mostly arise from variation in residues bordering the ACE2 binding site; however, more distant mutations S371F (BA.2) and R346K (BA.1.1) markedly reduce neutralization by therapeutic antibody Vir-S309. In-depth structure-and-function analyses of 27 potent RBD-binding mAbs isolated from vaccinated volunteers following breakthrough Omicron-BA.1 infection reveals that they are focused in two main clusters within the RBD, with potent right-shoulder antibodies showing increased prevalence. Selection and somatic maturation have optimized antibody potency in less-mutated epitopes and recovered potency in highly mutated epitopes. All 27 mAbs potently neutralize early pandemic strains, and many show broad reactivity with variants of concern.


Assuntos
Anticorpos Monoclonais , Vacinas contra COVID-19/imunologia , SARS-CoV-2 , Glicoproteína da Espícula de Coronavírus , Enzima de Conversão de Angiotensina 2 , Anticorpos Monoclonais/química , Anticorpos Monoclonais/genética , Anticorpos Antivirais , COVID-19 , Vacinas contra COVID-19/administração & dosagem , Epitopos , Humanos , Testes de Neutralização , SARS-CoV-2/classificação , SARS-CoV-2/genética , Glicoproteína da Espícula de Coronavírus/química
8.
Nature ; 607(7918): 387-392, 2022 07.
Artigo em Inglês | MEDLINE | ID: mdl-35732733

RESUMO

The α-helix is pre-eminent in structural biology1 and widely exploited in protein folding2, design3 and engineering4. Although other helical peptide conformations do exist near to the α-helical region of conformational space-namely, 310-helices and π-helices5-these occur much less frequently in protein structures. Less favourable internal energies and reduced tendencies to pack into higher-order structures mean that 310-helices rarely exceed six residues in length in natural proteins, and that they tend not to form normal supersecondary, tertiary or quaternary interactions. Here we show that despite their absence in nature, synthetic peptide assemblies can be built from 310-helices. We report the rational design, solution-phase characterization and an X-ray crystal structure for water-soluble bundles of 310-helices with consolidated hydrophobic cores. The design uses six-residue repeats informed by analysing 310-helical conformations in known protein structures, and incorporates α-aminoisobutyric acid residues. Design iterations reveal a tipping point between α-helical and 310-helical folding, and identify features required for stabilizing assemblies of 310-helices. This work provides principles and rules to open opportunities for designing into this hitherto unexplored region of protein-structure space.


Assuntos
Peptídeos , Estrutura Secundária de Proteína , Cristalografia por Raios X , Desenho de Fármacos , Interações Hidrofóbicas e Hidrofílicas , Peptídeos/síntese química , Peptídeos/química , Dobramento de Proteína , Estabilidade Proteica
9.
Cell ; 185(14): 2422-2433.e13, 2022 07 07.
Artigo em Inglês | MEDLINE | ID: mdl-35772405

RESUMO

The Omicron lineage of SARS-CoV-2, which was first described in November 2021, spread rapidly to become globally dominant and has split into a number of sublineages. BA.1 dominated the initial wave but has been replaced by BA.2 in many countries. Recent sequencing from South Africa's Gauteng region uncovered two new sublineages, BA.4 and BA.5, which are taking over locally, driving a new wave. BA.4 and BA.5 contain identical spike sequences, and although closely related to BA.2, they contain further mutations in the receptor-binding domain of their spikes. Here, we study the neutralization of BA.4/5 using a range of vaccine and naturally immune serum and panels of monoclonal antibodies. BA.4/5 shows reduced neutralization by the serum from individuals vaccinated with triple doses of AstraZeneca or Pfizer vaccine compared with BA.1 and BA.2. Furthermore, using the serum from BA.1 vaccine breakthrough infections, there are, likewise, significant reductions in the neutralization of BA.4/5, raising the possibility of repeat Omicron infections.


Assuntos
COVID-19 , Vacinas Virais , Anticorpos Neutralizantes , Anticorpos Antivirais , COVID-19/prevenção & controle , Humanos , Testes de Neutralização , SARS-CoV-2/genética , África do Sul
10.
J Am Chem Soc ; 144(13): 5956-5964, 2022 04 06.
Artigo em Inglês | MEDLINE | ID: mdl-35324198

RESUMO

The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10-T11-A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.


Assuntos
Quadruplex G , Rutênio , Dicroísmo Circular , DNA/química , Humanos , Rutênio/química , Telômero/metabolismo
11.
Cell Host Microbe ; 30(1): 53-68.e12, 2022 01 12.
Artigo em Inglês | MEDLINE | ID: mdl-34921776

RESUMO

Alpha-B.1.1.7, Beta-B.1.351, Gamma-P.1, and Delta-B.1.617.2 variants of SARS-CoV-2 express multiple mutations in the spike protein (S). These may alter the antigenic structure of S, causing escape from natural or vaccine-induced immunity. Beta is particularly difficult to neutralize using serum induced by early pandemic SARS-CoV-2 strains and is most antigenically separated from Delta. To understand this, we generated 674 mAbs from Beta-infected individuals and performed a detailed structure-function analysis of the 27 most potent mAbs: one binding the spike N-terminal domain (NTD), the rest the receptor-binding domain (RBD). Two of these RBD-binding mAbs recognize a neutralizing epitope conserved between SARS-CoV-1 and -2, while 18 target mutated residues in Beta: K417N, E484K, and N501Y. There is a major response to N501Y, including a public IgVH4-39 sequence, with E484K and K417N also targeted. Recognition of these key residues underscores why serum from Beta cases poorly neutralizes early pandemic and Delta viruses.


Assuntos
Anticorpos Antivirais/imunologia , Formação de Anticorpos/imunologia , COVID-19/imunologia , SARS-CoV-2/imunologia , Animais , Anticorpos Monoclonais/imunologia , Anticorpos Neutralizantes/imunologia , Células Cultivadas , Chlorocebus aethiops , Feminino , Células HEK293 , Humanos , Masculino , Camundongos , Camundongos Transgênicos , Testes de Neutralização/métodos , Ligação Proteica/imunologia , Glicoproteína da Espícula de Coronavírus/imunologia , Células Vero
12.
J Med Chem ; 64(15): 11379-11394, 2021 08 12.
Artigo em Inglês | MEDLINE | ID: mdl-34337941

RESUMO

The effectiveness of ß-lactam antibiotics is increasingly compromised by ß-lactamases. Boron-containing inhibitors are potent serine-ß-lactamase inhibitors, but the interactions of boron-based compounds with the penicillin-binding protein (PBP) ß-lactam targets have not been extensively studied. We used high-throughput X-ray crystallography to explore reactions of a boron-containing fragment set with the Pseudomonas aeruginosa PBP3 (PaPBP3). Multiple crystal structures reveal that boronic acids react with PBPs to give tricovalently linked complexes bonded to Ser294, Ser349, and Lys484 of PaPBP3; benzoxaboroles react with PaPBP3 via reaction with two nucleophilic serines (Ser294 and Ser349) to give dicovalently linked complexes; and vaborbactam reacts to give a monocovalently linked complex. Modifications of the benzoxaborole scaffold resulted in a moderately potent inhibition of PaPBP3, though no antibacterial activity was observed. Overall, the results further evidence the potential for the development of new classes of boron-based antibiotics, which are not compromised by ß-lactamase-driven resistance.


Assuntos
Antibacterianos/farmacologia , Compostos de Boro/farmacologia , Ensaios de Triagem em Larga Escala , Proteínas de Ligação às Penicilinas/antagonistas & inibidores , Pseudomonas aeruginosa/efeitos dos fármacos , Inibidores de beta-Lactamases/farmacologia , Antibacterianos/síntese química , Antibacterianos/química , Sítios de Ligação/efeitos dos fármacos , Compostos de Boro/síntese química , Compostos de Boro/química , Cristalografia por Raios X , Relação Dose-Resposta a Droga , Testes de Sensibilidade Microbiana , Modelos Moleculares , Estrutura Molecular , Proteínas de Ligação às Penicilinas/metabolismo , Relação Estrutura-Atividade , Inibidores de beta-Lactamases/síntese química , Inibidores de beta-Lactamases/química , beta-Lactamases
13.
Cell ; 184(16): 4220-4236.e13, 2021 08 05.
Artigo em Inglês | MEDLINE | ID: mdl-34242578

RESUMO

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has undergone progressive change, with variants conferring advantage rapidly becoming dominant lineages, e.g., B.1.617. With apparent increased transmissibility, variant B.1.617.2 has contributed to the current wave of infection ravaging the Indian subcontinent and has been designated a variant of concern in the United Kingdom. Here we study the ability of monoclonal antibodies and convalescent and vaccine sera to neutralize B.1.617.1 and B.1.617.2, complement this with structural analyses of Fab/receptor binding domain (RBD) complexes, and map the antigenic space of current variants. Neutralization of both viruses is reduced compared with ancestral Wuhan-related strains, but there is no evidence of widespread antibody escape as seen with B.1.351. However, B.1.351 and P.1 sera showed markedly more reduction in neutralization of B.1.617.2, suggesting that individuals infected previously by these variants may be more susceptible to reinfection by B.1.617.2. This observation provides important new insights for immunization policy with future variant vaccines in non-immune populations.


Assuntos
Anticorpos Antivirais/imunologia , Vacinas contra COVID-19/imunologia , SARS-CoV-2/imunologia , Animais , Anticorpos Monoclonais/imunologia , Anticorpos Neutralizantes/imunologia , Complexo Antígeno-Anticorpo/química , COVID-19/patologia , COVID-19/terapia , COVID-19/virologia , Vacinas contra COVID-19/administração & dosagem , Chlorocebus aethiops , Cristalografia por Raios X , Humanos , Imunização Passiva , Testes de Neutralização , Domínios Proteicos/imunologia , SARS-CoV-2/genética , SARS-CoV-2/isolamento & purificação , Glicoproteína da Espícula de Coronavírus/química , Glicoproteína da Espícula de Coronavírus/imunologia , Células Vero , Soroterapia para COVID-19
14.
Cell ; 184(11): 2939-2954.e9, 2021 05 27.
Artigo em Inglês | MEDLINE | ID: mdl-33852911

RESUMO

Terminating the SARS-CoV-2 pandemic relies upon pan-global vaccination. Current vaccines elicit neutralizing antibody responses to the virus spike derived from early isolates. However, new strains have emerged with multiple mutations, including P.1 from Brazil, B.1.351 from South Africa, and B.1.1.7 from the UK (12, 10, and 9 changes in the spike, respectively). All have mutations in the ACE2 binding site, with P.1 and B.1.351 having a virtually identical triplet (E484K, K417N/T, and N501Y), which we show confer similar increased affinity for ACE2. We show that, surprisingly, P.1 is significantly less resistant to naturally acquired or vaccine-induced antibody responses than B.1.351, suggesting that changes outside the receptor-binding domain (RBD) impact neutralization. Monoclonal antibody (mAb) 222 neutralizes all three variants despite interacting with two of the ACE2-binding site mutations. We explain this through structural analysis and use the 222 light chain to largely restore neutralization potency to a major class of public antibodies.


Assuntos
Anticorpos Monoclonais/imunologia , Anticorpos Neutralizantes/imunologia , Anticorpos Antivirais/imunologia , COVID-19/imunologia , SARS-CoV-2/imunologia , Glicoproteína da Espícula de Coronavírus/imunologia , Sítios de Ligação , COVID-19/terapia , COVID-19/virologia , Linhagem Celular , Humanos , Evasão da Resposta Imune , Imunização Passiva , Mutação , Ligação Proteica , Domínios Proteicos , SARS-CoV-2/genética , Deleção de Sequência , Glicoproteína da Espícula de Coronavírus/química , Glicoproteína da Espícula de Coronavírus/genética , Vacinação , Vacinas/imunologia , Soroterapia para COVID-19
15.
Cell ; 184(8): 2183-2200.e22, 2021 04 15.
Artigo em Inglês | MEDLINE | ID: mdl-33756110

RESUMO

Antibodies are crucial to immune protection against SARS-CoV-2, with some in emergency use as therapeutics. Here, we identify 377 human monoclonal antibodies (mAbs) recognizing the virus spike and focus mainly on 80 that bind the receptor binding domain (RBD). We devise a competition data-driven method to map RBD binding sites. We find that although antibody binding sites are widely dispersed, neutralizing antibody binding is focused, with nearly all highly inhibitory mAbs (IC50 < 0.1 µg/mL) blocking receptor interaction, except for one that binds a unique epitope in the N-terminal domain. Many of these neutralizing mAbs use public V-genes and are close to germline. We dissect the structural basis of recognition for this large panel of antibodies through X-ray crystallography and cryoelectron microscopy of 19 Fab-antigen structures. We find novel binding modes for some potently inhibitory antibodies and demonstrate that strongly neutralizing mAbs protect, prophylactically or therapeutically, in animal models.


Assuntos
Anticorpos Monoclonais/imunologia , Anticorpos Neutralizantes/imunologia , Anticorpos Antivirais/imunologia , COVID-19/imunologia , Glicoproteína da Espícula de Coronavírus/imunologia , Animais , Sítios de Ligação de Anticorpos , Células CHO , Chlorocebus aethiops , Cricetulus , Epitopos , Feminino , Células HEK293 , Humanos , Masculino , Camundongos , Camundongos Transgênicos , Modelos Moleculares , Ligação Proteica , Estrutura Terciária de Proteína , SARS-CoV-2/imunologia , Células Vero
16.
Cell ; 184(8): 2201-2211.e7, 2021 04 15.
Artigo em Inglês | MEDLINE | ID: mdl-33743891

RESUMO

SARS-CoV-2 has caused over 2 million deaths in little over a year. Vaccines are being deployed at scale, aiming to generate responses against the virus spike. The scale of the pandemic and error-prone virus replication is leading to the appearance of mutant viruses and potentially escape from antibody responses. Variant B.1.1.7, now dominant in the UK, with increased transmission, harbors 9 amino acid changes in the spike, including N501Y in the ACE2 interacting surface. We examine the ability of B.1.1.7 to evade antibody responses elicited by natural SARS-CoV-2 infection or vaccination. We map the impact of N501Y by structure/function analysis of a large panel of well-characterized monoclonal antibodies. B.1.1.7 is harder to neutralize than parental virus, compromising neutralization by some members of a major class of public antibodies through light-chain contacts with residue 501. However, widespread escape from monoclonal antibodies or antibody responses generated by natural infection or vaccination was not observed.


Assuntos
Anticorpos Monoclonais/imunologia , Anticorpos Neutralizantes/imunologia , Anticorpos Antivirais/imunologia , COVID-19/imunologia , SARS-CoV-2/imunologia , Glicoproteína da Espícula de Coronavírus/imunologia , Animais , Anticorpos Neutralizantes/sangue , Anticorpos Antivirais/sangue , Células CHO , COVID-19/epidemiologia , Chlorocebus aethiops , Cricetulus , Células HEK293 , Humanos , Pandemias , Ligação Proteica , Relação Estrutura-Atividade , Células Vero
17.
Preprint em Inglês | Fiocruz Preprints | ID: ppf-47927

RESUMO

A pesquisa aponta que o soro de pessoas previamente infectadas por outras cepas é menos potente contra esta variante viral. O problema é observado de forma marcante entre os indivíduos anteriormente infectados pela variante Gama, identificada originalmente em Manaus e atualmente dominante no Brasil, assim como pela variante Beta, detectada pela primeira vez na África do Sul. Nestes casos, a capacidade de neutralizar a cepa Delta é onze vezes menor. O soro de pessoas vacinadas também tem potência reduzida contra a variante originária da Índia, mas os dados apontam que as vacinas continuam efetivas. A capacidade de neutralizar a cepa é 2,5 vezes menor para o imunizante da Pfizer e 4,3 vezes menor para o da Astrazeneca. Os autores do trabalho ressaltam que os índices são semelhantes aos verificados com as variantes Gama e Alfa ­ que emergiram no Brasil e no Reino Unido, respectivamente. Não há evidência de fuga generalizada da neutralização, diferentemente do registrado com a variante Beta ­ com origem na África do Sul.

19.
Nat Struct Mol Biol ; 27(10): 950-958, 2020 10.
Artigo em Inglês | MEDLINE | ID: mdl-32737466

RESUMO

The COVID-19 pandemic has had an unprecedented health and economic impact and there are currently no approved therapies. We have isolated an antibody, EY6A, from an individual convalescing from COVID-19 and have shown that it neutralizes SARS-CoV-2 and cross-reacts with SARS-CoV-1. EY6A Fab binds the receptor binding domain (RBD) of the viral spike glycoprotein tightly (KD of 2 nM), and a 2.6-Å-resolution crystal structure of an RBD-EY6A Fab complex identifies the highly conserved epitope, away from the ACE2 receptor binding site. Residues within this footprint are key to stabilizing the pre-fusion spike. Cryo-EM analyses of the pre-fusion spike incubated with EY6A Fab reveal a complex of the intact spike trimer with three Fabs bound and two further multimeric forms comprising the destabilized spike attached to Fab. EY6A binds what is probably a major neutralizing epitope, making it a candidate therapeutic for COVID-19.


Assuntos
Anticorpos Antivirais/química , Betacoronavirus/química , Infecções por Coronavirus/imunologia , Pneumonia Viral/imunologia , Glicoproteína da Espícula de Coronavírus/química , Adulto , Enzima de Conversão de Angiotensina 2 , Animais , Anticorpos Neutralizantes/imunologia , Anticorpos Antivirais/imunologia , Anticorpos Antivirais/metabolismo , Betacoronavirus/imunologia , Betacoronavirus/metabolismo , Sítios de Ligação , COVID-19 , Chlorocebus aethiops , Reações Cruzadas , Microscopia Crioeletrônica , Cristalografia por Raios X , Epitopos , Humanos , Fragmentos Fab das Imunoglobulinas/química , Fragmentos Fab das Imunoglobulinas/metabolismo , Masculino , Pandemias , Peptidil Dipeptidase A/metabolismo , Conformação Proteica , Domínios Proteicos , SARS-CoV-2 , Glicoproteína da Espícula de Coronavírus/imunologia , Glicoproteína da Espícula de Coronavírus/metabolismo , Células Vero
20.
Cell Host Microbe ; 28(3): 445-454.e6, 2020 09 09.
Artigo em Inglês | MEDLINE | ID: mdl-32585135

RESUMO

There are as yet no licensed therapeutics for the COVID-19 pandemic. The causal coronavirus (SARS-CoV-2) binds host cells via a trimeric spike whose receptor binding domain (RBD) recognizes angiotensin-converting enzyme 2, initiating conformational changes that drive membrane fusion. We find that the monoclonal antibody CR3022 binds the RBD tightly, neutralizing SARS-CoV-2, and report the crystal structure at 2.4 Å of the Fab/RBD complex. Some crystals are suitable for screening for entry-blocking inhibitors. The highly conserved, structure-stabilizing CR3022 epitope is inaccessible in the prefusion spike, suggesting that CR3022 binding facilitates conversion to the fusion-incompetent post-fusion state. Cryogenic electron microscopy (cryo-EM) analysis confirms that incubation of spike with CR3022 Fab leads to destruction of the prefusion trimer. Presentation of this cryptic epitope in an RBD-based vaccine might advantageously focus immune responses. Binders at this epitope could be useful therapeutically, possibly in synergy with an antibody that blocks receptor attachment.


Assuntos
Anticorpos Neutralizantes/imunologia , Anticorpos Antivirais/imunologia , Betacoronavirus/química , Betacoronavirus/imunologia , Infecções por Coronavirus/terapia , Pneumonia Viral/terapia , Glicoproteína da Espícula de Coronavírus/química , Glicoproteína da Espícula de Coronavírus/imunologia , Sítio Alostérico , Sequência de Aminoácidos , Enzima de Conversão de Angiotensina 2 , Anticorpos Monoclonais/imunologia , Anticorpos Neutralizantes/uso terapêutico , Anticorpos Antivirais/uso terapêutico , Complexo Antígeno-Anticorpo/química , Betacoronavirus/genética , COVID-19 , Vacinas contra COVID-19 , Infecções por Coronavirus/tratamento farmacológico , Infecções por Coronavirus/imunologia , Infecções por Coronavirus/prevenção & controle , Infecções por Coronavirus/virologia , Microscopia Crioeletrônica , Cristalografia por Raios X , Interações entre Hospedeiro e Microrganismos/imunologia , Humanos , Modelos Moleculares , Testes de Neutralização , Pandemias , Peptidil Dipeptidase A/química , Pneumonia Viral/imunologia , Pneumonia Viral/virologia , Receptores Virais/química , SARS-CoV-2 , Glicoproteína da Espícula de Coronavírus/genética , Vacinas Virais/imunologia , Vacinas Virais/uso terapêutico , Internalização do Vírus , Tratamento Farmacológico da COVID-19
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA
...