Fetal hemoglobin regulating genetic variants identified in homozygous (HbSS) and heterozygous (HbSA) subjects from South Mexico.

Hemoglobin S is caused by a nucleotide change in HBB gene (HBB:c.20A>T, p.Glu6Val), is presented in diverse forms: simple carriers (HbSA), homozygotes (HbSS) also known as sickle cell anemia, and compound heterozygotes with other ß-hemoglobinopathies. It is worldwide distributed, in Mexico, is frequently observed in the southern states Guerrero, Oaxaca and Chiapas. Elevated fetal hemoglobin (HbF) is associated with mild phenotype; single-nucleotide variants (SNVs) in modifier genes, such as BCL11A, HBG2, HBBP1 pseudogene and HBS1L-MYB intergenic region, upregulate HbF synthesis. The aim of this study was to identify HbF regulating genetic variants in HbSS and HbSA Mexican subjects. We studied 39 individuals (HbSS = 24, 61%, HbSA = 15, 39%) from Chiapas (67%) and Guerrero (33%), peripheral blood was collected in ethylenediamine tetraacetic acid (EDTA) for molecular and hematological studies, DNA was isolated by salting-out technic and genotyping was performed through allelic discrimination by real time polymerase chain reaction (RT-PCR) using Taqman® probes for 15 SNV (in BCL11A: rs6706648, rs7557939, rs4671393, rs11886868, rs766432, rs7599488, rs1427407; HBS1L-MYB: rs28384513, rs7776054, rs9399137, rs4895441, rs9402686, rs1320963; HBG2: rs7482144; and HBBP1: rs10128556). The obtained data were analyzed using IMB SPSS v.22.0 software. All minor alleles were observed in frequencies over 0.05, the most frequent was rs9402686 (0.82), while the less frequent was rs101028556 (0.08). In HbSS group, the mean fetal hemoglobin was 11.9 ± 5.9% and was significantly elevated in BCL11A rs11886868 wildtype homozygotes and in carriers of HBS1L-MYB intergenic region rs7776054 (p = 0.04 and p = 0.03, respectively). In conclusion, in HbSS Mexican patients, two SNVs were observed related to increased HbF; BCL11A rs11886868 and HBS1L-MYB rs7776054.

Sickle cell anemia (SCA) is one of the most common types of hemoglobinopathies in people of African ancestry, it is caused by homozygosity of HbS mutation (HBB:c.20A>T). It is known that fetal hemoglobin plays a key role in decreasing HbS polymerization which damages the erythrocyte structure and is responsible for the characteristic hemolytic crises endured by these patients. Single-nucleotide variant (SNV) in genes that regulate fetal hemoglobin (HbF) after birth have been associated with its increment, thus ameliorating the hematologic phenotype of this pathology and other ß-hemoglobinopathies. Therefore, in this study, we identified, for the first time in Mexican patients with SCA (HbSS) and HbS carriers (HbSA), the presence of 15 SNVs on BCL11A, HBS1L-MYB and HBG2; all HbSS patients had anemia and elevated HbF; 2 variants were related to increased HbF rs11688888C of BCL11A and rs7776054G of HBSIL-MYB; and finally, all minor alleles were found at a frequency higher than 0.05.

Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of ß-Thalassemia in Mexican mestizo patients.

INTRODUCTION: Beta-thalassemia (ß-thal) is frequent in Mexican patients with microcytosis and hypochromia. We report three novel mutations and analyze the actual mutational spectrum in Mexican population. METHODS: One hundred and forty-nine ß-thal Mexican mestizo patients were studied (154 alleles). ARMS-PCR was performed to identify Cd39C>T, IVS1:1G>A, IVS1:110G>A, -28A>C, initiation codonA>G and IVS1:5G>A mutations, and gap-PCR for δß-thal Spanish type. DNA sequencing of HBB gene was carried out in negative samples for the initial screening. RESULTS: Fifteen different HBB gene mutations were observed in 148 alleles; three of them are novel: -90C>G, 20 bp deletion (at codons 78/85), and IVS2:2T>G; the mutation IVS1:6T>C that was observed for first time in our population; and eleven previously described mutations. Six alleles showed normal HBB sequence. To date, a total of 21 different mutations have been observed in Mexican patients; the four most frequent mutations are of Mediterranean origin: Cd39C>T (37.2%), IVS1:1G>A (17.3%), IVS1:110G>A (13.9%), and δß-thal Spanish type (9.0%), which represent 77.4% of the total studied alleles. CONCLUSION: Considering the novel mutations -90C>G, -20 bp Cd78/85, IVS2:2T>G and the first observation of IVS1:6T>C, the molecular spectrum of ß-thal in Mexicans comprises 21 different mutations, confirming the high allelic heterogeneity in Mexicans.

Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).

INTRODUCTION: Alpha-thalassemia (α-thal) is a common monogenic disorder worldwide. In mixed ethnic populations, α-thal and beta-thalassemia (ß-thal) can be expected, sometimes giving complex phenotypes, which without molecular analysis are not easily explained. We performed the molecular identification of α- and ß-thal alleles in 51 Mexican patients with microcytosis, hypochromia, and normal or low levels of HbA2 . METHODS: Common deletional alleles (-α(3.7) , -α(4.2) , - -(SEA) , - -(MED) , - -(FIL) , - -(THAI) , -α(20.5) ) and α-triplication were studied by gap-PCR and nondeletional alleles (α(IVSI) ((-5nt)) , α2 (NcoI) , α1 (NcoI) ) by ARMS. ß-thal alleles Cd39 (C>T), IVS1:1 (G>A), IVS1:110 (G>A), and Spanish δß-thal were also investigated. DNA sequencing was performed on HBA2, HBA1, and HBB genes. Negative samples were subjected to MLPA. RESULTS: In 35 subjects, we identified the mutations, -α(3.7) , - -(SEA) , - -(FIL) , α(IVSI) ((-5nt)) , and ααα(anti3.7) and two novel deletion alleles - -(Mex1) (6.8-8.9 kb) and - -(Mex2) (77.6-135.7 kb). Four individuals also had a ß-thal allele (Cd39/IVS1:110). No α-thal alleles were observed in 16 subjects, but three had a ß-thal mutation Cd39, IVS1:110, and Spanish δß-thal. CONCLUSION: α-thal is relatively common in Mexican patients, the combination with ß-thal is sometimes unexpected, and this underlines the importance of performing molecular analysis for both α- and ß-genes defects in patients showing microcytic hypochromic anemia.

Association analysis of vitamin D receptor gene polymorphisms and bone mineral density in postmenopausal Mexican-Mestizo women.

We investigated associations between vitamin D receptor (VDR) gene polymorphisms, FokI T>C (rs2228570), BsmI G>A (rs1544410), ApaI G>T (rs7975232), and TaqI T>C (rs731236), with bone mineral density (BMD) in postmenopausal Mexican-Mestizo women. Three hundred and twenty postmenopausal women participated, who were classified according to World Health Organization criteria as non-osteoporotic (Non-OP; N = 88), osteopenic (Opn; N = 144), and osteoporotic (OP; N = 88). BMD measurements at the lumbar (L1-L4) spine and at the left and right femoral neck were obtained by dual-energy X-ray absorptiometry. Single nucleotide polymorphisms (SNPs) were genotyped using real-time polymerase chain reaction and TaqMan probes. Genotype and allelic frequencies of the 4 VDR SNPs were similar among the 3 groups. Polymorphic allele frequencies were as follows: FokI (C) 0.53, 0.49, 0.56; BsmI (A) 0.26, 0.22, 0.23; ApaI (T) 0.43, 0.39, 0.44; TaqI (C) 0.27, 0.22, 0.23 for the Non-OP, Opn, and OP groups, respectively. Although no associations were found between the SNPs and BMD, based on the putative function of the FokI SNP, we constructed, for the first time, the haplotype with the 4 VDR SNPs, and found that the CGGT haplotype differed between the Non- OP and OP groups (21.8 vs 31.8%, P < 0.05). The risk analysis for this haplotype was nearly significant under the dominant model (OR = 1.783, 95%CI = 0.98-3.25, P = 0.058). This result suggests a possible susceptibility effect of the C allele of the FokI SNP for the development of osteoporosis in postmenopausal Mexican-Mestizo women.