High-throughput analysis of hematopoietic stem cell engraftment after intravenous and intracerebroventricular dosing.

Hematopoietic stem/progenitor cell gene therapy (HSPC-GT) has shown clear neurological benefit in rare diseases, which is achieved through the engraftment of genetically modified microglia-like cells (MLCs) in the brain. Still, the engraftment dynamics and the nature of engineered MLCs, as well as their potential use in common neurogenerative diseases, have remained largely unexplored. Here, we comprehensively characterized how different routes of administration affect the biodistribution of genetically engineered MLCs and other HSPC derivatives in mice. We generated a high-resolution single-cell transcriptional map of MLCs and discovered that they could clearly be distinguished from macrophages as well as from resident microglia by the expression of a specific gene signature that is reflective of their HSPC ontogeny and irrespective of their long-term engraftment history. Lastly, using murine models of Parkinson's disease and frontotemporal dementia, we demonstrated that MLCs can deliver therapeutically relevant levels of transgenic protein to the brain, thereby opening avenues for the clinical translation of HSPC-GT to the treatment of major neurological diseases.

Tissue-specific regulation and function of Grb10 during growth and neuronal commitment.

Growth-factor receptor bound protein 10 (Grb10) is a signal adapter protein encoded by an imprinted gene that has roles in growth control, cellular proliferation, and insulin signaling. Additionally, Grb10 is critical for the normal behavior of the adult mouse. These functions are paralleled by Grb10's unique tissue-specific imprinted expression; the paternal copy of Grb10 is expressed in a subset of neurons whereas the maternal copy is expressed in most other adult tissues in the mouse. The mechanism that underlies this switch between maternal and paternal expression is still unclear, as is the role for paternally expressed Grb10 in neurons. Here, we review recent work and present complementary data that contribute to the understanding of Grb10 gene regulation and function, with specific emphasis on growth and neuronal development. Additionally, we show that in vitro differentiation of mouse embryonic stem cells into alpha motor neurons recapitulates the switch from maternal to paternal expression observed during neuronal development in vivo. We postulate that this switch in allele-specific expression is related to the functional role of Grb10 in motor neurons and other neuronal tissues.

CTCF binding to the first intron of the major immediate early (MIE) gene of human cytomegalovirus (HCMV) negatively regulates MIE gene expression and HCMV replication.

UNLABELLED: Human cytomegalovirus (HCMV) gene expression during infection is highly regulated, with sequential expression of immediate-early (IE), early (E), and late (L) gene transcripts. To explore the potential role of chromatin regulatory factors that may regulate HCMV gene expression and DNA replication, we investigated the interaction of HCMV with the cellular chromatin-organizing factor CTCF. Here, we show that HCMV-infected cells produce higher levels of CTCF mRNA and protein at early stages of infection. We also show that CTCF depletion by short hairpin RNA results in an increase in major IE (MIE) and E gene expression and an about 50-fold increase in HCMV particle production. We identified a DNA sequence (TTAACGGTGGAGGGCAGTGT) in the first intron (intron A) of the MIE gene that interacts directly with CTCF. Deletion of this CTCF-binding site led to an increase in MIE gene expression in both transient-transfection and infection assays. Deletion of the CTCF-binding site in the HCMV bacterial artificial chromosome plasmid genome resulted in an about 10-fold increase in the rate of viral replication relative to either wild-type or revertant HCMV. The CTCF-binding site deletion had no detectable effect on MIE gene-splicing regulation, nor did CTCF knockdown or overexpression of CTCF alter the ratio of IE1 to IE2. Therefore, CTCF binds to DNA within the MIE gene at the position of the first intron to affect RNA polymerase II function during the early stages of viral transcription. Finally, the CTCF-binding sequence in CMV is evolutionarily conserved, as a similar sequence in murine CMV (MCMV) intron A was found to interact with CTCF and similarly function in the repression of MCMV MIE gene expression mediated by CTCF. IMPORTANCE: Our findings that CTCF binds to intron A of the cytomegalovirus (CMV) major immediate-early (MIE) gene and functions to repress MIE gene expression and viral replication are highly significant. For the first time, a chromatin-organizing factor, CTCF, has been found to facilitate human CMV gene expression, which affects viral replication. We also identified a CTCF-binding motif in the first intron (also called intron A) that directly binds to CTCF and is required for CTCF to repress MIE gene expression. Finally, we show that the CTCF-binding motif is conserved in CMV because a similar DNA sequence was found in murine CMV (MCMV) that is required for CTCF to bind to MCMV MIE gene to repress MCMV MIE gene expression.

Genomic imprinting in development, growth, behavior and stem cells.

Genes that are subject to genomic imprinting in mammals are preferentially expressed from a single parental allele. This imprinted expression of a small number of genes is crucial for normal development, as these genes often directly regulate fetal growth. Recent work has also demonstrated intricate roles for imprinted genes in the brain, with important consequences on behavior and neuronal function. Finally, new studies have revealed the importance of proper expression of specific imprinted genes in induced pluripotent stem cells and in adult stem cells. As we review here, these findings highlight the complex nature and developmental importance of imprinted genes.

CTCF binding site sequence differences are associated with unique regulatory and functional trends during embryonic stem cell differentiation.

CTCF (CCCTC-binding factor) is a highly conserved multifunctional DNA-binding protein with thousands of binding sites genome-wide. Our previous work suggested that differences in CTCF's binding site sequence may affect the regulation of CTCF recruitment and its function. To investigate this possibility, we characterized changes in genome-wide CTCF binding and gene expression during differentiation of mouse embryonic stem cells. After separating CTCF sites into three classes (LowOc, MedOc and HighOc) based on similarity to the consensus motif, we found that developmentally regulated CTCF binding occurs preferentially at LowOc sites, which have lower similarity to the consensus. By measuring the affinity of CTCF for selected sites, we show that sites lost during differentiation are enriched in motifs associated with weaker CTCF binding in vitro. Specifically, enrichment for T at the 18(th) position of the CTCF binding site is associated with regulated binding in the LowOc class and can predictably reduce CTCF affinity for binding sites. Finally, by comparing changes in CTCF binding with changes in gene expression during differentiation, we show that LowOc and HighOc sites are associated with distinct regulatory functions. Our results suggest that the regulatory control of CTCF is dependent in part on specific motifs within its binding site.

A role for CTCF and cohesin in subtelomere chromatin organization, TERRA transcription, and telomere end protection.

The contribution of human subtelomeric DNA and chromatin organization to telomere integrity and chromosome end protection is not yet understood in molecular detail. Here, we show by ChIP-Seq that most human subtelomeres contain a CTCF- and cohesin-binding site within ∼1-2 kb of the TTAGGG repeat tract and adjacent to a CpG-islands implicated in TERRA transcription control. ChIP-Seq also revealed that RNA polymerase II (RNAPII) was enriched at sites adjacent to the CTCF sites and extending towards the telomere repeat tracts. Mutation of CTCF-binding sites in plasmid-borne promoters reduced transcriptional activity in an orientation-dependent manner. Depletion of CTCF by shRNA led to a decrease in TERRA transcription, and a loss of cohesin and RNAPII binding to the subtelomeres. Depletion of either CTCF or cohesin subunit Rad21 caused telomere-induced DNA damage foci (TIF) formation, and destabilized TRF1 and TRF2 binding to the TTAGGG proximal subtelomere DNA. These findings indicate that CTCF and cohesin are integral components of most human subtelomeres, and important for the regulation of TERRA transcription and telomere end protection.