RESUMO
This dataset describes the knowledge of local people in North Sulawesi on local edible fruits which can be eaten raw or used as medicine. North Sulawesi is located in the Wallacea zone [1,2] and has a high biodiversity of local fruits that are not yet fully exploited. Fruits are available as rich sources of vitamins, fibres, minerals, and phytochemicals [3] for local people's diet and health. Ethnobotany was used to collect data for the documentation of local knowledge on the existence, the use, and conservation practices of local fruits using semi-structured and structured interviews and questionnaire. There were 27 recorded families of local edible fruits, predominated by Myrtaceae and Anacardiaceae. Some fruits were found abundantly, but some were rarely found, especially those which were endemic to North Sulawesi. The fruit trees were mostly self-grown, and the fruits were eaten by the community themselves. In general, they were well aware of the types of local fruits that could be eaten raw. Knowledge of local fruits were passed on from generation to generation. Most people claimed that local fruits which could be eaten raw were also used for medicine and maintaining health. Most of the local fruits used as medicines were not made as medicinal preparations, but eaten raw or cooked. However, most people did not know exactly about the efficacy of the fruits. Types of diseases that were claimed to be cured by using local fruit among others were sprue, high cholesterol and digestive disorders. The possibility of future youth generations to consume these fruits was very high, according to most people. But they were worried that the younger generation in the future would prefer imported fruits. The community in general knew that these local fruits needed to be conserved, but they did not yet know how to maintain the existence of these local fruits in the future, apart from their current practices.
RESUMO
BACKGROUND AND OBJECTIVE: Genetic variation in the form of a single nucleotide polymorphisms (SNPs) in the tumor necrosis factor alpha (TNF-α) promoter region is known to influence the regulation of TNF-α production, transcription and translation and has been linked to several diseases. Primer sequences that amplify DNA flanking the -308 sequence are not universal, therefore, research on SNP conducted in this area still uses different primer pairs. The purpose of this research was to design and optimize universal primers to amplify DNA sequences covering the TNF-α -308 promoter area for other researchers to study the presence of SNPs in the -308 nucleotide and beyond. MATERIALS AND METHODS: The peripheral blood samples for DNA preparation were obtained from 3 participants. The DNAs were extracted using available commercial kit. The candidate of universal primers were designed using BLAST and Primer3 softwares. Amplification of DNA region flanked by the designed primer pairs was performed using PCR method using available commercial kit. RESULTS: The study showed that there were significant differences between the 5 primary pairs studied. From the 5 pairs of primers, the TNF-α 1 primer pair (TNF-α 1F: AACCAGCATTATGAGTCTC and TNF-α 1R: AACAACTGCCTTTATATGTC) and the TNF-α 2 primer pair (TNF-α 2F: TGAAACCAGCATTATGAGT and TNF-α 2R: AACAACTGCCTTTATATGTC) produced single, distinct, sharp and thick bands. CONCLUSION: From this study it can be concluded that TNF-α 1 and TNF-α 2 primer pairs have the potential to be used as universal primers to study the SNPs in the TNF-α -308 promoter region.