Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 13 de 13
Filtrar
1.
Ann Med ; 54(1): 1938-1951, 2022 12.
Artigo em Inglês | MEDLINE | ID: mdl-35801810

RESUMO

BACKGROUND: Epilepsy is a heterogeneous complex condition that involve the human brain. Genetic predisposition to epilepsy is a fundamental factor of the disorder aetiology. The sodium voltage-gated channel (SCN) genes variants are critical biomarker for the epilepsy development and progression. In this study, we aimed to investigate the association of several SNCs genetic polymorphisms with epilepsy risk and their intrudance of the disease prognosis. METHODS: Blood samples were withdrawn from 296 Epilepsy patients in addition to 293 healthy matched participants prior to DNA extraction. PCR-sequencing was used for genotyping analysis. Genotyping outputs were then statistically analysed for genotype/phenotype evaluation. RESULTS: Within SCN1A gene we found that the rs6432861 (p = 0.014) was in correlation with the risk of epilepsy. In addition, both rs4667485 and rs1469649 of SCN2A gene were significantly correlated to epilepsy risk for both allelic (4e-4 and 1e-3) and genotypic (1e-3 and 5e-3). Moreover, the haplotype analysis showed that the GATGCTCGGTTTCGCTACGCA haplotype of SCN2A gene was significantly related to epilepsy increased risk, p = 6e-3, OR (CI) = 2.02 (1.23-3.31). In relevant to our finding, many of the investigated SCNs variants in the current study were related to several clinical features of epilepsy. CONCLUSION: In light of our results, we infer that SCN genes polymorphisms are strong candidates for epilepsy development and progression. Furthermore, these variant are essential for the disorder prognosis and medications outcomes.Key MessagesGenetic polymorphisms of sodium channels SCN1A, SCN2A and SCN3A were found to be associated with the risk of epilepsy.SCN1B polymorphisms were found to be correlated to epilepsy reduced risk.SCNs variants are involved in the epilepsy prognosis and response to treatment.


Assuntos
Epilepsia , Canal de Sódio Disparado por Voltagem NAV1.1 , Epilepsia/tratamento farmacológico , Epilepsia/genética , Humanos , Canal de Sódio Disparado por Voltagem NAV1.1/genética , Canal de Sódio Disparado por Voltagem NAV1.2/genética , Canal de Sódio Disparado por Voltagem NAV1.3/genética , Polimorfismo Genético , Prognóstico , Arábia Saudita , Canais de Sódio/genética , Subunidade beta-1 do Canal de Sódio Disparado por Voltagem/genética
2.
Exp Oncol ; 43(2): 149-154, 2021 06.
Artigo em Inglês | MEDLINE | ID: mdl-34190511

RESUMO

BACKGROUND: Genetic predisposition to breast cancer (BC) has been extensively explored to achieve an enhanced understanding of the biology of BC. Targeting candidate genes to screen different genetic variants such as RAD51 gene that plays a critical role in DNA repair pathways including the double-strand break repair system is an important task. AIM: To study several single nucleotide polymorphisms (SNPs) within RAD51-UTR gene and to find their relationship with BC risk and prognosis among Jordanian females. MATERIALS AND METHODS: In this case-control study, DNA sequencing technique was used to screen SNPs within the untranslated region (UTR) of RAD51 in 206 cases and 185 controls and the resulting data were statistically analyzed using different types of genetic analyses. Patients' clinical and pathological features were obtained from their medical records to perform genotype-phenotype association analysis. RESULTS: Our findings show a significant association between both SNPs rs528590644, rs1801320 and BC risk (p = 0.016). We estimated the correlation between many of BC prognostic factors and BC risk, and we found an association between rs1801321 and age at first menstruation (p = 0.032) in addition to a strong correlation between age at BC diagnosis and rs1801320 (p = 0.008). CONCLUSION: RAD51-UTR polymorphisms may be involved in BC development and progression.


Assuntos
Neoplasias da Mama/genética , Predisposição Genética para Doença/genética , Rad51 Recombinase/genética , Estudos de Casos e Controles , Feminino , Haplótipos , Humanos , Jordânia , Polimorfismo de Nucleotídeo Único , Regiões não Traduzidas/genética
3.
BMC Psychiatry ; 21(1): 5, 2021 01 05.
Artigo em Inglês | MEDLINE | ID: mdl-33402148

RESUMO

BACKGROUND: Like other complex diseases including drug addiction, genetic factors can interfere with the disease. In this study, three opioid genes (OPRM1, OPRD1, and OPRK1) were examined for an association with drug addiction among Jordanian males. METHODS: The study involved 498 addicts, in addition to 496 healthy controls and all from Arab descent. RESULTS: The findings in this study showed that rs1799971 of the OPRM1 gene was in association with drug addiction for both alleles and genotypes with P-values = 0.002 and 0.01, respectively. In addition, a significant association between the dominant model (A/A vs G/A-G/G) of rs1799971 (OPRM1) and drug addiction (P-value = 0.003, OR = 1.59 (1.17-2.15)) was detected. Moreover, a genetic haplotype (AGGGCGACCCC) of theOPRM1 gene revealed a significant association with drug addiction (P-value = 0.01, OR = 1.56 (1.15-2.12)). We also found that the age of addicts, smoking, and marital status with genetic variants within OPRM1, OPRD1, and OPRK1 genes may be implicated in drug addiction risk. CONCLUSION: We propose that rs1799971 of the OPRM1gene is a genetic risk factor for drug addiction among Jordanian males.


Assuntos
Predisposição Genética para Doença , Transtornos Relacionados ao Uso de Substâncias , Predisposição Genética para Doença/genética , Genótipo , Humanos , Masculino , Polimorfismo de Nucleotídeo Único/genética , Receptores Opioides/genética , Receptores Opioides mu/genética , Transtornos Relacionados ao Uso de Substâncias/genética
4.
Pharmgenomics Pers Med ; 13: 199-215, 2020.
Artigo em Inglês | MEDLINE | ID: mdl-32765042

RESUMO

BACKGROUND: Profiling rare variants in isolated populations can significantly clarify and understand the development of a clinically relevant process. Therefore, leading to a better identifying novel targeted treatment. OBJECTIVE: This study aimed to determine the allele frequencies of 56 single nucleotide polymorphisms (SNPs) within several important pharmacogenes. METHODS: This study consisted of 166 unrelated subjects from a genetically isolated group (Chechen) who were living in Jordan. In this study, the distribution of the variants among Chechen was compared to other ethnic groups available at two databases (Genome 1000 and (ExAC)). The frequency of genotypes and alleles was calculated and tested using the chi-square test and the Hardy-Weinberg equilibrium equation (HWE). RESULTS: Our results revealed that the distribution of allele frequencies within different pharmacogenes among Chechen showed different similarities with other populations. The CEU and TSI showed the highest resemblance with the Chechen population (75% similarity), in contrast to LWK which had the lowest similarity (30%). CONCLUSION: This study sheds light on clinically relevant SNPs to enhance medical research and apply pharmacogenomics in clinical settings.

5.
J Pers Med ; 10(1)2020 Jan 06.
Artigo em Inglês | MEDLINE | ID: mdl-31935801

RESUMO

Several genetic variants have been identified that cause variation among different populations and even within individuals of a similar descent. This leads to interindividual variations in the optimal dose of the drug that is required to sustain the treatment efficiency. In this study, 56 single nucleotide polymorphisms (SNPs) within several pharmacogenes were analyzed in 128 unrelated subjects from a genetically isolated group of Circassian people living in Jordan. We also compared these variant distributions to other ethnic groups that are available at two databases (Genome 1000 and eXAC). Our results revealed that the distribution of allele frequencies within genes among Circassians in Jordan showed similarities and disparities when compared to other populations. This study provides a powerful base for clinically relevant SNPs to enhance medical research and future pharmacogenomic studies. Rare variants detected in isolated populations can significantly guide to novel loci involved in the development of clinically relevant traits.

6.
Gene ; 728: 144281, 2020 Feb 20.
Artigo em Inglês | MEDLINE | ID: mdl-31836525

RESUMO

Genetic predisposition to breast cancer (BC) has become one of the most studied aspects of the disease. Advances in the field of cancer research have revealed the role of different genetic polymorphisms within genes of interest in the development of BC. This study aimed to explore the impact of a variable number tandem repeat (VNTR) genetic variant found within the SET and MYND domain containing protein 3 (SMYD3) gene on BC risk in Jordan and examine key clinical and pathological prognostic factors. Genotyping of blood samples from 180 cases with breast cancer and 180 healthy individuals from the Jordanian population was carried out via a combination of PCR and agarose gel electrophoresis. A highly significant association was found at level of genotype (P-value = 0.009) and allele (P-value = 0.0001) between BC development and the VNTR variant in the SMYD3 gene among Jordanian women. Moreover, we found that the VNTR of SMYD3 gene may interfere with BC risk among patients with different immunohistochemistry (IHC) profiles (P-value < 0.05). This study reported that there is a significant correlation between BC development and the VNTR in the SMYD3 gene. These findings can help alleviate the burden of BC in developing countries including Jordan and to fill the gaps in current literature. Since this study was carried out on Jordanian Arabs, more studies on the link between BC and the SMYD3 VNTR variant are recommended to determine this polymorphism's impact on other ethnic groups.


Assuntos
Biomarcadores Tumorais/genética , Neoplasias da Mama/genética , Neoplasias da Mama/patologia , Estudos de Associação Genética , Histona-Lisina N-Metiltransferase/genética , Repetições Minissatélites , Adolescente , Adulto , Estudos de Casos e Controles , Feminino , Seguimentos , Humanos , Pessoa de Meia-Idade , Prognóstico , Adulto Jovem
7.
Pharmgenomics Pers Med ; 12: 201-207, 2019.
Artigo em Inglês | MEDLINE | ID: mdl-31692576

RESUMO

BACKGROUNDS: Breast cancer (BC) is one of the most widespread cancers globally. Understanding the etiology of BC may help in determining the various risk factors involved in its malignancy. Certain genetic mutations are considered to play a key role in increasing the risk of BC. OBJECTIVES: In this study, we explored the correlation between a variable number tandem repeat (VNTR) polymorphism in the IL-4 gene and BC. METHODS: PCR and subsequent gel electrophoresis were used to genotype this variant in 360 Jordanian women (180 BC patients and 180 controls). In addition, phenotype-genotype analysis was carried out. RESULTS: Our findings illustrate that there is no significant relationship between the variant genotypes in the IL-4 gene and BC among Jordanian females. Other than body mass index and tumor differentiation (p< 0.05), none of the clinical and pathological parameters of BC patients exhibited any association with the variant genotypes. CONCLUSIONS: From this study, we propose that the IL-4 genetic variant does not impact BC development and progression but that it could influence the disease prognosis.

8.
Onco Targets Ther ; 12: 7757-7765, 2019.
Artigo em Inglês | MEDLINE | ID: mdl-31571925

RESUMO

PURPOSE: Genetic predisposition to disease has become one of the most investigated risk factors in recent years, and breast cancer (BC) is no exception. In this study, we investigated specific genetic variants of three candidate genes belonging to the glutathione-S-transferase superfamily that have been implicated in increased risk of cancers. MATERIALS AND METHODS: This case-control study comprised 241 Jordanian women who were diagnosed with BC in addition to 219 matched controls. Gel electrophoresis of PCR products was used to visualize and genotype both the GSTM1 and GSTT1 genes, while PCR-RFLP was employed to genotype the rs1695 of the GSTP1 gene. RESULTS: Our findings did not reveal any correlation between the investigated polymorphisms of GST genes and BC risk among Jordanian women. Otherwise, the combination of GSTM1 entire gene deletion and (GG) genotype of GSTP1 polymorphism (rs1695) was significantly associated with BC with p-value <0.05 (i.e. p-value was not significant after correcting for multiple comparison). CONCLUSION: We suggest that the interaction between GSTM1 polymorphism and rs1695 of GSTP1 may influence BC development and progression among Jordanian women. More epidemiological studies are needed to provide a baseline for the underlying role of GSTs polymorphisms in tumorigenesis.

9.
J Cancer ; 10(19): 4647-4654, 2019.
Artigo em Inglês | MEDLINE | ID: mdl-31528229

RESUMO

This study aim to investigate the association of breast cancer risk and prognostic factors with single nucleotide variants of the BRCA1, BRCA2, DAPK1, MMP9, TOX3, and TP53 genes in Jordanian women. Blood samples were collected from 230 Jordanian breast cancer patients for use in DNA extraction followed by genotyping and subsequent statistical analysis. We found that two single nucleotide variants (SNVs) of the BRCA2 gene, namely rs1799944 and rs766173, were significantly associated with breastfeeding status. Likewise, the rs11141901 and rs1041326 SNVs of the DAPK1 gene were linked with co-morbidity (p-value = 0.002) and family history of BC (p-value = 0.015), while the rs1045042 SNV of the same gene was associated with both allergy (p-value = 0.001) and family history of BC (p-value = 0.02). Tumor differentiation was correlated with the DAPK1 SNVs rs11141901 (p-value = 0.041) and rs1041326 (p-value = 0.005). Additionally, the rs2250889 SNV of the MMP9 gene was significantly associated with HER2 status, whereas the TP53 SNVs rs12951053 and rs1042522 were associated with age at menarche (p-value = 0.043) and breastfeeding status (p-value = 0.013), respectively. In contrast, the TP53 SNV rs2287497 was significantly linked to age at first pregnancy (p-value = 0.001), smoking (p-value = 0.041), and axillary lymph node status (p-value = 6e-4). No such association was found for the BRCA1 and TOX3 SNVs. The current findings suggest significant associations between certain SNVs and breast cancer risk and prognosis in Jordanian women.

10.
BMC Med Genet ; 20(1): 148, 2019 09 02.
Artigo em Inglês | MEDLINE | ID: mdl-31477036

RESUMO

BACKGROUND: Single nucleotide polymorphisms (SNPs) in several CYP genes have been associated with altered breast cancer (BC) risk in different populations. Despite this, there is a dearth of information on the roles of these SNPs in Jordanian BC patients. Therefore, this study aims to determine if there is any single nucleotide polymorphism (SNP) within CYP19A1, CYP2C19, CYP2C9, CYP1B1, CYP3A4, and CYP1A2 genes associated with BC in the Jordanian population. In addition, this work investigates the association between selected BC prognostic factors and variants of the aforementioned CYP candidate genes. METHODS: Blood samples were withdrawn from 221 BC patients and 218 healthy volunteers recruited from the Jordanian population. Genomic DNA was withdrawn and, after quantification and quality control, was genotyped using the Sequenom MassARRAY® system (iPLEX GOLD). Statistical analysis was then carried out to assess allelic and genotypic frequencies as well as genetic association between cases and controls. RESULTS: The CYP19A1 SNP rs7176005 (p < 0.0045) and the CYP1A2 SNP rs762551 (p = 0.004) were significantly associated with BC risk. However, no such association was found for the screened SNPs of the CYP2C9, CYP1B1, CYP2C19 and CYP3A4 genes. Regarding the prognostic factors of BC, several of the screened SNPs were associated with different pathological and clinical features. CONCLUSIONS: Certain CYP genes, particularly CYP19A1 and CYP1A2, were associated with BC risk and development in the Jordanian population.


Assuntos
Neoplasias da Mama/genética , Ciclofilinas/genética , Estudos de Associação Genética , Predisposição Genética para Doença/genética , Adulto , Idoso , Idoso de 80 Anos ou mais , Aromatase/genética , Estudos de Coortes , Citocromo P-450 CYP1A2/genética , Citocromo P-450 CYP1B1/genética , Citocromo P-450 CYP2C19/genética , Citocromo P-450 CYP2C9/genética , Citocromo P-450 CYP3A/genética , Feminino , Genótipo , Humanos , Jordânia , Pessoa de Meia-Idade , Polimorfismo de Nucleotídeo Único , Prognóstico , Risco , Adulto Jovem
11.
J Oncol ; 2019: 6425708, 2019.
Artigo em Inglês | MEDLINE | ID: mdl-31391850

RESUMO

Breast cancer pharmacogenetics is increasingly being explored due to chemotherapy resistance among certain classes of patients. The ATP binding cassette (ABC) transporter genes have been previously implicated in breast cancer progression and drug response. In the present study, single nucleotide polymorphisms (SNPs) from the ABCC1, ABCC2, ABCB1, and ABCG2 genes were screened in breast cancer patients and healthy volunteers from the Jordanian-Arab population. Only the ABCB1 SNPs showed a significant association with BC in Jordanian-Arab patients, and the ABCB1 SNP rs2032582 exhibited a strong genotypic association with BC. With regard to the clinical characteristics of BC, the ABCC2 SNPs rs2273697 and rs717620 were found to be significantly associated with age at breast cancer diagnosis and breastfeeding status, while the ABCB1 SNP rs1045642 was significantly associated with age at breast cancer diagnosis. In terms of pathological characteristics, the ABCC1 SNP rs35628 and the ABCB1 SNP rs2032582 were significantly associated with tumor size, the ABCC2 SNP rs2273697 was significantly associated with estrogen receptor status, and the ABCG2 SNP rs2231142 was significantly associated with axillary lymph node status. In this current study, we assume that significant genetic variants within the ABC superfamily may increase the risk of breast cancer among Jordanian women. Furthermore, these variants might be responsible for worse BC prognosis.

12.
BMC Cancer ; 19(1): 1257, 2019 Dec 30.
Artigo em Inglês | MEDLINE | ID: mdl-31888550

RESUMO

BACKGROUND: Breast cancer risk, development, and treatment are influenced by genetic variation in certain genes, namely those involved in cell proliferation, tumor suppression, and drug metabolism. In turn, the relevance of the aforementioned genetic variation to cancer depends on the ethnic group in question, highlighting the need for population-specific association studies. Therefore, the objective of the present study was to investigate the association between certain ESR1, ESR2, HER2, UGT1A4, and UGT2B7 single nucleotide polymorphisms and breast cancer. METHODS: Blood samples were collected from 437 Jordanian-Arab breast cancer patients and healthy volunteers and subject to genotyping using the Sequenom MassARRAY® system (iPLEX GOLD). RESULTS: Our findings show a significant association between breast cancer and the allelic (P = 0.02486879) and genotypic (P = 0.04793066) frequencies of the ESR1 polymorphism rs3798577, a result which was confirmed in different genetic models. No other investigated polymorphism showed a significant association with breast cancer itself in Jordanian Arabs, but the Rare Hz (GG) vs Het (AG) genetic model revealed an association of the disease with the ESR1 polymorphism rs3798577. However, several associations were found between certain polymorphisms and breast cancer's prognostic factors. CONCLUSION: This study suggests that certain polymorphisms may increase the risk of breast cancer in the Jordanian-Arab population. Future research and clinical translation could incorporate the current results in preventative breast cancer approaches tailored for Jordanian-Arab patients.


Assuntos
Neoplasias da Mama/genética , Receptor alfa de Estrogênio/genética , Receptor beta de Estrogênio/genética , Genótipo , Glucuronosiltransferase/genética , Receptor ErbB-2/genética , Árabes , Estudos de Casos e Controles , Feminino , Frequência do Gene , Estudos de Associação Genética , Predisposição Genética para Doença , Humanos , Jordânia , Polimorfismo de Nucleotídeo Único , Prognóstico
13.
Onco Targets Ther ; 12: 7923-7928, 2019.
Artigo em Inglês | MEDLINE | ID: mdl-31920325

RESUMO

PURPOSE: Breast cancer (BC) is a complex disease that is governed by several different environmental and inherited factors. There are many genes have been linked with BC development by screening specific genetic variants within these genes. In this study, we aim to investigate the correlation between Variable Number Tandem Repeat (VNTR) in XRCC5 gene and BC. MATERIALS AND METHODS: Polymerase Chain Reaction (PCR) and Gel electrophoresis were used to genotype the XRCC5 gene polymorphism in 200 cases with breast cancer and 200 healthy individuals. All participants were Jordanian women from Arab descents. Clinical and pathological characteristics for BC patients were summarized and categorized according to their medical records. RESULTS: In this study, we found a strong correlation between the VNTR polymorphism in the XRCC5 gene and BC risk (P-value<0.0001). Remarkably, three different genotypes (2R\2R, 3R\2R and 3R\3R) showed significant association with BC (P-value<0.0001). This study also reported a significant difference in the distribution of allele frequencies between BC patients and healthy individuals (3R; P-value<0.0001 and 2R; P-value<0.001). However, we propose that VNTR of XRCC5 gene did not interfere with BC prognosis. CONCLUSION: We speculate that the VNTR of XRCC5 gene may influence BC development. More investigations are needed in this regard to clarify the underlying role of the XRCC5 genetic variant in tumorgenesis including BC development.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA
...