Carcinoma vulva patterns of recurrence and treatment outcomes: A single-institution experience.

AIM: The aim of this study was to evaluate the patterns of recurrence and outcomes in patients with vulvar cancer treated with surgery, with or without postoperative radiotherapy (RT) or RT alone. MATERIALS AND METHODS: The hospital records were retrospectively analyzed from February 2007 to May 2016. All patients that had biopsy-proven carcinoma vulva were included for analysis. Surgery was done by simple or radical vulvectomy with or without lymph node dissection. Radical RT dose was 60 Gy (photons alone or with electron boost). Adjuvant RT was administered in case of node positivity or positive margins. RESULTS: A total of 76 patients were diagnosed as squamous cell carcinoma of vulva. The median age was 59 years. About 59 patients were treated by surgery and 17 patients were treated by radical RT. The most common stage was IB. Adjuvant RT was administered in 10 patients. About 13 patients (22%) underwent inguinal lymphadenectomy. At a median follow-up of 35 months, 49 patients (64.4%) were alive, 27 died, and 6 patients were lost to follow-up. Locoregional recurrence rate was 24.5% in radical surgery group, 12% in surgery plus adjuvant RT group, and 47% in radical RT group. Distant metastasis rate was 4%. The progression-free survival at 3 years was 45.3% and 35.5% in the surgery group and radical RT group, respectively. CONCLUSION: Surgery resulted in favorable local control rates in early-stage carcinoma vulva. Adjuvant RT is indicated in case of nodal positivity or positive margins. Radical RT can be considered as an alternative in patients with comorbidities.

Tuberculous Orbital Apex Syndrome with Severe Irreversible Visual Loss.

A 16-year-old girl presented with a unilateral red eye, progressive visual loss and diplopia. A detailed clinical assessment with appropriate investigations led to a diagnosis of Orbital Apex Syndrome (OAS) secondary to Tuberculosis (TB). We report this unusual case of TB OAS, which resulted in a poor visual outcome despite appropriate management.

Visual outcomes of pars plana vitrectomy with epiretinal membrane peel in patients with uveitis.

PURPOSE: To report the outcomes of pars plana vitrectomy with epiretinal membrane (ERM) peel, with or without internal limiting membrane peel, in patients with uveitis. METHODS: Retrospective interventional case series of patients undergoing pars plana vitrectomy with ERM peel between January 2005 and March 2012. Sixteen consecutive patients (16 eyes) were identified, with a minimum postoperative follow-up of 6 months. Visual acuity, anatomical outcomes, perioperative control of inflammation, and complications were assessed. RESULTS: The mean age at surgery was 47.3 years (range, 14-68 years), with a mean duration of ERM at surgery of 21.3 months (3-84 months). At 6 months, visual acuity improved in 31.25% of eyes, stabilized in 31.25%, and was worse in 37.5%. The causes of reduced visual acuity postoperatively included severe preexisting macular pathology and unoperated cataract. CONCLUSION: Pars plana vitrectomy with ERM peel in eyes with uveitis may improve or stabilize visual acuity, especially in eyes with macular traction, but in the absence of traction, outcomes are variable and unpredictable. Prevention of ERM formation by aggressive control of inflammation is important.

Repeatability of visual function measures in age-related macular degeneration.

PURPOSE: To assess repeatability of visual function measures in patients with early, intermediate or late age-related macular degeneration (AMD) without active neovascular disease in the study eye, but active neovascular AMD in the fellow eye. METHODS: One hundred subjects from an ongoing trial were screened for this study in which their LogMAR acuity, contrast sensitivity and reading performance were assessed using standardised protocols by trained optometrists. The same measures were repeated one month later and repeatability of the visual functions assessed. RESULTS: Data from 83 subjects satisfied inclusion criteria for analysis. Coefficient of repeatability was 14.9 letters for LogMAR visual acuity , 7.2 letters for Pelli Robson contrast sensitivity, 0.72 for LogMAR reading acuity, 110.4 words/ min for reading speed and 0.67 for LogMAR critical print size. Intraclass correlation coefficients allowed comparison between measures and were found to be 0.96 for LogMAR visual acuity, 0.93 for contrast sensitivity, 0.75 for LogMAR reading acuity, 0.79 for reading speed and 0.74 for LogMAR critical print size. Coefficients of variation were 9.4 %, 10.7 %, 48.4 %, 28.4 % and 31.8 % respectively. CONCLUSIONS: We found coefficients of repeatability that concurred with previous studies demonstrating variability of visual functions in patients with AMD. In addition, we found intraclass correlation coefficients to be better with visual acuity and contrast sensitivity than with measures of reading performance.

Myxoid lipoblastoma.

A rapidly growing soft tissue mass in the axilla of an infant raises the suspicion of a lipoblastoma or a liposarcoma. Excisional/incisional biopsy is vital in confirming the diagnosis and hence avoiding aggressive extirpation. This case report highlights the role of histopathology and immunohistochemistry as the gold standard in differentiating a lipoblastoma from a liposarcoma. In some cases where the histopathology is inconclusive, genetic rearrangement of the PLAG1 (pleomorphic adenoma gene 1) oncogene on chromosome 8q12 helps in confirming the diagnosis of lipoblastoma.

Role of reactive oxygen species and antioxidants in atopic dermatitis.

BACKGROUND: In humans, oxidative stress is involved in many diseases such as atherosclerosis, Parkinson's disease, heart failure, myocardial infarction, Alzheimer's disease, Fragile X syndrome and chronic fatigue syndrome. Atopic dermatitis (AD), also known as atopic eczema, is a non-contagious, relapsing inflammatory skin disease which is characterized by eczema and pruritus. The skin reacts abnormally to irritants, food and environmental allergens and it becomes very itchy, which leads to scratching, redness and flaky skin. Very little study has been done to find out the relationship between oxidative stress and Atopic dermatitis. AIM: The aim of our work was to evaluate the status of oxidative stress in patients of Atopic dermatitis in comparison with healthy control subjects. MATERIAL AND METHODS: Twenty five patients of known Atopic dermatitis and 25 normal healthy controls of same age group were included in the study. Estimations of oxidants like Malondialdehyde (MDA), enzymatic antioxidants like Superoxide dismutase (SOD), Catalase, Glutathione peroxidase (GPX) and non-enzymatic antioxidants like reduced Glutathione (GSH), Vitamin A, Vitamin E and Vitamin C were done to assess the oxidative stress. RESULTS: Atopic dermatitis patients were more prone to damage caused by Reactive Oxygen Species (ROS) or Oxidants, than controls, which was evident from an increase of Malondialdehyde and a decrease of enzymatic and non enzymatic Antioxidants. CONCLUSION: Antioxidants may possibly be beneficial in the treatment of Atopic dermatitis, which must be substantiated by further studies.

Role of rectal myomectomy in refractory chronic constipation.

BACKGROUND: To assess the role of diagnostic and therapeutic value of anorectal myectomy in cases of chronic refractory constipation. MATERIALS AND METHODS: Twenty-eight patients 11 months to 9 years of age presenting with chronic constipation, with contrast enema showing dilated rectum and sigmoid colon were included in the study. Anorectal myectomy under general anaesthesia was carried out in these selected patients and were followed-up for up to 6 months to 5 years. Clinical improvement was measured by post-operative bowel habits and relief of symptoms. RESULTS: Twenty-two patients improved clinically; partial response in 4 patients, no response in 2 patients. Two patient required further pull through surgery and was found to have transition zone at the recto-sigmoid level. Ten patients had aganglionosis (of which 5 had ganglion cells present in the proximal part of speciment), 7 had normal histology, 7 had hypoganglionosis, 2 had intestinal neuronal dysplasia, one had nerve hypertrophy and one had immature ganglia. CONCLUSION: Anorectal myectomy is an effective and technically simple procedure in selected patients with chronic refractory constipation, for both diagnostic and therapeutic purpose. Because apart from confirming Hirschsprung's disease, it also therapeutically relieves symptoms in 93% of patients with chronic refractory constipation.

Diphallus with anorectal malformation-case report.

Diphallus is a very rare condition. We report a case of a newborn with absent anal opening and duplication of external genitalia. Examination of the external genitalia showed two well formed penises with fully descended testis within each of the separate hemiscrotums along with soft tissue mass resembling accessory buttock behind the hemiscrotum. Staged reconstruction of duplicated genitalia and anorectal malformation was done. We achieved excellent cosmetic and functional external genitalia.

Molecular Detection of 16SrXI Group Phytoplasma Associated with Root (Wilt) Disease of Coconut (Cocos nucifera) in India.

Coconut palm (Cocos nucifera L.), a versatile tree crop with multifarious uses, is important for the livelihood security of millions of people in India. Root (wilt) disease (RWD) is a major production constraint causing an estimated yield loss of 968 million nuts in southern India. Affected palms show bending of leaflets (flaccidity), foliar yellowing, and marginal necrosis. Phytoplasmas have been observed to be associated with this disease by electron microscopy (EM) and transmission (3) but not characterized. Attempts made in the past decade to detect a phytoplasma associated with RWD through PCR using universal primers had inconsistent results so we designed two primer sets (1F7 [AGTGCTTAACACTGTCCTGCTA]/7R3 [TTGTAGCCCAGATCATAAGGGGCA], 3Fwd [ACCTGCCTTTAAGACGAGGA]/3Rev [AAAGGAGGTGATCCATCCCCACCT]) and seminested primer pair 1F7/7R2 (GACAAGGGTTGCGCTCGTTTT), 3Fwd/5Rev (ACCCCGAGAACGTATTCACCGCGA) from sequencing of a 1.8-kb fragment (GenBank No. FJ794816) amplified by primers P1/P7 from a diseased sample. These new primer pairs were used for the detection of phytoplasma from five symptomatic and five asymptomatic palms from Kasaragod (where disease is not endemic), 14 symptomatic palms from Kayamkulam (endemic area), and 10 palms from disease-free areas (Kidu, Karnataka) using PCR. DNA was extracted from 3 g of spindle leaf (two to three leaflets) midrib tissues using a modified phytoplasma enrichment protocol in which an addition of 5% polyvinylpolypyrrolidone (MW of 40,000) during tissue grinding was essential. PCR was performed for 35 cycles with an annealing temperature of 63°C to avoid nonspecific amplification. A 1.3-kb amplicon was seen in two of the five samples and the positive control sample (sugarcane grassy shoot DNA) using the seminested primer pair 3Fwd/3Rev-3Fwd/5Rev. The amplicons were cloned and sequenced and a representative sequence was deposited in GenBank (GQ850122). With the 1F7/7R3-1F7/7R2 seminested primers, a 493-bp product was obtained from 13 of 14 palms from Kayamkulam and all five diseased palms from Kasaragod. No amplification was seen from healthy palms. A BLAST search showed that the RWD phytoplasma 16S rRNA gene sequence has >96% nt identity with 16SrXI and 16SrXIV group phytoplasmas and 99% identity with sugarcane white leaf phytoplasma (AB052874), On the basis of the identity of the 16Sr RNA gene 3Fwd/5Rev region, RWD phytoplasma belongs to the 16SrXI group. A phylogenetic tree (neighbor-joining method) also revealed clustering of the coconut phytoplasma with the 16SrXI group phytoplasmas and virtual restriction fragment length polymorphism analysis (4) also placed it into group 16SrXI. Other phytoplasmas infecting coconut are found in groups 16SrIV (1) and 16SrXIV (2). Our RWD phytoplasma sequence does not match an earlier reported Kerala (wilt) coconut phytoplasma sequence (AY158660) and the latter sequence does not have similarity with any known phytoplasma sequences in the database. To our knowledge, this is first report of the association of 16SrXI group phytoplasma with the root wilt disease of coconut in India. These findings could be used for the early detection of root wilt disease phytoplasma in breeding materials and to develop a DNA-based diagnostic kit. References: (1) N. A. Harrison et al. Ann. Appl. Biol. 153:85, 2008. (2) N. Nejat et al. Am. J. Appl. Sci. 6:1331, 2009. (3) M. Sasikala et al. Eur. J. Plant Pathol. 94:191, 2005. (4) Y. Zhao et al. Int. J. Syst. Evol. Microbiol. 59:2582, 2007.

Isolated prostatic utricle.

Complete excision of a prostatic utricle through posterior sagittal rectum retracting approach is reported in an infant.