First Report of Rice yellow mottle virus in Rice in Federal Democratic Republic of Ethiopia.

Rice yellow mottle virus (RYMV, genus Sobemovirus) is a major biotic constraint to rice production in Africa. First reported in Kenya in 1966, RYMV was later found in most countries in Africa where rice (Oryza sativa, O. glaberrima) is grown (5). In the Federal Democratic Republic of Ethiopia, however, the disease has never been reported in rice fields. In September 2012, plants with leaf yellowing and mottling symptoms were observed near Bahir Dar and in the Fogera district in the northwestern part of the country during a joint survey of scientists from Madagascar (FOFIFA), Ethiopian Institute of Agricultural Research (EIAR), and Japan International Cooperation Agency (JICA). The disease was observed in 2013 in Fogera and Dera districts, where samples were collected, causing small patches of infected plants in ~5% of the fields. Symptomatic leaves of two plants collected in the fields were inoculated on five plants of the susceptible O. sativa cultivar IR64. All inoculated plants reproduced the typical yellow mottle symptoms. Symptomatic leaves of eight plants collected in the fields reacted positively when tested by double antibody sandwich (DAS)-ELISA tests with a polyclonal antiserum raised against a Madagascan isolate of RYMV (2), indicating for the first time the presence of the virus in Ethiopia. Triple antibody sandwich (TAS) tests with discriminant monoclonal antibodies (2) revealed that they all belonged to serotype 4, a serotype found in East Africa and in Madagascar. Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from four samples. The 720-bp coat protein (CP) gene was amplified with reverse transcription (RT)-PCR with the primers 5'CTCCCCCACCCATCCCGAGAATT3' and 5'CAAAGATGGCCAGGAA3' (3). The sequences were deposited in GenBank (Accession Nos. KMO17554, KMO14555, KMO17556, and KMO17557). The four sequences showed over 98% nucleotide identity between each other. They shared over 92% nucleotide identity with isolates of strains S4 found in Kenya, Uganda, Tanzania, and Madagascar (4). Agricultural changes associated to rice intensification are known to favor RYMV emergence and spread (5). Recent efforts have been led by the National Rice Research and Development Strategy (NRRDSE) to intensify rice cultivation in Ethiopia (1). Early knowledge of RYMV occurrence in the country is a prerequisite to extended surveys of the disease and implementation of control measures. References: (1) K. Assefa et al. Challenges and opportunities of rice in Ethiopian agricultural development. www.eiar.gov.et/Publications/frgseries2.pdf , 2011. (2) D. Fargette et al. Arch. Virol. 147:583, 2002. (3) A. Pinel et al. Arch. Virol. 145:1621, 2000. (4) M. Rakotomalala et al. Virus Res. 171:71, 2013. (5) O. Traoré et al. Virus Res. 141:258, 2009.

Late Quaternary climatic vegetational shifts in an ecological transition zone of northern Madagascar: insights from genetic analyses of two endemic rodent species.

The Loky-Manambato region, located in northern Madagascar, is a biotically rich contact zone between different forest biomes. Local current forest cover is composed of both humid and dry formations, which show elevational stratification. A recent phylogeographical study of a regional dry forest rodent, Eliurus carletoni (subfamily Nesomyinae), found genetic evidence of forest contractions between 18 750 and 7500 years BP, which based on extrapolation of the pollen subfossil record, was thought to be associated with an expansion of local humid forests. Herein, we conduct a genetic test of this hypothesis and focused on populations on two neighbouring massifs of forest-dependent rodent species, one associated with low-elevation dry forests (E. carletoni) and the other with higher elevation humid forests (Eliurus tanala). Using mitochondrial markers and a combination of traditional and coalescent-based phylogeographical, historical demographic and population genetic methods, we found evidence of historical connections between populations of E. tanala. Adjacent populations of E. carletoni and E. tanala exhibit opposite historical demographic patterns, and for both, evidence suggests that historical demographic events occurred within the last 25 000 years BP. These findings strongly support the proposed late Quaternary shifts in the floristic composition of the Loky-Manambato region.

[Thoracic myopericytoma in a child. A case report]. / Myopericytome à localisation thoracique chez l'enfant. A propos d'un cas.

Myopericytoma is a ubiquitous, benign tumor that is likely to be found in the muscular-cutaneous system. Symptoms are related to its location and to the mass effect it may cause on surrounding organs. Diagnosis is usually made by the pathologist and treatment is surgical. We report herein a rare thoracic location in a 4-year-old girl.