First reports of Beet curly top virus, Citrus yellow vein-associated virus, and Hop latent viroid in industrial hemp (Cannabis sativa) in Washington State.

In 2021 and 2022, virus-like symptoms were observed in several cultivars of industrial hemp (Cannabis sativa) in two fields in central Washington, USA. Affected plants had a range of symptoms at different developmental stages, with young plants having severe stunting with shortened internodes and reduced flower mass. Young leaves of infected plants also showed light green to total yellowing, and twirling with twisting margins (Fig. S1). Infections of older plants caused less foliar symptoms that consisted of mosaic, mottling, and mild chlorosis on a few branches with tacoing of older leaves. To assess if symptomatic hemp plants were infected with Beet curly top virus (BCTV) as reported earlier (Giladi et al., 2020; Chiginsky et al., 2021), symptomatic leaves were collected from 38 plants, and the extracted total nucleic acids tested by PCR to amplify a 496-base pair (bp) fragment specific to BCTV coat protein (CP) using primers BCTV2-F 5'-GTGGATCAATTTCCAG-ACAATTATC-3' and BCTV2-R 5'-CCCATAAGAGCCATATCA-AACTTC-3' (Strausbaugh et al. 2008). BCTV was found in 37 of the 38 plants. To further assess the virome of symptomatic hemp plants, total RNA was extracted from symptomatic leaves of four plants using Spectrum total RNA isolation kits (Sigma-Aldrich, St. Louis, MO) and subjected to high-throughput sequencing on an Illumina Novaseq platform in paired-end mode (University of Utah, Salt Lake City, UT). The raw reads (33 to 40 million per sample) were trimmed based on quality and ambiguity and resulting paired-end reads of ≈142 bp length were assembled de novo into a pool of contigs (CLC Genomics Workbench 21, Qiagen Inc.). Virus sequences were identified through BLASTn analysis in GenBank (https://www.ncbi.nlm.nih.gov/blast). One contig of 2,929 nucleotides (nt) obtained from one sample (accession no. OQ068391) showed 99.3% identity with BCTV-Wor strain reported from sugar beet in Idaho (accession no. KX867055 Strausbaugh et al., 2017). Another contig of 1,715 nt from a second sample (accession no. OQ068392) shared 97.3% identity with BCTV-CO strain (accession no. KX867022). Two contig sequences of 2,876 nt (accession no. OQ068388) and 1,399 nt (accession no. OQ068389) obtained from the 3rd and 4th samples showed 97.2% and 98.3% identity, respectively, with Citrus yellow vein-associated virus (CYVaV, accession no. MT893740.1) reported in industrial hemp from Colorado (Chiginsky et al., 2021). Contigs of 256 nt sequence (accession no. OQ068390) obtained from the 3rd and 4th samples also showed 99-100% identity with Hop Latent viroid (HLVd) sequences in GenBank (accessions OK143457 and X07397). These results indicated single infections of BCTV strains and co-infection of CYVaV and HLVd in individual plants. To confirm theagents, symptomatic leaves were collected from 28 randomly selected hemp plants and tested by PCR/RT-PCR using primers specific to BCTV (Strausbaugh et al., 2008), CYVaV (Kwon et al., 2021) and HLVd (Matousek et al., 2001). Amplicons specific to BCTV (496 bp), CYVaV (658 bp) and HLVd (256 bp) were detected in 28, 25, and 2 samples, respectively. BCTV CP sequences obtained by Sanger sequencing from seven samples showed 100% sequence identity with BCTV-CO and BCTV-Wor strains in six and one samples, respectively. Similarly, sequences of CYVaV- and HLVd-specific amplicons showed 100% identity with corresponding sequences in GenBank. To the best of our knowledge, this is the first report of two strains of BCTV (BCTV-CO and BCTV-Wor), CYVaV, and HLVd infecting industrial hemp in Washington state.

First report of Tobacco ringspot virus in highbush blueberry in Washington State.

Since 2015, several blueberry plants (Vaccinium corymbosum) of cvs. Draper and Top Shelf in an organic farm in eastern Washington State showed reduced growth with deformed leaves displaying chlorotic spots, rings, and red blotches and producing small and poorly ripened berries. The symptomatic plants showed gradual decline within 2 to 3 years post-planting. In ELISA using antibodies (Agdia, Inc., USA) to Blueberry leaf mottle virus, Cherry leaf roll virus, Peach rosette mosaic virus, Strawberry latent ringspot virus, Tomato black ring virus, Tomato ringspot virus, and Tobacco ringspot virus [TRSV]), leaf samples from six symptomatic plants tested positive only to TRSV (Secoviridae: Nepovirus). Subsequently, total RNA was isolated from leaves of a symptomatic plant using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, USA). High quality RNA was subjected to high-throughput sequencing (HTS) on the Illumina© NovaSeq™ platform (Huntsman Cancer Institute, UT, USA). An average of ~28 million 150-base pair (bp) paired-end reads obtained were subjected to quality filtering followed by de novo assembly using CLC Genomics Workbench (v12.0) and BLASTn analysis (http://www.ncbi.nlm.nih.gov/blast). Two contigs of 2,778 bp (average coverage: 11,031.7) and 3,589 bp (average coverage: 11,882) showed, respectively, a maximum of 97.3 and 97.6% nucleotide (nt) identity with TRSV RNA1 of a South Korean isolate (KJ556849). Another contig of 3,615 bp (average coverage: 7072.1) showed a maximum of 92.8% nt identity with TRSV RNA2 of an isolate from Iowa (MT563079). The HTS data revealed no other viral sequences reported from blueberry plants (Martin and Tzanetakis 2018). To further confirm the presence of TRSV, extracts of leaf samples from seven symptomatic and ten asymptomatic plants collected randomly from cvs. Draper and Top Shelf were tested by RT-PCR using primers specific to a region of the helicase gene of TRSV RNA1 (Forward: GACTACTGAGCAACATTGCAACTTCC, Reverse: GTCCCCTAACAGCATTGACTACC) and the coat protein gene of TRSV RNA2 (Forward: GCTGATTGGCAGTGTATTGTTAC, Reverse: GTGTTCGCATCTGGTTTCAAATTGG). An approximately 360 bp fragment specific to RNA1 and ~640 bp fragment specific to RNA2 were amplified only from symptomatic samples. Sanger sequence analysis of amplicons specific to RNA1 and RNA2 showed 98.1% and 96.8% nt identity with corresponding sequences of TRSV isolates from South Korea (KJ556849) and Iowa (MT563079), respectively. These results confirmed the presence of TRSV in symptomatic blueberry plants. The complete sequence of RNA1 (7,512 nt, MW495243) and RNA2 (3,925 nt, MW495244) genome segments of the blueberry isolate determined in this study showed 95.9 and 93.2% nt sequence identity, respectively, with corresponding TRSV sequences from South Korea (KJ556849) and Iowa (MT563079). Based on previous reports (Converse and Ramsdell 1982, Martin et al. 2012, Martin and Tzanetakis, 2018), this study represents the first report of TRSV infecting highbush blueberry in Washington State. Since the State has emerged as the national leader in blueberry production, the results will strengthen plant health certification standards to provide virus-tested propagative materials for domestic growers and export to the European Union.

First report of grapevine rupestris vein feathering virus in grapevines from Washington State.

Since the first report of grapevine rupestris vein feathering virus (GRVFV; genus Marafivirus, family Tymoviridae) in a Greek grapevine causing chlorotic discoloration of leaf veins (El Beaino et al., 2001), GRVFV was reported in some European countries, and in Australia, China, Korea, New Zealand, Uruguay, and Canada (Blouin et al., 2017; Cho et al., 2018; Reynard et al., 2017). In the USA, the virus was reported only from California in vines showing Syrah decline symptoms (Al Rwahnih et al., 2009). During virus surveys conducted between 2015 and 2019, 424 samples (petioles from individual or composite of five vines, with 4 petioles/vine) with and without discernible symptoms were collected randomly from 39 Vitis vinifera cultivars in vineyards and nurseries in eastern Washington State. Total RNA was isolated from these samples separately using SpectrumTM Plant Total RNA Kit (Sigma-Aldrich) and subjected individually to Illumina RNAseq (Huntsman Cancer Institute, Salt Lake City, UT). An average of ~28 million 120-base pair (bp) paired-end reads using HiSeq2500 platform and an average of ~18 million 145-bp paired-end reads using Novaseq 6000 platform were obtained per sample. The contigs from de novo assembly of quality-filtered reads from each sample (CLC Genomics workbench 12) were subjected to BLASTn analysis against the virus database from GenBank. In addition to grapevine viruses and viroids previously reported in Washington State, GRVFV-specific sequences were obtained in samples from 11 of the 39 cultivars; namely, Muscat Ottonel, Pinot gris and Sangiovese from vineyards and Aglianico, Bonarda, Cabernet Sauvignon, Chardonnay, Garnacha Tinta, Riesling, Tempranillo and Valdiguie from nurseries. BLASTn analysis of the 73 GRVFV-specific contigs, ranging in size between 500 nt and 6474 nt, showed sequence identity between 79.4% and 95.5% with GRVFV sequences deposited in GenBank. The data also revealed that GRVFV was always present as coinfection with one or more viruses and viroids (grapevine leafroll-associated virus 3, grapevine red blotch virus, grapevine virus A and B, grapevine rupestris stem pitting-associated virus, hop stunt viroid and grapevine yellow speckle viroid 1) making it difficult to correlate presence of the virus with specific symptoms. To confirm the presence of GRVFV, samples from cvs. Sangiovese (n = 45) and Pinot gris (n = 1) were tested by RT-PCR using custom designed primers SaF-215 (5'- TACAAGGTGAATTGCTCCACAC -3') and SaR-1027 (5'-TCATTGGCGATGCGTTCG-3') to amplify the 813 bp sequence covering partial replicase associated polyprotein region of the virus genome. Sanger sfour amplicons (MT782067-MT782070) showed identities from 86% (700 bp out of 813 bp) with an Australian isolate (MT084811.1) to 90.9% (738 bp out of 813 bp) with an isolate from New Zealand (MF000326.1). Additional studies are in progress to examine the etiology, genetic diversity and impact of GRVFV in Washington vineyards.

First Report of grapevine red globe virus in grapevines in Washington State.

Grapevine red globe virus (GRGV; genus Maculavirus, family Tymoviridae) has been reported in grapevines (Vitis spp.) from Italy, Greece, France, China, Spain and Germany and in California, U.S.A. (Sabanadzovic et al. 2000; Cretazzo et al. 2017; Fan et al. 2016; Ruiz-Garcia et al., 2018). During surveys of grapevine nurseries, a total of 241 composite samples, each consisting of four petioles from mature leaves/vine from five asymptomatic grapevines, from 33 grapevine (Vitis vinifera) cultivars were collected. Total RNA isolated from these samples using Spectrum Total RNA isolation kit (Sigma-Aldrich, St. Louis, MO) was subjected to high-throughput sequencing (HTS) on an Illumina HiSeq2500 or Novaseq 6000 platforms in paired-end mode (Genomics Core Facility, Huntsman Cancer Institute, Utah University, Salt Lake City, UT). After trimming raw reads based on quality and ambiguity, the paired-end quality reads of approximately 120 (HiSeq) or 145 (Novaseq) base pair (bp) length were assembled de novo into a pool of contigs (CLC Genomics workbench 12). These contigs were subjected to BLASTn analysis against the nonredundant virus database from GenBank (http://www.ncbi.nlm.nih.gov/blast). A total of 49 contig sequences, ranging from 200 to 1645 bp in length with an average coverage ranging up to 418.7, aligning with GRGV genome were detected in cvs. Aglianico, Cabernet franc, Pinot gris and Riesling. BLASTn analysis of contigs greater than 500 bp length showed sequence identity between 88.5% and 95% with corresponding GRGV sequences reported from other countries. These results indicated the presence of genetically distinct isolates of GRGV. HTS data also revealed coinfection of GRGV in all samples with one or more of the following virus and/or viroids: grapevine rupestris stem pitting associated virus, grapevine rupestris vein feathering virus, hop stunt viroid or grapevine yellow speckle viroid-1. To further confirm infection by GRGV, total RNA was extracted from two asymptomatic Pinot gris vines previously tested positive in HTS using Spectrum Total RNA isolation kit and subjected to reverse transcription-PCR using primers specific to the replicase polyprotein gene of the virus (RG4847F: 5'-TGGTCTGTTGTTCGCATCTT-3' and RG6076R: 5' CGGAAGGGGAAGCATTGATCT-3', Cretazzo et al., 2017). Sequence analysis of the approximately1,250 bp amplicons (accession number MT749359) showed 91.2 % nt sequence identity with corresponding sequence of GRGV isolate from Brazil (KX828704.1). To our knowledge, this is the first report of GRGV in Washington State. Together with the report of the occurrence of GRGV in California (Sabanadzovic et al. 2000), these/span> results indicate wide geographical distribution of the virus. Although GRGV can cause asymptomatic infections in grapevines (Martelli et al. 2002), the economic importance of GRGV as single or coinfections with other viruses needs to be examined to assess the potential significance of the virus to grape production and grapevine certification programs.