Molecular interactions and immune responses between Maize fine streak virus and the leafhopper vector Graminella nigrifrons through differential expression and RNA interference.

Graminella nigrifrons is the only known vector for Maize fine streak virus (MFSV). In this study, we used real-time quantitative PCR to compare the expression profiles of transcripts that putatively function in the insect immune response: four peptidoglycan recognition proteins (PGRP-SB1, -SD, -LC and LB), Toll, spaetzle, defensin, Dicer-2 (Dcr-2), Argonaut-2 (Ago-2) and Arsenic resistance protein 2 (Ars-2). Except for PGRP-LB and defensin, transcripts involved in humoral pathways were significantly suppressed in G. nigrifrons fed on MFSV-infected maize. The abundance of three RNA interference (RNAi) pathway transcripts (Dcr-2, Ago-2, Ars-2) was significantly lower in nontransmitting relative to transmitting G. nigrifrons. Injection with double-stranded RNA (dsRNA) encoding segments of the PGRP-LC and Dcr-2 transcripts effectively reduced transcript levels by 90 and 75% over 14 and 22 days, respectively. MFSV acquisition and transmission were not significantly affected by injection of either dsRNA. Knock-down of PGRP-LC resulted in significant mortality (greater than 90%) at 27 days postinjection, and resulted in more abnormal moults relative to those injected with Dcr-2 or control dsRNA. The use of RNAi to silence G. nigrifrons transcripts will facilitate the study of gene function and pathogen transmission, and may provide approaches for developing novel targets of RNAi-based pest control.

Viruses in maize and Johnsongrass in southern Ohio.

The two major U.S. maize viruses, Maize dwarf mosaic virus (MDMV) and Maize chlorotic dwarf virus (MCDV), emerged in southern Ohio and surrounding regions in the 1960s and caused significant losses. Planting resistant varieties and changing cultural practices has dramatically reduced virus impact in subsequent decades. Current information on the distribution, diversity, and impact of known and potential U.S. maize disease-causing viruses is lacking. To assess the current reservoir of viruses present at the sites of past disease emergence, we used a combination of serological testing and next-generation RNA sequencing approaches. Here, we report enzyme-linked immunosorbent assay and RNA-Seq data from samples collected over 2 years to assess the presence of viruses in cultivated maize and an important weedy reservoir, Johnsongrass (Sorghum halepense). Results revealed a persistent reservoir of MDMV and two strains of MCDV in Ohio Johnsongrass. We identified sequences of several other grass-infecting viruses and confirmed the presence of Wheat mosaic virus in Ohio maize. Together, these results provide important data for managing virus disease in field corn and sweet corn maize crops, and identifying potential future virus threats.

Wheat mosaic virus (WMoV), the Causal Agent of High Plains Disease, is Present in Ohio Wheat Fields.

High Plains disease was first described in wheat (Triticum aestivum) in Nebraska, Idaho, Texas, and other High Plains states in 1993 to 1994 (1). The causal agent is a negative sense RNA virus in the genus Emaravirus with at least three genome segments, which is transmitted by the wheat curl mite (Aceria tosichella Keifer) (2). This virus is variously referred to as High Plains virus (HPV), Maize red stripe virus (MRSV/MRStV), or Wheat mosaic virus (WMoV) in the literature. We adopt the name WMoV based on the latest recommendation (3). The presence of WMoV in Ohio was revealed through a comprehensive survey conducted in early spring 2012. Specifically, wheat plants exhibiting virus-like symptoms including chlorosis, reddening, stunting, spotting, or striping were collected from 27 wheat fields in 14 counties throughout Ohio, between March 20 and April 15, 2012. Total RNA was extracted from individual leaf samples, then pooled prior to ribosomal RNA removal and high throughput RNA-sequencing (RNA-Seq) using the Illumina HiSeq2000 platform (University of Illinois Biotechnology Center, Champaign-Urbana, IL). The resulting sequences were assembled and analyzed using CLC Genomics Workbench 5.5 software (CLC Bio, Cambridge, MA). One 983-nt contig was 99% identical to the nucleocapsid protein (NP)-coding RNA segment of WMoV (GenBank Accession DQ324466). We used reverse transcription (RT)-PCR to determine the distribution of WMoV in individual samples using WMoV-specific primers: WMoV NPf1 (TGCTATGTCATTGTTCAGGTGGTC), and WMoV NPr1 (TTAGGCAGTCCTTGATTGTGCTG). WMoV was identified in one sample each from Miami, Auglaize, and Paulding Counties, which are all in western Ohio. The WMoV-positive plants were chlorotic, with varying degrees of stunting and leaf striping. The presence of WMoV in the three samples was confirmed using protein A sandwich (PAS)-ELISA with WMoV-specific antiserum. Vascular puncture inoculation (VPI) (4) was used to inoculate germinating maize seed (cv. Spirit) with the extracts from the WMoV-positive samples. WMoV was detected in two of 378 surviving inoculated plants by RT-PCR and PAS-ELISA. These two WMoV-positive maize plants developed flecking mosaic symptoms on upper uninoculated leaves, consistent with reported WMoV symptoms. The WMoV-positive sample from Auglaize County also contained Wheat streak mosaic virus (WSMV), and 60 of the 120 surviving plants inoculated with this sample were positive for WSMV. This result suggests that, even with VPI, mechanical transmission of WMoV remains a great challenge. To our knowledge, this is the first report of WMoV in Ohio, and demonstrates that WMoV is more widespread than previously thought, reaching at least the eastern edge of the Midwest wheat production region. The expanding distribution of this emerging virus is significant because of its potential to cause additional yield losses in wheat. References: (1) S. G. Jensen et al. Plant Dis. 80:1387, 1996. (2) N. Mielke-Ehred and H.-P. Muhlbach. Viruses 4:1515, 2012. (3) J. M. Skare et al. Virology 347:343, 2006. (4) R. Louie et al. J. Virol. Methods 135:214, 2006.

Complete sequence and development of a full-length infectious clone of an Ohio isolate of Maize dwarf mosaic virus (MDMV).

Maize dwarf mosaic virus (MDMV) is an important and widespread aphid-transmitted virus of maize. It is a member of the genus Potyvirus in the family Potyviridae with a monopartite (+) ssRNA genome. Here we report the complete genome sequence and construction and testing of infectious clones of an Ohio isolate of MDMV. Full-length MDMV cDNA was cloned into the vector pSPORT. Full-length cDNA PCR-amplified from the vector constructs were used as template for in vitro transcription, and transcripts were inoculated to maize seeds by vascular puncture inoculation. Plants inoculated by this procedure showed symptoms typical of MDMV infection, and infection was confirmed by RT-PCR and mechanical transmission to new plants.

First Report of Maize chlorotic mottle virus and Maize Lethal Necrosis in Kenya.

In September 2011, a high incidence of a new maize (Zea mays L.) disease was reported at lower elevations (1,900 m asl) in the Longisa division of Bomet County, Southern Rift Valley, Kenya. The disease later spread to the Narok South and North and Naivasha Districts. By March 2012, the disease was reported at up to 2,100 m asl. Diseased plants had symptoms characteristic of virus diseases: a chlorotic mottle on leaves, developing from the base of young whorl leaves upward to the leaf tips; mild to severe leaf mottling; and necrosis developing from leaf margins to the mid-rib. Necrosis of young leaves led to a "dead heart" symptom, and plant death. Severely affected plants had small cobs with little or no grain set. Plants frequently died before tasseling. All maize varieties grown in the affected areas had similar symptoms. In these regions, maize is grown continuously throughout the year, with the main planting season starting in November. Maize streak virus was present, but incidence was low (data not shown). Infected plants were distributed throughout affected fields, with heavier infection along field edges. High thrips (Frankliniella williamsi Hood) populations were present in sampled fields, but populations of other potential disease vectors, such as aphids and leafhoppers, were low. Because of the high thrips populations and foliar symptoms, symptomatic plants were tested for the presence of Maize chlorotic mottle virus (MCMV) (3) using tissue blot immunoassay (TBIA) (1). Of 17 symptomatic leaf samples from each Bomet and Naivasha, nine from Bomet and all 17 from Naivasha were positive for MCMV. However, the observed symptoms were more severe than commonly associated with MCMV, suggesting the presence of maize lethal necrosis (MLN), a disease that results from maize infection with both MCMV and a potyvirus (4). Therefore, samples were tested for the presence of Sugarcane mosaic virus (SCMV), which is present in Kenya (2). Twenty-seven samples were positive for SCMV by TBIA, and 23 of 34 samples were infected with both viruses. Virus identities were verified with reverse-transcription (RT)-PCR (Access RT-PCR, Promega) and MCMV or SCMV-specific primers. MCMV primers (2681F: 5'-ATGAGAGCAGTTGGGGAATGCG and 3226R: 5'-CGAATCTACACACACACACTCCAGC) amplified the expected 550-bp product from three leaf samples. Amplicon sequences were identical, and had 95 to 98% identity with MCMV sequences in GenBank. SCMV primers (8679F: 5'-GCAATGTCGAAGAAAATGCG) and 9595R: 5'-GTCTCTCACCAAGAGACTCGCAGC) amplified the expected 900-bp product from four leaf samples. Amplicon sequences had 96 to 98% identity, and were 88 to 96% identical with SCMV sequences in GenBank. To our knowledge, this is the first report of MCMV and of maize coinfection with MCMV and SCMV associated with MLN in Kenya and Africa. MLN is a serious threat to farmers in the affected areas, who are experiencing extensive to complete crop loss. References: (1) P. G. S. Chang et al. J. Virol. Meth. 171:345, 2011. (2) Delgadillo Sanchez et al. Rev. Mex. Fitopat. 5:21, 1987. (3) Jiang et al., Crop Prot. 11:248, 1992. (4) R. Louie, Plant Dis. 64:944, 1980.

Characterization and Distribution of a Potyvirus Associated with Passion Fruit Woodiness Disease in Uganda.

This article describes the incidence and etiology of a viral disease of passion fruit in Uganda. Symptoms, including those characteristic of passion fruit woodiness disease (PWD), were observed on 32% of plants in producing areas. Electron microscopic observations of infected tissues revealed flexuous filaments of ca. 780 nm. Enzymelinked immunosorbent assays indicated a serological relationship with Cowpea aphid-borne mosaic virus (CABMV) and Passion fruit ringspot virus (PFRSV). In host range studies, only species in the families Solanaceae and Chenopodiaceae were susceptible, and neither Vigna unguiculata nor Phaseolus vulgaris became infected. Coat protein (CP) gene sequences of eight isolates exhibited features typical of potyviruses and were highly similar (88 to 100% identity). However, the sequences had limited sequence identity with CP genes of two of the three potyviruses reported to cause PWD: East Asian Passiflora virus and Passion fruit woodiness virus (PWV). Deduced amino acid sequences for the CP of isolates from Uganda had highest identity with Bean common mosaic necrosis virus (BCMNV) (72 to 79%, with evolutionary divergence values between 0.17 and 0.19) and CABMV (73 to 76%, with divergence values between 0.21 and 0.25). Based on these results and in accordance with International Committee for Taxonomy of Viruses criteria for species demarcation in the family Potyviridae, we conclude that a previously unreported virus causes viral diseases on passion fruit in Uganda. The name "Ugandan Passiflora virus" is proposed for this virus.

Stolbur phytoplasma transmission to maize by Reptalus panzeri and the disease cycle of maize redness in Serbia.

Maize redness (MR), induced by stolbur phytoplasma ('Candidatus Phytoplasma solani', subgroup 16SrXII-A), is characterized by midrib, leaf, and stalk reddening and abnormal ear development. MR has been reported from Serbia, Romania, and Bulgaria for 50 years, and recent epiphytotics reduced yields by 40 to 90% in South Banat District, Serbia. Potential vectors including leafhoppers and planthoppers in the order Hemiptera, suborder Auchenorrhyncha, were surveyed in MR-affected and low-MR-incidence fields, and 33 different species were identified. Only Reptalus panzeri populations displayed characteristics of a major MR vector. More R. panzeri individuals were present in MR-affected versus low-MR fields, higher populations were observed in maize plots than in field border areas, and peak population levels preceded the appearance of MR in late July. Stolbur phytoplasma was detected in 17% of R. panzeri adults using nested polymerase chain reaction but not in any other insects tested. Higher populations of R. panzeri nymphs were found on maize, Johnsongrass (Sorghum halepense), and wheat (Triticum aestivum) roots. Stolbur phytoplasma was detected in roots of these three plant species, as well as in R. panzeri L(3) and L(5) nymphs. When stolbur phytoplasma-infected R. panzeri L(3) nymphs were introduced into insect-free mesh cages containing healthy maize and wheat plants, 89 and 7%, respectively, became infected. These results suggest that the MR disease cycle in South Banat involves mid-July transmission of stolbur phytoplasma to maize by infected adult R. panzeri. The adult R. panzeri lay eggs on infected maize roots, and nymphs living on these roots acquire the phytoplasma from infected maize. The nymphs overwinter on the roots of wheat planted into maize fields in the autumn, allowing emergence of phytoplasma-infected vectors the following July.

The Mdm1 Locus and Maize Resistance to Maize dwarf mosaic virus.

Previously, Mdm1, a gene controlling resistance to Maize dwarf mosaic virus (MDMV), was identified in the inbred line Pa405. The gene was tightly linked to the restriction fragment length polymorphism marker umc85 on the short arm of chromosome 6. This chromosomal region is also the location of resistance genes to two other viruses in the family Potyviridae, Sugarcane mosaic virus (SCMV) and Wheat streak mosaic virus (WSMV). A diverse collection of 115 maize inbred lines was evaluated for resistance to MDMV and SCMV, and for MDMV resistance loci on chromosome 6S. Forty-six resistant inbred lines were crossed to three MDMVsusceptible inbred lines to develop F2 populations. The F2 populations were inoculated with MDMV and scored for infection and symptom type. Environmental factors influenced both the rate and type of symptom development. Bulked segregant analysis of each F2 population indicated that, in 42 of 43 MDMV-resistant lines, chromosome 6S markers found in the resistant parent also were present in the bulked resistant but not the susceptible tissue. Markers previously associated with resistance to both SCMV and WSMV on chromosome 3 and to WSMV on chromosome 10 were associated with resistance in nine and seven of the F2 populations, respectively. These data suggest that Mdm1 or closely linked genes on chromosome 6S are associated with MDMV resistance in most germplasm, but that other loci also may affect resistance.

Plant rhabdoviruses.

This chapter provides an overview of plant rhabdovirus structure and taxonomy, genome structure, protein function, and insect and plant infection. It is focused on recent research and unique aspects of rhabdovirus biology. Plant rhabdoviruses are transmitted by aphid, leafhopper or planthopper vectors, and the viruses replicate in both their insect and plant hosts. The two plant rhabdovirus genera, Nucleorhabdovirus and Cytorhabdovirus, can be distinguished on the basis of their intracellular site of morphogenesis in plant cells. All plant rhabdoviruses carry analogs of the five core genes: the nucleocapsid (N), phosphoprotein (P), matrix (M), glycoprotein (G) and large or polymerase (L). However, compared to vesiculoviruses that are composed of the five core genes, all plant rhabdoviruses encode more than these five genes, at least one of which is inserted between the P and M genes in the rhabdoviral genome. Interestingly, while these extra genes are not similar among plant rhabdoviruses, two encode proteins with similarity to the 30K superfamily of plant virus movement proteins. Analysis of nucleorhabdoviral protein sequences revealed nuclear localization signals for the N, P, M and L proteins, consistent with virus replication and morphogenesis of these viruses in the nucleus. Plant and insect factors that limit virus infection and transmission are discussed.

Transmission of Maize streak virus by vascular puncture inoculation with unit-length genomic DNA.

The infectivity of cloned unit-length genomes of Maize streak virus (MSV) was tested using vascular puncture inoculation (VPI). VPI of kernels with plasmid DNA (pUC19) carrying a tandem repeat of the MSV genome produced 33+/-8% infection. Similar plasmids carrying the unit-length MSV genome were not infectious. If the MSV genome was released from the plasmid prior to VPI, 16+/-4% of plants became infected. Ligation of the free linear MSV genome did not increase infectivity. The three infective inocula produced symptoms of similar severity in maize. Bioassay of systemically infected leaves indicated the virus was equally infectious regardless of inoculum. In Southern blots of bioassay plants, no differences in MSV genome restriction endonuclease sites were observed. Thus, inoculation with the free linear or circularized MSV unit-length genome produced infections similar to those with plasmids carrying tandemly repeated genomes. The infectivity of free linear MSV unit-length genomes will facilitate molecular analysis of MSV, because cloning steps are minimized.

Maize fine streak virus, a New Leafhopper-Transmitted Rhabdovirus.

ABSTRACT A previously uncharacterized virus was isolated from fall-planted sweet corn (Zea mays L., Syngenta GSS 0966) leaves showing fine chlorotic streaks. Symptomatic plants were negative in enzyme-linked immunosorbent assay against many maize viruses, but reacted weakly with antisera to Sorghum stunt mosaic virus suggesting a distant relationship between the viruses. The virus was readily transmitted by vascular puncture inoculation (VPI), but not by leaf-rub inoculation. Symptoms on maize included dwarfing and fine chlorotic streaks along intermediate and small veins that developed 12 to 17 days post-VPI. The isolated virus was bacilliform (231 +/- 5 nm long and 71 +/- 2 nm wide), with a knobby surface, and obvious helical structure typical of rhabdovirus morphology. Nucleorhabdovirus virions were observed by transmission electron microscopy of infected maize leaf tissue sections. Proteins unique to infected plants were observed in extracts of infected leaves, and the isolated virion contained three proteins with molecular masses 82 +/- 2, 50 +/- 3, and 32 +/- 2 kDa. Preliminary sequence analysis indicated the virus had similarity to members of the family Rhabdoviridae. The virus was transmitted by Graminella nigrifrons under persistent conditions. The data indicate the virus, provisionally designated Maize fine streak virus, is a new species in the genus Nucleorhabdovirus.

Transmission of viral RNA and DNA to maize kernels by vascular puncture inoculation.

Vascular puncture inoculation (VPI) is an effective technique for transmission of maize viruses without using arthropods or other biological vectors. It involves using a jeweler's engraving tool to push minuten pins through a droplet of virus inoculum toward the major vascular bundle in the scutellum of germinating kernels. Here, VPI is shown to be useful for introducing RNA and DNA viral genomes into maize. Maize dwarf mosaic potyvirus (MDMV) virions, MDMV genomic RNA, foxtail mosaic potexvirus (FoMV) genomic RNA and maize streak geminivirus (MSV) DNA were introduced into kernels by VPI, and infection rates determined. At high concentrations, both MDMV virion and genomic RNA preparations produced 100% infection of susceptible maize. However, MDMV genomic RNA was transmitted with about 100-fold lower efficiency than virions. FoMV genomic RNA and MSV DNA were transmitted at lower efficiency than the MDMV RNA, and the highest transmission rates were about 50%. Ribonuclease A pretreatment prevented genomic MDMV and FoMV RNA transmission, but not MDMV virion transmission indicating the viral RNA was the infectious entity. Proteinase K (ProK) pretreatment reduced transmission of MDMV RNA suggesting that integrity of the viral genomic protein bound covalently to the viral RNA may be important for efficient transmission.

Ubiquity of the St chloroplast genome in St-containing Triticeae polyploids.

Interspecific hybridization occurs between Tritceae species in the grass family (Poaceae) giving rise to allopolyploid species. To examine bias in cytoplasmic DNA inheritance in these hybridizations, the sequence of the 3' end of the chloroplast ndhF gene was compared among 29 allopolyploid Triticeae species containing the St nuclear genome in combination with the H, I, Ns, P, W, Y, and Xm nuclear genomes. These ndhF sequences were also compared with those from diploid or allotetraploid Triticeae species having the H, I, Ns, P, W, St, and Xm genomes. The cpDNA sequences were highly similar among diploid, allotetraploid, allohexaploid, and allooctoploid Triticeae accessions containing the St nuclear genome, with 0-6-nucleotide (nt) substitutions (0-0.8%) occurring between pairs of species. Neighbor-joining analysis of the sequences showed that the ndhF DNA sequences from species containing the St nuclear genome formed a strongly supported clade. The data indicated a strong preference for cpDNA inheritance from the St nuclear genome-containing parent in hybridizations between Triticeae species. This preference was independent of the presence of the H, I, Ns, P, W, and Xm nuclear genomes, the geographic distribution of the species, and the mode of reproduction. The data suggests that hybridizations having the St-containing parent as the female may be more successful.

Maize necrotic streak virus, a New Maize Virus with Similarity to Species of the Family Tombusviridae.

A new virus was isolated from maize (Zea mays L.) leaves showing mild mosaic symptoms and coinfected with Maize dwarf mosaic virus. The virus was readily transmitted by vascular puncture inoculation (VPI) but not leaf-rub inoculation. Virus symptoms on susceptible maize included pale green, yellow, or cream-colored spots and streaks measuring 1 to 2 mm on emerging leaves 5 to 7 days post-VPI. As leaves developed, the spots and streaks became spindle-shaped, then coalesced into long, chlorotic bands. These bands became translucent and necrotic around the edges. There was a distinctive chlorosis on the stalks that became necrotic. Based on these distinctive symptoms, the new virus was named Maize necrotic streak virus (MNeSV). The virus was not transmitted by Aphis maidis-radicus, Myzus persicae, Macrosiphum euphorbiae, Rhopalosiphum padi, Dalbulus maidis, Graminella nigrifrons, Perigrinus maidis, or Diabrotica virgifera virgifera under persistent or nonpersistent conditions. Both susceptible and resistant maize genotypes were identified following VPI with MNeSV. The isolated virus had isometric (32 nm) virions and a single 29.5-kDa coat protein. MNeSV was serologically distinct from morphologically similar maize viruses. The 4.3-kb single-stranded RNA genome had 25 to 53% sequence identity with species in the family Tombusviridae.

Regulation of Maize Leaf Nitrate Reductase Activity Involves Both Gene Expression and Protein Phosphorylation.

Nitrate reductase (NR; EC 1.6.6.1) activity increased at the beginning of the photoperiod in mature green maize (Zea mays L.) leaves as a result of increased enzyme protein level and protein dephosphorylation. In vitro experiments suggested that phosphorylation of maize leaf NR affected sensitivity to Mg2+ inhibition, as shown previously in spinach. When excised leaves were fed 32P-labeled inorganic phosphate, NR was phosphorylated on seryl residues in both the light and dark. Tryptic peptide mapping of NR labeled in vivo indicated three major 32P-phosphopeptide fragments, and labeling of all three was reduced when leaves were illuminated. Maize leaf NR mRNA levels that were low at the end of the dark period peaked within 2 h in the light and decreased thereafter, and NR activity generally remained high. It appears that light signals, rather than an endogenous rhythm, account primarily for diurnal variations in NR mRNA levels. Overall, regulation of NR activity in mature maize leaves in response to light signals appears to involve control of gene expression, enzyme protein synthesis, and reversible protein phosphorylation.

Identification of a maize root transcript expressed in the primary response to nitrate: characterization of a cDNA with homology to ferredoxin-NADP+ oxidoreductase.

To more fully understand the biochemical and molecular events which occur in plants exposed to nitrate, cDNAs whose accumulation was enhanced in nitrate- and cycloheximide-treated maize (Zea mays L. W64A x W182E) roots were isolated. The 340 bp Zmrprn1 (for Zea mays root primary response to nitrate) cDNA also hybridized with a probe enriched for nitrate-induced sequences, and was characterized further. Sequence analysis of a near full-length cDNA (Zmrprn1A) showed strong homology (> 90% amino acid identity) with a root ferredoxin-NADP+ oxidoreductase (FNR) of rice, and 45-50% amino acid identify with leaf FNR genes. When expressed in Escherichia coli, the Zmrprn1A cDNA produced a protein with NADPH: ferricyanide reductase activity, consistent with the enzymatic properties of an FNR. The Zmrprn1 cDNA hybridized with a 1.4 kb transcript which was expressed in the maize root primary response to nitrate. That is, mRNA levels in roots increased rapidly and transiently in response to external nitrate, and low levels of nitrate (10 microM) induced transcript accumulation. The accumulation of the Zmrprn1 transcript was not prevented by cycloheximide, indicating that the cellular factor(s) required for expression were constitutively present in maize roots. The Zmrprn1 mRNA accumulated specifically in response to nitrate, since neither K+ nor NH4+ treatment of roots caused transcript accumulation. Maize leaves had about 5% of the transcript level found in roots, indicating a strong preference for expression of Zmrprn1 in roots. Analysis of maize genomic DNA indicated the presence of only a single gene or very small gene family for the Zmrprn1. Together, the data indicate that Zmrprn1A encodes a nitrate regulated maize root FNR.

Glutamine Synthetase and Ferredoxin-Dependent Glutamate Synthase Expression in the Maize (Zea mays) Root Primary Response to Nitrate (Evidence for an Organ-Specific Response).

To define further the early, or primary, events that occur in maize (Zea mays) seedlings exposed to NO3-, accumulation of chloroplast glutamine synthetase (GS2; EC 6.3.1.2) and ferredoxin-dependent glutamate synthase (Fd-GOGAT; EC 1.4.7.1), transcripts were examined in roots and leaves. In roots, NO3- treatment caused a rapid (within 30 min), transient, and cycloheximide-independent accumulation of GS2 and Fd-GOGAT transcripts. In addition, 10 [mu]M external NO3- was sufficient to cause transcript accumulation. The induction was NO3- specific, since NH4Cl treatment did not affect mRNA levels. GS2 and Fd-GOGAT mRNA accumulation in roots was similar to that observed for nitrate reductase (NR) mRNA. Therefore, the four genes involved in NO3- assimilation (NR, nitrite reductase, GS2, and Fd-GOGAT) are expressed in the root primary response to NO3-, suggesting that all four genes can respond to the same signal transduction system. In contrast, relatively high levels of GS2 and Fd-GOGAT mRNAs were present in untreated leaf tissue, and NO3- treatment had little or no influence on transcript accumulation. Rapid, transient, and cycloheximide-independent NR mRNA expression was seen in the NO3--treated leaves, demonstrating that NO3- was not limiting. The NO3--independent constitutive expression of GS2 and Fd-GOGAT is likely due to the requirement for reassimilation of photorespiratory NH4+ in these young leaves.

Localization of Nitrate Absorption and Translocation within Morphological Regions of the Corn Root.

The absorption of NO(3) (-) was characterized in six regions of a 7-d-old corn root (Zea mays L. cv W64A x W182E) growing in a complete nutrient solution. Based on changing rates of (15)N accumulation during 15-min time courses, translocation of the concurrently absorbed N through each region of the intact root was calculated and distinguished from direct absorption from the medium. Of the (15)N accumulated in the 5-mm root tip after 15 min, less than 15 and 35% had been absorbed directly from the external solution at 0.1 and 10 mm NO(3) (-) concentration of the external solution, respectively. The characterization of the apical portion of the primary root as a sink for concurrently absorbed N was conconfirmed in a pulse-chase experiment that showed an 81% increase of (15)N in the 5-mm root tip during a 12-min chase (subsequent to a 6-min labeling period). The lateral roots alone accounted for 60% of root influx and 70% of 15-min whole root (15)N accumulation at either 0.1 or 10 mm. NO(3) (-) concentration of the external solution. Because relatively steady rates of (15)N accumulation in the shoot were reached after 6 min, the rapidly exchanging pools in lateral roots must have been involved in supplying (15)N to the shoot. The laterals and the basal primary root also showed large decreases (24 and 17%) in (15)N during the chase experiment, confirming their role in rapid translocation.

Comparative studies of the light modulation of nitrate reductase and sucrose-phosphate synthase activities in spinach leaves.

We recently obtained evidence that the activity of spinach (Spinacia oleracea L.) leaf nitrate reductase (NR) responds rapidly and reversibly to light/dark transitions by a mechanism that is strongly correlated with protein phosphorylation. Phosphorylation of the NR protein appears to increase sensitivity to Mg(2+) inhibition, without affecting activity in the absence of Mg(2+). In the present study, we have compared the light/dark modulation of sucrose-phosphate synthase (SPS), also known to be regulated by protein phosphorylation, and NR activities (assayed with and without Mg(2+)) in spinach leaves. There appears to be a physiological role for both enzymes in mature source leaves (production of sucrose and amino acids for export), whereas NR is also present and activated by light in immature sink leaves. In mature leaves, there are significant diurnal changes in SPS and NR activities (assayed under selective conditions where phosphorylation status affects enzyme activity) during a normal day/night cycle. With both enzymes, activities are highest in the morning and decline as the photoperiod progresses. For SPS, diurnal changes are largely the result of phosphorylation/dephosphorylation, whereas with NR, the covalent modification is super-imposed on changes in the level of NR protein. Accumulation of end products of photosynthesis in excised illuminated leaves increased maximum NR activity, reduced its sensitivity of Mg(2+) inhibition, and prevented the decline in activity with time in the light seen with attached leaves. In contrast, SPS was rapidly inactivated in excised leaves. Overall, NR and SPS share many common features of control but are not identical in terms of regulation in situ.