European Sero-Epidemiology Network: standardisation of the assay results for pertussis.

A standardisation process was developed in order to compare and harmonize serological results of pertussis toxin (PT) antibody measurements performed by laboratories using different technical procedures for detection. This involved the development of a common panel, of sera by a designed reference centre, the distribution of the panel to each participating laboratory for testing with their routine methods, the comparison of the obtained results to those of the reference centre, and the calculation of standardisation equations by regressing the quantitative results against those of the reference centre. As a cut-off indicative of protection against pertussis has not yet been defined, a particular emphasis was laid upon achieving standardisation of high titre results that would allow epidemiological evaluations based on the estimation of the incidence of recent infections rather than on the traditional approach of determining the population immunity profile. A generally good agreement was achieved between the participating laboratories, all using ELISA procedures very similar in many crucial aspects, and standardisation equations were produced useful to enable inter-country comparison during the next stages of the European Sero-Epidemiology Network (ESEN) project concerning the serological surveillance of immunity to pertussis in Europe.

How to make sense of pertussis immunogenicity data.

Studies on serologic correlates to protection in pertussis were reviewed. Trials in the 1950s showed that agglutinogen titers correlated to protection of whole-cell vaccines, but postvaccination antibodies against pertussis toxin (PT) and against filamentous hemagglutinin did not in a later trial of acellular vaccines. However, in household studies nested in 2 recent trials, preexposure antibody levels against pertactin and against fimbriae correlated with protection against typical and mild pertussis, and anti-PT correlated only with protection against typical pertussis. These findings could be used by regulatory agencies to license pertussis vaccines. A reference laboratory for pertussis should distribute panels to control interlaboratory variation in recommended assays, and a minimal response should be set for each pertussis antigen. We conclude that 2 studies have shown correlates between measurable anti-pertactin, anti-fimbriae, and anti-PT antibody levels at exposure and individual protection against pertussis. We suggest that postvaccination response rates may be used as surrogate markers of protection.

Polymorphism in the pertussis toxin promoter region affecting the DNA-based diagnosis of Bordetella infection.

The pertussis toxin (PT) promoter region is a frequently used target for DNA-based diagnosis of pertussis and parapertussis infections. The reported polymorphism in this region has also allowed discrimination of species in mixtures with several Bordetella species by their specific PCR amplicon restriction patterns. In the present study, we investigated the degree of polymorphism in order to confirm the reliability of the assay. Five different sequence types of the amplified 239- or 249-bp region were found among the 33 Bordetella pertussis, B. parapertussis, and B. bronchiseptica American Type Culture Collection reference strains and patient isolates analyzed. According to the sequences that were obtained and according to the PT promoter sequences already available in the databases, restriction enzyme analysis with TaqI, BglI, and HaeII, which gave four different patterns, can be performed to reliably identify B. pertussis, B. parapertussis, and B. bronchiseptica.

Analysis of incidence of infection with enterotoxigenic Escherichia coli in a prospective cohort study of infant diarrhea in Nicaragua.

Diarrheal episodes with enterotoxigenic Escherichia coli (ETEC) were prospectively monitored during the first 2 years of life in a cohort of 235 infants from Leon, Nicaragua. ETEC was an etiological finding in 38% (310 of 808) of diarrheal episodes and in 19% (277 of 1,472) of samples taken as asymptomatic controls at defined age intervals (P = <0.0001). The majority of diarrheal episodes (80%) occurred before 12 months of age. The major ETEC type was characterized by colonization factor CFA I and elaboration of both heat-labile enterotoxin and heat-stable enterotoxin (ST). The proportion of E. coli strains with CFA I was significantly higher in cases with diarrhea (P = 0.002). The second most prevalent type showed putative colonization factor PCFO166 and production of ST. The prevalence of PCFO166 was approximately 20%, higher than reported before. Children with a first CFA I episode contracted a second ETEC CFA I infection 24% of the time, compared with 46% for ETEC strains of any subtype. Most of the ETEC episodes were of moderate severity, and only 5% (15 of 310) were characterized as severe. In conclusion, our results give valuable information for the planning of intervention studies using ETEC vaccines.

Diagnostic polymerase chain reaction.

In this overview, the PCR sensitivities and specificities for diagnosis of B. pertussis in seven different pertussis vaccine studies are discussed. The performance sensitivity of the PCR methods ranged from < or = 1 to 10 cfu, and the diagnostic sensitivity from 73 to 100% when culture was used as a reference. The proportional increase in cases by positive PCR among culture-negatives ranged from 71 to 293% (four trials), whereas the gain was 6 to 11% among culture and serology-negatives (two trials). As the triggers for collecting nasopharyngeal samples, the selection of samples for PCR analysis, and the PCR protocols themselves differed between the trials, these figures must be interpreted with caution. However, the overall results indicate a considerable gain in sensitivity when PCR was added to culture, but a moderate gain in addition to serology.

Immunomagnetic separation and solid-phase detection of Bordetella pertussis.

In the present study, novel solid-phase methods were used for both sample preparation and PCR detection of Bordetella pertussis. The sample preparation was performed by immunomagnetic separation with paramagnetic beads coated with polyclonal antibodies directed toward the surface antigens of the bacteria. The precoated immunobeads were directly used on nasopharyngeal aspirates to capture the bacteria on the solid support and were subsequently transferred to the PCR tube with no further manipulations. The region encompassing the pertussis toxin promoter was analyzed to allow direct discrimination between the three major Bordetella species (B. pertussis, B. parapertussis, and B. bronchiseptica). The resulting amplicons were captured on a second magnetic solid phase, allowing detection and restriction analysis of the target sequence. A colorimetric detection system based on a DNA binding fusion protein enabled the use of standardized enzyme-linked immunosorbent format tests both for the detection of Bordetella spp. and for species evaluation. When the optimized system was evaluated on 55 clinical aspirate samples, 21 of 22 (95%) culture-positive samples were positive by the system that we developed. In addition, two samples were positive by the PCR-based assay, while the culture assay was negative. The implications of these results are discussed.

Validation of nested Bordetella PCR in pertussis vaccine trial.

A nested PCR, using a 239-bp sequence in the pertussis toxin promoter region, was developed and evaluated. The assay differentiates Bordetella pertussis, Bordetella parapertussis, and Bordetella bronchiseptica by restriction enzyme analysis of the amplified fragments. The diagnostic performance of the PCR was evaluated in a Swedish pertussis vaccine efficacy trial which took place from 1992 to 1995, including study children and household members and using culture and serology for laboratory confirmation of suspected cases. In total 2,421 nasopharyngeal aspirates were analyzed. The total diagnostic sensitivity for B. pertussis was 90.2% (194 of 215). During the study period samples were processed with and without the cation-exchange resin Chelex. The PCR diagnostic sensitivity for B. pertussis among the Chelex-treated aspirates was 94.9% (75 of 79), and that for B. pertussis among 124 aspirates in a consecutive non-Chelex-treated material was 89.5% (111 of 124). After Chelex treatment of the 13 PCR-negative samples, an additional six became PCR positive, giving a final sensitivity of 94.3%. In addition, PCR was positive for B. pertussis with 57 of 1,744 samples negative by culture but with available serological data. The specificity of PCR with these samples was supported by a significant increase in antibody levels between acute and convalescent sera in 45 cases and by epidemiological or clinical data in all but two of the remaining cases. PCR was also positive for B. pertussis with 26 of 415 aspirates from episodes lacking serology. The diagnostic sensitivity of PCR for B. parapertussis was 74.0% (37 of 50). There were an additional seven culture-negative B. parapertussis PCR findings, six from cases with significant antibody increases against filamentous hemagglutinin only and one from a case lacking serology. There were no samples positive for B. bronchiseptica. In conclusion, PCR detection of B. pertussis and/or B. parapertussis enabled us to identify 90 positive nasopharyngeal aspirates, in addition to the 262 culture-positive samples (an increase of 34%). Relating these cases to serology and clinical data indicated a PCR specificity approaching 100%.

A controlled trial of a two-component acellular, a five-component acellular, and a whole-cell pertussis vaccine.

BACKGROUND: Because of concern about safety and efficacy, no pertussis vaccine has been included in the vaccination program in Sweden since 1979. To provide data that might permit the reintroduction of a pertussis vaccine, we conducted a placebo-controlled trial of two acellular and one whole-cell pertussis vaccines. METHODS: After informed consent was obtained, 9829 children born in 1992 were randomly assigned to receive one of four vaccines: a two-component acellular diphtheria-tetanus-pertussis (DTP) vaccine (2566 children), a five-component acellular DTP vaccine (2587 children), a whole-cell DTP vaccine licensed in the United States (2102 children), or (as a control) a vaccine containing diphtheria and tetanus toxoids (DT) alone (2574 children). The vaccines were given at 2, 4, and 6 months of age, and the children were then followed for signs of pertussis for an additional 2 years (to a mean age of 21/2 years). RESULTS: The whole-cell vaccine was associated with significantly higher rates of protracted crying, cyanosis, fever, and local reactions than the other three vaccines. The rates of adverse events were similar for the acellular vaccines and the control DT vaccine. After three doses, the efficacy of the vaccines with respect to pertussis linked to a laboratory-confirmed case of pertussis or contact with an infected household member with paroxysmal cough for > or = 21 days was 58.9 percent for the two-component vaccine (95 percent confidence interval, 50.9 to 65.9 percent), 85.2 percent for the five-component vaccine (95 percent confidence interval, 80.6 to 88.8 percent), and 48.3 percent for the whole-cell vaccine (95 percent confidence interval, 37.0 to 57.6 percent). CONCLUSIONS: The five-component acellular pertussis vaccine we evaluated can be recommended for general use, since it has a favorable safety profile and confers sustained protection against pertussis. The two-component acellular vaccine and the whole-cell vaccine were less efficacious.

Comparison of five calculation modes for antibody ELISA procedures using pertussis serology as a model.

During a phase III pertussis vaccine trial, serum antibody responses were measured by two enzyme-linked immunosorbent assays (ELISA) for pertussis toxin and filamentous haemagglutinin. These were used both for studies of antibody levels after vaccination and for diagnostic purposes. Since the absorbance values obtained were not directly proportional to the amount of antibody in the samples, ELISA optical densities were transformed to units by calibration to a reference serum. Five different calculation modes were compared. In four of these modes unit calculations were based on the relationship between dose response curves of the serum sample and a reference serum. In addition, traditional endpoint titres were included in the comparison. The calculation mode using reference line units showed the highest reproducibility, with intrassay coefficients of variation (CV) within the same test plate of 4-7% and interassay CVs of 12-14%. The CVs among the other methods ranged from 6 to 31% for intra-assay comparisons and from 12 to 47% for interassay comparisons. Furthermore, the CV values for intra-assay variations were used to calculate standardized differences between 79 pairs of acute and convalescent sera from cases confirmed by culture. These differences were then used to estimate the 'diagnostic sensitivity' for the different calculation modes. The results indicated that use of the reference line units was the most sensitive, whereas use of the end point titers was the least sensitive of these calculation modes.

Diagnostic evaluation of polymerase chain reaction discriminative for Bordetella pertussis, B. parapertussis, and B. bronchiseptica.

A polymerase chain reaction (PCR) procedure for simultaneous detection and identification of Bordetella pertussis, B. parapertussis, and B. bronchiseptica was developed and evaluated against culture in a study comprising nasopharyngeal aspirates and swabs from 166 patients with suspected pertussis, 54 of which were culture positive. A 239-base-pair sequence in the pertussis toxin promoter region was amplified using primers Bouni 1: 5'GCACCATCCCGCATACGTGTTG3', and Bouni 2: 5'GTGCAACGCATCCCGTCTTCC3'. The sequence contains mutations in B. parapertussis and B. bronchiseptica, and species were differentiated by restriction enzyme cleavage of the amplified product. The lowest detectable amount of B. pertussis DNA was 0.1 pg (equals approximately 30 bacteria). No false positives were found in clinical samples or among 18 other species. Treatment of 66 aspirates with a weak cation exchange resin increased the diagnostic sensitivity of PCR. Two culture-positive aspirates were negative by PCR, but grew with a single colony among contaminating flora and could be identified only after PCR analysis of the colony material. The amount of positive cases was increased from 13 by culture to 19 by the addition of PCR. Six samples positive by PCR were culture negative. All six patients showed clinical and epidemiologic evidence of pertussis, and three patients had been treated with antibiotics. PCR increased the sensitivity of pertussis case finding with retained specificity and can be used for laboratory diagnosis of whooping cough.

Comparison of nasopharyngeal aspirates with swabs for culture of Bordetella pertussis.

Nasopharyngeal samples were collected from 117 children by aspiration from one nostril and by swab from the other one and cultured for Bordetella pertussis. Among 33 culture-positive specimens, there were 30 positive aspirates and 26 positive swab specimens. Aspirates are easily divided and saved for investigations with other assays which may further improve diagnostic sensitivity. As the aspiration technique was also preferred by nurses and parents, it was recommended and chosen for a planned pertussis vaccine efficacy trial to take place in Sweden from 1992 to 1995.

Evaluation of an improved DNA probe for diagnosis of pertussis.

A Bordetella pertussis specific subclone, pRZ61, of a Bordetella genus-specific clone, pB23, was evaluated on nasopharyngeal aspirates of 179 patients with suspected pertussis. Hybridization was performed directly after spotting or after 1-3 days of preculture of the nylon membranes on solid culture medium. A direct comparison of the two probes was obtained by reprobing with the subclone the same membranes that had been hybridized with the parent probe. pRZ61 detected 50% of the serologically defined cases of pertussis, that is, had the same sensitivity as standard culture. Specificity as compared with serology was close to 100%. The increasing sensitivity and the corresponding decreasing specificity after preculture noted for pB23 was not seen with the subclone. The study showed that the improved probe represents a rapid diagnostic method in pertussis.

DNA hybridization for diagnosis of pertussis.

The aim of the present study was to evaluate a mixed phase DNA hybridization assay for detection of Bordetella pertussis and Bordetella parapertussis in nasopharyngeal aspirates from patients with suspected pertussis. Among 179 consecutive patients with own or parental suspicion of pertussis, the diagnosis was confirmed in 103 patients by serology and in 52/103 (50%) cases also by culture. The remaining 76 patients served as nonpertussis controls. Direct hybridization was positive in 38% samples with serology as reference method, a non-significant difference to the 50% sensitivity for culture. Preculture of samples on membranes for 24, 48 and 72 h gave a significantly higher sensitivity only with 72 h preculture, 69% vs 50% (P = 0.007). The 72h preculture gave, however, also a significant decrease of specificity, 87% vs 100% for routine culture (P = 0.001) and is not a more rapid diagnostic method. The result shows that rapid diagnosis by DNA hybridization can be achieved in a large proportion of pertussis cases. The presence of smaller numbers of bacteria in samples only positive after preculture indicate that DNA hybridization could be a highly sensitive diagnostic method with further development of more rapid amplification systems.

A DNA hybridization test for detection of Bordetella in nasopharyngeal specimens.

A cloned Bam H1 fragment of genomic Bordetella pertussis DNA which recognized a frequently repeated sequence in the genome of B. pertussis was used as a probe in a DNA hybridization assay for the detection of Bordetella. Extensive studies on cross-reactivity were carried out in standardized strains and in cultured swab specimens from patients without suspected pertussis. Hybridizations of cultured clinical specimens from 142 patients with suspected pertussis were in complete agreement with the standard identification methods. The recovery rate of B. pertussis from nasopharyngeal swabs was less than 50%. Therefore the possibility to detect low numbers of B. pertussis in solution (nasopharyngeal aspirates) was investigated. The detection limit of direct hybridization by dot-blot technique was 5 x 10(3)-10(4) B. pertussis. Culturing bacteria on membranes placed on agar plates prior to hybridization showed that the detection limit could be lowered to 10(4), 10(2), and 10(1) cfu after 1, 2 and 3 days' culture, respectively. DNA hybridization under these conditions was found to be sufficiently sensitive and specific for further evaluation in clinical specimens for diagnosis of pertussis.